이 작품은 우수 온타리오 센터와 온타리오 연구 기금 JK 보조금에 의해 가능하게되었다. 우리는 촬영하는 동안 기술 지원을 Siddika Pardhan 박사 피터 퍼거슨 감독에게 감사의 말씀을 전합니다.

참고 : 다음 프로토콜이 부착 세포와 함께 사용하도록 설계되었습니다. 수정은 정지에서 재배 비 부착 세포에 방법을 적용해야합니다. 프로토콜에 설명 된 CAM 실험은 형광 표지 (예를 들면, GFP, RFP 등)를 발현하는 세포와 함께 사용하도록 설계된다. 나인 일된 닭 배아 CAM 실험에 대한 실험 프로토콜의 2 일에 필요합니다. 1. 준비 및 안티센스 올리고 뉴클레오티드와 종양 세포의 형질 (ASOS) <ol><li> 관심의 세포를 포함하는 T75 플라스크 (들)에서 대기음 매체는 1XPBS로 세척하고, 0.25 % 트립신 / EDTA 2 ㎖를 추가합니다. 각 플라스크에 완전 성장 배지 10 ㎖를 첨가하고 50 ㎖ 튜브 용액에 세포를 옮긴다. 세포를 세어 최종 농도는 1 ㎖ 당 1.0 × 105 세포가되도록 양을 조정한다. </li><li> T25 플라스크의 라벨 두 그룹 : 한 그룹은 1-8 표시 여덟 플라스크를 포함하며, U 될 것입니다실시간 대사 측정 실험 SED; 두 번째 그룹은 8 주 형틀을 포함하고 닭 배아 CAM 실험에 사용한다. 인큐베이터에있는 각 플라스크 및 장소 (37 ° C, 5 % CO 2 O / N)에 솔루션 세포 2 ㎖를 추가합니다. </li><li> 다음날 아침 (주 0, 0 분), 라벨 세 5 ml의 튜브를 다음과 같이 제어 (비 대상 ASO 또는 siRNA를), &#39;관심의 대상&#39;(즉, 대상 ASO 또는 siRNA를), 리포 펙 타민 2000 (또는 유사한 형질 전환 시약). 적합한 튜브에서 무 혈청 배지로 적당한 농도 ASO 스톡 용액을 희석. <ol><li> 적절한 튜브에 형질 전환 시약의 요구량을 첨가하고, 5 분 동안 무 혈청 배지에서 배양한다. ASO 튜브에 형질 전환 시약 솔루션을 추가하고 20 분 동안 품어. </li></ol></li><li> 각 그룹에서 플라스크 1-4의 각 제어 ASO 형질 전환 시약 용액 250 μl를 추가, 250각각의 그룹 내의 5-8 플라스크 각각에 &#39;관심 대상&#39;ASO 형질 감염 시약 용액 μL. 4 시간 (37 ᵒC, 5 % CO 2)에 대해 품어. <ol><li> 배양하는 동안, 2.1 절에 설명 된 단계를 수행한다. 배양 후, CAM 실험 그룹의 각 플라스크에 완전 배지 3 ㎖을 추가하고 인큐베이터로 복귀 O / N (37 ᵒC, 5 % CO 2). 2.2 절에 설명에 따라 대사 실험 그룹을 처리합니다. 섹션 4의 설명에 따라 설정 CAM 실험을 처리합니다. </li></ol></li></ol> 2. 바이오 센서 칩 준비 및 셀 시드 <ol><li> 무균 환경에서 조심스럽게 PBS 400 ㎕의 여섯 바이오 센서 칩을 씻는다. 20 분 동안 70 % 에탄올 400 μL와 칩 멸균. PBS의 400 μL로 3 회 세척 할 것. <ol><li> 무균 조직이 배양 내부의 칩을 배치전자 요리 오염을 방지합니다. &#39;제어&#39;라고 표시된 접시에 세 개의 칩을 놓고 &#39;관심의 대상&#39;이라는 레이블이 붙은 접시에 세. </li></ol></li><li> &#39;제어&#39;와 &#39;관심의 대상&#39;으로 두 개의 50 ㎖ 튜브 레이블. PBS로 세포를 씻으 0.25 % 트립신 / EDTA의 적절한 볼륨을 추가합니다. 단일 층 분리 될 때까지 기다린 후 각 플라스크에서 세포를 수집합니다. 적절한 튜브에 용액을 증착. <ol><li> 세포를 세어 6.0x10 최종 농도가 105 세포 / ㎖가되도록 양을 조정한다. 초기 농도가 너무 낮 으면 원심 분리하고 세포를 재현 탁. </li></ol></li><li> (칩당 1.25x10 5 세포의 총) 해당 그룹의 각 바이오 센서 칩에 셀 용액 250 μL를 추가한다. 칩 혼란의 위험을 최소화하기 위해 한 번에 하나의 그룹이 태스크를 수행한다. 증발을 방지하기 위하여 습도 챔버 내부의 칩을 함유하는 멸균 접시를 놓은 습도 차를 배치mber 인큐베이터에서 O / N (37 ᵒC, 5 % CO 2). </li><li> 이튿날 아침 (주 1)은, 각 칩으로부터 신중 매체 대기음 0.2 % 소 태아 혈청 (FBS) 및 1X 페니실린 및 스트렙토 마이신 (P / S)이 보충 된 성장 배지 250 μL로 대체. 4 시간 (37 ᵒC, 5 % CO 2)에 대해 품어. </li></ol> 3. 대사 측정 시스템 준비 및 솔루션 준비 <ol><li> 배양 중에 필요한 약액과 다가오는 대사 분석 용 측정 시스템을 준비한다. 참고 : 대사 측정 시스템은 여섯 모듈의 총이 포함되어 있습니다. 각 모듈은 실험 당 하나의 칩을 수용한다. <ol><li> 다음 실험 그룹으로 분석 세분 : 하나의 칩을 &#39;제어&#39;와 분석의 기간 동안 차량을받을 수있는 그룹 &#39;관심의 대상&#39;에서 각각; 각 그룹은 두 개의 칩 중 소정의 기간에 대한 약물 치료를받을ssay, 세척 기간 동안 차량 하였다. </li><li> 감작 약물 연구의 경우, 해당 특정 약물에 맞는 약물 치료의 길이, 타이밍 및 농도를 변경. 주 : 시스플라틴의 경우, 다음 단계는 A549 세포와 경험적으로 결정하고, 세포주에 따라 달라질 수있다. 4 μL / 분의 기본 유량을 갖는 모든 단계를 수행한다. 성장 배지 + 0.2 % FBS, 1X 및 P / S 6 HR 매체에서 6 μM 시스플라틴의 24 시간 + 0.2 % FBS 1 배 P / S 성장 배지 + 0.2 % FBS, 1X 및 P / S에 24 시간 성장 배지 + 0.2 % FBS, 1X 및 P / S (18)의 HR 0.1 % 트리톤 X의 4 시간 참고 :이 단계로부터의 편차 원하는 유량과 실험의 지속 기간에 기초하여 중간 및 약물 용액의 필요한 양을 결정하기 위해 계산을 필요로 할 것이다. 다음 섹션은 위에서 설명 된 단계를 기준으로합니다. </li></ol></li><li> 라벨 및 성장 배지 + 0.2 % FBS를 50 ml의 열네 50 ㎖ 튜브를 채우기D 1 배 P / S. 한 대사 측정 시스템 튜브 랙에 여섯, 다른 여섯, 또한 시스플라틴과 튜브가 들어 세 번째 튜브 랙의 나머지 두 놓습니다. 증발을 방지하기 위하여 공기 투과성 막을 처음 두 실 랙. </li><li> 1 배 P / S 중간 + 0.2 % FBS에서 (해당 볼륨의) 6 μM 시스플라틴의 솔루션을 준비합니다. 네 표지 50 ㎖ 튜브에 시스플라틴 용액의 필요한 양을 분배. <ol><li> 세 번째 대사 측정 튜브 랙에 남아있는 4 개의 슬롯에 튜브를 놓습니다. 튜브가 원하는 biomodules에 해당하는 해당 슬롯에 배치되어 있는지 확인합니다. 공기 투과 막으로 튜브를 밀봉합니다. </li></ol></li><li> 준비하고 여섯 50 ㎖ 튜브에 라벨을 20 ml의 배지에서 0.1 % 트리톤-X 솔루션의 각각을 입력합니다. 트리톤-X 솔루션은 남아있는 세포를 용해하고 각각의 칩에 대한 &#39;제로&#39;가치를 제공 할 것입니다. 네 번째 대사 측정 단위 튜브 랙에 튜브를 삽입하고 재치 밀봉H 과도한 증발을 방지하기 위해 공기 permable 막. </li><li> biomodules에 칩을 넣고 실험을 시작합니다. </li></ol> 4. CAM 실험 약물 치료와 주사 참고 : CAM 실험을위한 닭 배아를 준비하는 단계와 절차는 다른 19 설명되어 있습니다 <ol><li> CAM 실험 48 시간 후 - 형질 전환 (2 일)을 처리하기 시작합니다. 두 차량 플라스크 및 시스플라틴 두에 &#39;제어&#39;와 그룹 &#39;관심의 대상&#39;을 하위 나눕니다. 플라스크에서 매체를 대기음 3 신선한 매체의 ml의, 또는 6 μM 시스플라틴 (cisplatin) 중 하나와 함께 보충. 6 시간 (37 ᵒC, 5 % CO 2)에 대해 품어. </li><li> 세척 한 후, 매체를 대기음 세포를를 Trypsinize; 네 적절하게 레이블 15 ml의 튜브에 용액에 트립신 세포를 수집합니다. <ol><li> 원심 분리기와 PBS로 세포를 세 번 씻는다. PBS 5ml에 세포 펠렛을 다시 일시세포를 카운트 좋아. </li><li> 최종 세포 농도가 1.0 × 6 세포 / ml가되도록 양을 조정한다. 주입 표지 5 ml의 튜브에 세포 솔루션을 전송하고 얼음에 배치합니다. 세포가 잘 혼합되도록 조심스럽게 주입 전에 튜브를 전환. </li></ol></li><li> 주사 (9 일 이전) (24) 닭의 배아 (그룹 당 6)의 총을 옆으로 설정합니다. 1 ml의 시린지에 연결된가요 성 튜브에 부착 된 유리를 사용하여 바늘 주사를 수행한다. 주입을 수행하는 개별 처리 그룹 멀게한다. <ol><li> 스테레오 현미경을 이용하여, CAM의 정맥 순환에 1.0 × 100 μL 부피의 5 세포를 주입. 세포의 전체 볼륨을 주입하는 속도가 느린, 맥동 기술을 사용합니다. 부드러운 혈액의 흐름을 줄기 및 유출을 흡수 닦아 부드럽게 주사 부위를 가볍게 두 드리십시오. 적절하게 각 주입 다음 각 배아 컨테이너 레이블. </li></ol></li><li> 존재와 DISTRI 확인CAM의 혈관 세포의 형광 bution는 형광 현미경을 사용하여 가시화하여 주 사후. 종양 세포의 수가 적을 나타나거나 유통이 좋지있는 모든 배아에주의하십시오. </li><li> 습도 챔버에서 닭 배아를 놓고 인큐베이터 (37 ° C, 습도 60 %)에 저장합니다. 전이성 초점을 열거하기 전에 7~9일 기다립니다. </li></ol> 5. 전이성 초점 열거 <ol><li> 7~9일 배양 기간 동안 배아를 모니터링하고 죽은 사람을 버린다. 습도 챔버는 배양 기간 동안 항상 습기가 남아 있는지 확인합니다. </li><li> 20X 배율 스테레오 형광 현미경을 이용하여, 정규, 격자 형상의 패턴으로 배아 CAM의 전체 상부 표면을 스캔. </li><li> 다음 배아 당 최종 총 수를 집계, 뷰의 각 필드에 전이 병소의 수를 계산합니다. 각 그룹의 여섯 배아 이렇게하면 평균 O를 제공 할 것입니다치료 당 F 전이성 초점. </li></ol>

<ol>
	<li>Bouwman, P., Jonkers, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+effects+of+deregulated+DNA+damage+signalling+on+cancer+chemotherapy+response+and+resistance.">The effects of deregulated DNA damage signalling on cancer chemotherapy response and resistance.</a> Nat Rev Cancer. 12, 587-598 (2012).</li><li>Bozic, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evolutionary+dynamics+of+cancer+in+response+to+targeted+combination+therapy.">Evolutionary dynamics of cancer in response to targeted combination therapy.</a> Elife. 2, e00747 (2013).</li><li>Diaz, L. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+molecular+evolution+of+acquired+resistance+to+targeted+EGFR+blockade+in+colorectal+cancers.">The molecular evolution of acquired resistance to targeted EGFR blockade in colorectal cancers.</a> Nature. 486, 537-540 (2012).</li><li>Hanahan, D., Weinberg, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hallmarks+of+cancer:+the+next+generation.">Hallmarks of cancer: the next generation.</a> Cell. 144, 646-674 (2011).</li><li>Rytelewski, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inhibition+of+BRCA2+and+Thymidylate+Synthase+Creates+Multidrug+Sensitive+Tumor+Cells+via+the+Induction+of+Combined+'Complementary+Lethality'.">Inhibition of BRCA2 and Thymidylate Synthase Creates Multidrug Sensitive Tumor Cells via the Induction of Combined 'Complementary Lethality'.</a> Mol Ther Nucleic Acids. 2, e78 (2013).</li><li>Lord, C. J., Ashworth, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+DNA+damage+response+and+cancer+therapy.">The DNA damage response and cancer therapy.</a> Nature. 481, 287-294 (2012).</li><li>Helleday, T., Petermann, E., Lundin, C., Hodgson, B., Sharma, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+repair+pathways+as+targets+for+cancer+therapy.">DNA repair pathways as targets for cancer therapy.</a> Nat Rev Cancer. 8, 193-204 (2008).</li><li>Shaheen, M., Allen, C., Nickoloff, J. A., Hromas, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Synthetic+lethality:+exploiting+the+addiction+of+cancer+to+DNA+repair.">Synthetic lethality: exploiting the addiction of cancer to DNA repair.</a> Blood. 117, 6074-6082 (2011).</li><li>Green, S., Benedetti, J., Smith, A., Crowley, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Clinical trials in oncology. 28, (2012).</li><li>Begley, C. G., Ellis, L. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Drug+development:+Raise+standards+for+preclinical+cancer+research.">Drug development: Raise standards for preclinical cancer research.</a> Nature. 483, 531-533 (2012).</li><li>Galluzzi, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+definitions+of+cell+death+subroutines:+recommendations+of+the+Nomenclature+Committee+on+Cell+Death+2012.">Molecular definitions of cell death subroutines: recommendations of the Nomenclature Committee on Cell Death 2012.</a> Cell Death Differ. 19, 531-533 (2012).</li><li>Ruggeri, B. A., Camp, F., Miknyoczki, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Animal+models+of+disease:+pre-clinical+animal+models+of+cancer+and+their+applications+and+utility+in+drug+discovery.">Animal models of disease: pre-clinical animal models of cancer and their applications and utility in drug discovery.</a> Biochem Pharmacol. 87, 150-161 (2014).</li><li>Kwon, M. C., Berns, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mouse+models+for+lung+cancer.">Mouse models for lung cancer.</a> Mol Oncol. 7, 165-177 (2013).</li><li>Young, M., Ordonez, L., Clarke, A. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=What+are+the+best+routes+to+effectively+model+human+colorectal+cancer.">What are the best routes to effectively model human colorectal cancer.</a> Mol Oncol. 7, 178-189 (2013).</li><li>Sharma, S. V., Haber, D. A., Settleman, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell+line-based+platforms+to+evaluate+the+therapeutic+efficacy+of+candidate+anticancer+agents.">Cell line-based platforms to evaluate the therapeutic efficacy of candidate anticancer agents.</a> Nat Rev Cancer. 10, 241-253 (2010).</li><li>Garnett, M. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Systematic+identification+of+genomic+markers+of+drug+sensitivity+in+cancer+cells.">Systematic identification of genomic markers of drug sensitivity in cancer cells.</a> Nature. 483, 570-575 (2012).</li><li>Alborzinia, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Real-time+monitoring+of+cisplatin-induced+cell+death.">Real-time monitoring of cisplatin-induced cell death.</a> PLoS One. 6, e19714 (2011).</li><li>Cvetkovic, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=KISS1R+induces+invasiveness+of+estrogen+receptor-negative+human+mammary+epithelial+and+breast+cancer+cells.">KISS1R induces invasiveness of estrogen receptor-negative human mammary epithelial and breast cancer cells.</a> Endocrinology. 154, 1999-2014 (2013).</li><li>Leong, H. S., Chambers, A. F., Lewis, J. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Assessing+cancer+cell+migration+and+metastatic+growth+in+vivo+in+the+chick+embryo+using+fluorescence+intravital+imaging.">Assessing cancer cell migration and metastatic growth in vivo in the chick embryo using fluorescence intravital imaging.</a> Methods Mol Biol. 872, 1-14 (2012).</li><li>Hung, Y. P., Albeck, J. G., Tantama, M., Yellen, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Imaging+cytosolic+NADH-NAD(+)+redox+state+with+a+genetically+encoded+fluorescent+biosensor.">Imaging cytosolic NADH-NAD(+) redox state with a genetically encoded fluorescent biosensor.</a> Cell Metab. 14, 545-554 (2011).</li><li>Tantama, M., Hung, Y. P., Yellen, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Imaging+intracellular+pH+in+live+cells+with+a+genetically+encoded+red+fluorescent+protein+sensor.">Imaging intracellular pH in live cells with a genetically encoded red fluorescent protein sensor.</a> J Am Chem Soc. 133, 10034-10037 (2011).</li><li>Rytelewski, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=BRCA2+inhibition+enhances+cisplatin-mediated+alterations+in+tumor+cell+proliferation,+metabolism,+and+metastasis.">BRCA2 inhibition enhances cisplatin-mediated alterations in tumor cell proliferation, metabolism, and metastasis.</a> Mol. Onc. 8 (8), 1429-1440 (2014).</li></ol>

저자가 공개하는 게 없다.

때문에 임상 시험과 관련된 고유의 비용과 위험에, 더 적절하게 신규 항암 치료법을 평가하기위한 예비 임상 시험 방법론보다 엄격한 개발이 요구된다. 현재 일반적으로 사용되는 기술 덜 효과​​적 일 수있다 모든 전시 잠재적으로 유망한 치료 대상 / 에이전트를 구별하는 능력을 제한 할 수 있습니다 약점, 그리고 그. 우리는 기존 방식의 많은 단점을 해결 새로운 항암 접근법을 평가하는 프로토콜을 고안했다. 설명 프로토콜의 특히 중요한 기능은 실시간으로 세포 반응을 측정하고, 분에 의해 신진 대사와 고수 분의 변화를 추적 할 수있는 기능입니다. 이것은 피크 약물 효과, 최적 투여 식별 및 조합 약물 치료의 구성 요소들 사이의 상호 작용의보다 상세한 이해를 위해 허용한다. 동시에, 그것은 discre에 대한 통찰력을 제공합니다셀 카운팅, 아폽토시스, 또는 염료 변환 분석법에 의해 제공되지 않은 정보는 암세포, 테 대사 변화. 이 분석의 한계를 정확하게 약물 치료 중에 발생되는 세포사의 종류를 판별 할 수 없다는 것이다. 생존율의 변화는 바이오 센서 칩에 부착의 변화에​​ 의해 반사되지만, 이것은 세포 죽음의 방식에 관한 정보를 제공하지 않는다. 또한 유사한 대사 데이터를 결정하기 위해 형광 현미경을 사용하여 세포 이미징 기법을 살 수 있고, 이것은이 프로토콜 (20, 21)에 기재된 실험에 더하여 사용될 수있다. 또한, 닭 배아 CAM 모델의 사용은 다음과 같은 치료 전이성 주파수를 연구하는 새로운 타겟이, 약물, 또는 약물 조합 extravasate 및 / 또는 주변 조직 침입 암 세포의 빈도를 감소 여부를 확인할 수있는 효과적인 방법이다. 이 CLI에서 특히 관련 질문입니다nical 관점은 전이성 암 환자의 사망률 사이의 높은 비율을 초래하기 때문이다. 전위 제한 요소는 실제 약물 치료는 CAM에서 발생하지 않는다는 것이다. 그 대신, 생체 발생 전처리 된 세포를 CAM에 주입된다. 따라서,이 분석은 생체 내에서 약물의 흡수 또는 배포에 관한 정보를 제공하지 않습니다. 또한, 정맥 CAM 주사는 기술적으로 도전하고 중요한 연습 / 경험을 필요로한다. 우리는 DNA 손상 약물 시스플라틴에 종양 세포를 감작하는 BRCA2 타겟팅 ASO의 능력을 평가하기 위해,이 프로토콜을 사용했다. 실험의 결과는 치료를위한 유망한 공격 대상으로 BRCA2를 식별하고, 또한 약물 후보로서 BRCA2 ASO 더 전임상 개발을위한 이론적 근거를 제공 하였다. 특히 우리는 DN의 급성장 필드에서 조합 치료를 위해 신규 대상을 식별하기 위해 사용되는 프로토콜이 구상수리 억제. 우리는이 프로토콜이 가장 엄격하게 더 새로운 항암 접근법을 평가하기위한 노력으로, 암 생물학에서 일반적인 기술 외에 사용될 느낀다.

세포 독성 암 치료는 치료 실패, 재발로 이어질 수있는 중요한 임상 적 문제가 대상 및 / 또는에 대한 내성을 획득하고, 환자 사망률 1 증가했다. 대부분의 종양에서 이질성의 높은 수준을 고려할 때, 충분히 높은 세포 수의 종양은 그 세포가 생존 2,3- 대해 의존하는 분자 경로를 표적으로 단일 또는 조합 요법에 내성 세포의 서브 세트를 포함 할 것이다 수학적 확실성이다. 종양 세포에 긍정적 재발 선도, 치료 기간 동안 선택 될 수있다. 동시에 전 또는 치료 매개 선택 이후에, 다른 암 세포 생존 메카니즘을 대상 신규 치료법의 개발은, 따라서 임상 적으로 중요한 것이다. 종양에서 게놈의 불안정성 게놈 돌연변이의 높은 수준의 비 종양 (4) 숙주 세포로부터 암세포를 구별 기본적인 특징이다. 따라서, usefu- DNA 손상 화학 요법의 효능을 증가시키는 저항의 발생을 예방하기 위해 L 전략 적극적 종양 세포 5 DNA 복구를 억제하는 것이다. 이것은 예비 임상 탐구되고 조사 및 신규 DNA 복구 다양한 대상의 활성 필드이다. 이들 소분자 또는 안티센스 표적 계 억제제의 수는 개발되어 6-8 테스트 겪고있다. 목적은 임상 시험에서 안전성과 효능을 가장 유망한 전임상 후보를 식별하고 평가하는 것입니다. 임상 시험의 고비용 (차선 전임상 평가를 포함한 여러 이유로) 실패의 위험이 새로운 치료법의 개발에 9 진행 강력한 장애물이다. 적절히 치료 대상 및 새로운 약물 후보를 평가할 수있는 적절하고 엄격한 전임상 모델의 사용은 임상 시험 (10)의 높은 실패율을 감소시킬 수있다 </suP&gt;. 시험 관내 (세포 증식 분석법) 종양 세포의 능력에있어서, b) 치료 - 유도 환원에서 종양 세포의 증식을 감소시키는 능력) 측정 : 일부 공통적으로 사용 전임상 방법은 신규 한 항암 요법의 효과이다을 평가 폼 조직 배양 콜로니 (콜로니 형성 어 세이) 시험 관내 (레 독스 염료 변환) 시험 관내 종양 세포 사멸, d) 요법 - 유도 유도 (세포 사멸, 괴사가 포식이 연관된 종양 세포 대사 활동에있어서, c) 요법 - 유도 환원 생체 내에서 유사 분열 등) (11), 전자)와 함께 인간과 마우스 이종 이식 12-14의 성장 또는 절제의 감소를 치료 유도. 체외 나열된 방법 중 가장 큰 문제점은 이들 중 어느 것도 후보 치료제의 효과를 실시간 평가를 제공하지 않는다는 것이다. 오히려, 그들은 단지 선택된 넓게 분리 된 시점에서 정보를 제공 할치료 과정 동안. 이러한 측정은 정확하게 종양 세포 반응의 강도 및 타이밍을 반영하는 능력을 감소 하였다. 생체 내 마우스 이종 이식 모델은 또한 높은 비용, 완료하는 시간의 길이, 차선 투여 및 치료시기 (스케줄링)의 위험에 의해 제한된다. 또한, 설치류 이종 이식 모델 차 인간 종양 세포의 반응을 시험 관내 평가와 비교하여 인간에서의 임상 효능 한정 예측 및 후보 치료 개입 (15, 16)에 확립 된 인간 종양 세포주가 있다는 증거가있다. 우리는 위에서 설명한보다 일반적인 절차의 단점을 해결하는 방식으로, 예비 임상 신약 조합을 평가하기 위하여 새로운 조합 프로토콜을 고안했다. 증식, 콜로니 형성 또는 산화 환원 염료 변환 분석 대신에, 우리는 실시간으로 세포 부착, 호흡, 산성화를 분석 대사 측정 유닛을 이용전체 치료 기간 동안 17. 동시에, 우리는 닭 배아 침윤 및 전이의 융모 18,19 막 (CAM) 모델을 사용하여 생체 내에서 조합 치료의 효과를 조사 하였다. 우리는 일반적으로 사용되는 화학 요법 약물 시스플라틴의 효과를 강화시키는 데 BRCA2 타겟팅 안티센스 올리고 뉴클레오티드 (ASO)의 능력을 평가하기 위해 다음 방법을 사용 하였다.

<table><tbody><tr><td>A549 cells</td><td>ATCC</td><td>CCL-185</td><td>http://www.atcc.org/products/all/CCL-185.aspx</td></tr><tr><td>AeraSeal film</td><td>Carl Roth GmbH</td><td></td><td></td></tr><tr><td>AMEM</td><td>Wisent Bioproducts</td><td>210-011-QK</td><td></td></tr><tr><td>Antisense oligodeoxynucleotides</td><td>Avecia</td><td></td><td>BRCA2 target sequence: 5&#039; - UAAGGAACGUCAAGAGAUAC - 3&#039; (bases 7241-7259 )</td></tr><tr><td>Axio Zoom V16 Microscope</td><td>Carl Zeiss</td><td></td><td>http://www.zeiss.ca/microscopy/en_ca/products/stereo-zoom-microscopes/axio-zoom-v16.html</td></tr><tr><td>Bionas Biosensor Chips</td><td>Bionas GmbH and Micronas GmbH</td><td>BIS8001D</td><td></td></tr><tr><td>Bionas Discovery 2500 System&amp;nbsp;</td><td>Bionas GmbH</td><td></td><td>http://www.bionas-discovery.com/prodservices/instruments/system2500/</td></tr><tr><td>Cisplatin</td><td>Sigma Aldrich</td><td>479306</td><td></td></tr><tr><td>Fertilized chicken eggs</td><td>Sourced locally</td><td></td><td></td></tr><tr><td>Fetal bovine serum&amp;nbsp;</td><td>Gibco - Life Technologies</td><td></td><td></td></tr><tr><td>Lipofectamine 2000&amp;nbsp;</td><td>Invitrogen - Life Technologies&amp;nbsp;</td><td>12566014</td><td>http://www.lifetechnologies.com/ca/en/home/life-science/protein-expression-and-analysis/transfection-selection/lipofectamine-2000.html</td></tr><tr><td>PBS</td><td>Wisent Bioproducts</td><td>311-010-CL</td><td></td></tr><tr><td>Trypsin (0.25%)/EDTA</td><td>Wisent Bioproducts</td><td>325-043-CL</td><td></td></tr></tbody></table>

evaluating the effectiveness of cancer drug sensitization in vitro and in vivo

이질성 때문에 동일한 경로를 대상으로 인간의 암 치료 단독 투여 또는 조합 요법에 내재 돌연변이 하이 레벨로, 실패 할 가능성이있다. 중점 치료에 고유 및 / 또는 적응 저항에 대한 책임이 있습니다 경로의 억제에 배치해야합니다. 조사의 활성 필드는 일반적으로 개발 및 화학 요법과 방사선 요법을 사용의 작용을 촉진하고, 내성을 방지 DNA 수리 억제제의 시험이다. 우리는 DNA 손상 약물 시스플라틴에 종양 세포를 감작하는 수단으로 BRCA2 억제의 효과를 평가하기 위해 신규 한 프로토콜을 사용했다. 종양 세포 대사 (호흡 산성화)는 분 단위로 분에 치료 효과를 묘사하기 위해 72 시간 동안 실시간으로 모니터링 하였다. 조합에서, 우리는 닭 배아 융모 막 (CAM) 혈관 외 유출과 침략의 모델을 이용하여 전이 주파수의 평가를 수행 하였다. 이프로토콜은 새로운 암 치료 요법을 평가하기 위해 생체 외 및 생체 방법에 사용되는 일반적으로의 약점 중 일부를 해결합니다. 이는 이러한 세포 증식 분석, 세포 사멸 분석과 같은 일반적인 방법에 더하여 사용될 수 있으며, 생체 내 뮤린 이종 이식 연구에서 더욱 밀접 후보 타겟 및 에이전트들 사이를 구별하고, 또한 개발을위한 가장 유망한 후보를 선택한다.

결과 및 수치는 출판 일 (22)의 허가 적응. BRCA2 억제 시스플라틴 처리 된 종양 세포 호흡의 감소를 유도 ASO를 BRCA2가 타겟팅 및 시스플라틴 단독 제어 ASO 시스플라틴을받은 세포에 비해 호흡에서 이른 감소 및 비가역을 나타내 처리 인간 A549 폐암 세포; 처리 된 세포를 시스플라틴 치료 24 시간 BRCA2 ASO 제어 ASO 호흡 사이의 차이 후 39 % (도 1a)이었다. 중요한 것은, 호흡 감소는이 세포 수의 변화와 무관 발생한 것을 시사 세포 부착에서 검출 드롭 전에 시작했다. 호흡은 호흡 저하는 세포 사멸 (그림 1B)를 앞에 조형 이벤트가 될 수 있음을 시사 접착의 첫 번째 관찰 드롭이 약 10 시간을 감소하기 시작했다. 교류에 차이 없음idification은 BRCA2 ASO와 시스플라틴 치료가 당 대사 (그림 1C)에 거의 영향이 있는지 제안, 72 시간의 실험 시간 프레임 동안 관찰되었다. 시스플라틴 치료와 결합 BRCA2 억제는 전이 주파수를 감소 인간 A549 폐암 세포는 시스플라틴의 존재 또는 부재 또는 BRCA2 제어 ASO ASO으로 처리하고, CAM (도 2a)의 순환 정맥 내로 주사 하였다. 감염 후 구일는 BRCA2 ASO 시스플라틴 처리 한 세포는 단독으로 제어 ASO 시스플라틴 또는 BRCA2 ASO (도 2B)로 처리 한 세포에 비해 전이성 병소의 77 %보다 낮은 빈도를 보였다. 이것은 BRCA2 ASO과 시스플라틴 치료하거나, 감소 또는 고형 종양을 가진 환자에서 전이성 부담을 방지 할 수있는 잠재력을 가지고 있음을 시사한다. <img alt="그림 1"SRC = &quot;/ 파일 / ftp_upload / 52388 / 52388fig1highres.jpg&quot;/&gt; 종양 세포 부착, 호흡, 산성화. A549 세포 그림 1. 실시간 모니터링에는 바이오 센서 칩 상에 도금, BRCA2로 형질 ASO 및 Bionas 검색 시스템을 이용하여 24 시간 시스플라틴 처리 하였다. (A) 호흡, (B) 밀착성, 및 (C)의 산성화 측정은 72 시간의 기간 동안 매 4 분을 수행 하였다. 핑크 = 블루 ASO = BRCA2 ASO를 제어, 녹색 = 아소 + 시스플라틴, 빨간색 = BRCA2 ASO + 시스플라틴을 제어 할 수 있습니다. 허가 (22)와 출판 작업에서 적응 그림. <a href="https://www-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/52388/52388fig1large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> <img alt="그림 2" src="/files/ftp_upload/52388/52388fig2highres.jpg" /> 그림 2. 열거 전이성 FREquency 닭 배아 CAM 모델을 사용. ASO BRCA2로 형질 감염 A549 세포를 6 시간 동안 시스플라틴으로 처리하고, 다음 구일 된 닭 배아 (A)의 순환 정맥 내로 주사 하였다. 전이성 초점 (B)는 (40 배의 목적으로 공 초점 현미경을 사용하여 시각) 분사 (C) 9 개의 날을 계수 하였다. 허가 (22)와 출판 작업에서 적응 그림. <a href="https://www-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/52388/52388fig2large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a>

Watch this Scientific Journal Video about Evaluating the Effectiveness of Cancer Drug Sensitization In Vitro and In Vivo at JoVE.com

Evaluating the Effectiveness of Cancer Drug Sensitization In Vitro and In Vivo

Here, real-time monitoring of tumor cell metabolism, combined with an in vivo chicken embryo chorio-allantoic membrane (CAM) model of metastasis, are used to evaluate novel anti-cancer targets/agents for their ability to sensitize tumor cells to DNA damaging chemotherapeutics.

암 약물 과민 반응의 효과를 평가<em&gt; 체외</em&gt; 및<em&gt; 생체</em

Due to the high level of heterogeneity and mutations inherent in human cancers, single agent therapies, or combination regimens which target the same ...

evaluating-effectiveness-cancer-drug-sensitization-vitro

Universidad San Sebastian

Research

JoVE Journal

Medicine

Evaluating the Effectiveness of Cancer Drug Sensitization In Vitro and In Vivo

8.6K 조회수.  Western University. Here, real-time monitoring of tumor cell metabolism, combined with an in vivo chicken embryo chorio-allantoic membrane (CAM) model of metastasis, are used to evaluate novel anti-cancer targets/agents for their ability to sensitize tumor cells to DNA damaging chemotherapeutics. 

비디오: Evaluating the Effectiveness of Cancer Drug Sensitization In Vitro and In Vivo

Establishing Dual Resistance to EGFR-TKI and MET-TKI in Lung Adenocarcinoma Cells In Vitro with a 2-step Dose-escalation Procedure

Drug resistance is a major challenge in cancer therapy. The generation of resistant sublines in vitro is necessary for discovering novel mechanisms to overcome this challenge. Here, a 2-step dose-escalation method for establishing dual-resistance to an epidermal growth factor receptor (EGFR)-tyrosine kinase inhibitor (TKI), gefitinib, and a MET-TKI, PHA665752, is described. This method is based on simple stepwise dose-escalation of inhibitors for inducing acquired resistance in cell lines. The alternate method for generating resistant sublines involves exposing the cells to high concentrations of the inhibitor in one step. The stepwise dose-escalation method has a higher possibility of successfully inducing acquired resistance than this method. Activating EGFR mutations are biomarkers of a response to treatment with EGFR-TKI, which is an applied first-line treatment for non-small cell lung cancers (NSCLC) that harbor these mutations. However, despite reports of effective responses, the use of EGFR-TKI is limited because tumors inevitably acquire resistance. The major mechanisms behind EGFR-TKI resistance include a secondary mutation at the gatekeeper site, T790M in exon 20 of EGFR, and a bypass signal of MET. Thus, a potential solution for this issue would be a combination of EGFR-TKI and MET-TKI. This combined treatment has been shown to be effective in an in vitro study model. Acquired gefitinib-resistance was established through MET-amplification by stepwise dose-escalation of gefitinib for 12 months, and a cell line named PC-9MET1000 was generated in a previous study. To further investigate the mechanisms of acquired MET-TKI and EGFR-TKI resistance, a MET-TKI, PHA665752, was administered to these cells with stepwise dose-escalation in the presence of gefitinib for 12 months. This protocol has also been successfully applied for a number of combination therapies to establish acquired resistance to other inhibitor molecules.

Establishing Dual Resistance to EGFR-TKI and MET-TKI in Lung Adenocarcinoma Cells In Vitro with a 2-step Dose-escalation Procedure

An in vitro method for establishing dual resistance to an EGFR-TKI and a MET-TKI in cancer cells is described. This method is useful for developing treatments for patients with EGFR-mutations, who exhibit disease progression despite EGFR-TKI treatment with MET-amplification. It can also be modified for inhibitors targeting other molecules.

폐 선 암 세포에서 생체 외에서 2 단계 복용량 단계적 확대 절차와 EGFR TKI와 만난 TKI 듀얼 저항 설정

Drug resistance is a major challenge in cancer therapy. The generation of resistant sublines in vitro is necessary for discovering novel mechanisms to ...

연구

암 연구학

Preclinical Assessment of the Bioactivity of the Anticancer Coumarin OT48 by Spheroids, Colony Formation Assays, and Zebrafish Xenografts

In vitro and in vivo pre-clinical screening of novel therapeutic agents are an essential tool in cancer drug discovery. Although human cancer cell lines respond to therapeutic compounds in 2D (dimensional) monolayer cell cultures, 3D culture systems were developed to understand the efficacy of drugs in more physiologically relevant models. In recent years, a paradigm shift was observed in pre-clinical research to validate the potency of new molecules in 3D culture systems, more precisely mimicking the tumor microenvironment. These systems characterize the disease state in a more physiologically relevant manner and help to gain better mechanistic insight and understanding of the pharmacological potency of a given molecule. Moreover, with the current trend in improving in vivo cancer models, zebrafish has emerged as an important vertebrate model to assess in vivo tumor formation and study the effect of therapeutic agents. Here, we investigated the therapeutic efficacy of hydroxycoumarin OT48 alone or in combination with BH3 mimetics in lung cancer cell line A549 by using three different 3D culture systems including colony formation assays (CFA), spheroid formation assay (SFA) and in vivo zebrafish xenografts.

Here, we present the preclinical screening of anticancer coumarins using 3D culture and zebrafish.

Spheroids, 식민지 대형 분석 실험, 그리고 Zebrafish Xenografts 제 Coumarin OT48의 Bioactivity의 전 임상 평가

In vitro and in vivo pre-clinical screening of novel therapeutic agents are an essential tool in cancer drug discovery. Although human cancer cell lines ...

Potentiation of Anticancer Antibody Efficacy by Antineoplastic Drugs: Detection of Antibody-drug Synergism Using the Combination Index Equation

Potentiation of hostile monoclonal antibodies (mAb) by chemotherapeutic agents constitutes a valuable strategy for designing effective and safer therapy against cancer. Here we provide a protocol to identify a rational combination at the preclinical step. First, we describe a cell-based assay to assess the synergism between anticancer mAb and cytotoxic drugs, that uses the combination index equation of Chou and Talalay1. This includes the measurement of tumor cell drug- and antibody-sensitivity using an MTT assay, followed by an automated computer analysis to calculate the combination index (CI) values. CI values of &lt;1 indicate synergism between tested mAbs and cytotoxic agents1. To corroborate the in vitro findings in vivo, we further describe a method to assess the combination regimen efficacy in a xenograft tumor model. In this model, the combined regimen significantly delays tumor growth, which results in a significant extended survival in comparison to single-agent controls. Importantly, the in vivo experimentation reveals that the combination regimen is well tolerated. This protocol allows the effective evaluation of anticancer drug combinations in preclinical models and the identification of rational combination to evaluate in clinical trials.

This protocol describes how to assess synergism between an anticancer antibody and antineoplastic drugs in preclinical models by using the combination index equation of Chou and Talalay.

Potentiation Antineoplastic 약물으로 항 암 항 체 효능: 조합 인덱스 방정식을 사용 하 여 항 체-마약 성분의 검출

Potentiation of hostile monoclonal antibodies (mAb) by chemotherapeutic agents constitutes a valuable strategy for designing effective and safer therapy ...

In Vitro Tumor Cell Rechallenge For Predictive Evaluation of Chimeric Antigen Receptor T Cell Antitumor Function

The field of chimeric antigen receptor (CAR) T cell therapy is rapidly advancing with improvements in CAR design, gene-engineering approaches and manufacturing optimizations. One challenge for these development efforts, however, has been the establishment of in vitro assays that can robustly inform selection of the optimal CAR T cell products for in vivo therapeutic success. Standard in vitro tumor-lysis assays often fail to reflect the true antitumor potential of the CAR T cells due to the relatively short co-culture time and high T cell to tumor ratio. Here, we describe an in vitro co-culture method to evaluate CAR T cell recursive killing potential at high tumor cell loads. In this assay, long-term cytotoxic function and proliferative capacity of CAR T cells is examined in vitro over 7 days with additional tumor targets administered to the co-culture every other day. This assay can be coupled with profiling T cell activation, exhaustion and memory phenotypes. Using this assay, we have successfully distinguished the functional and phenotypic differences between CD4+ and CD8+ CAR T cells against glioblastoma (GBM) cells, reflecting their differential in vivo antitumor activity in orthotopic xenograft models. This method provides a facile approach to assess CAR T cell potency and to elucidate the functional variations across different CAR T cell products.

Here, we describe an in vitro co-culture method to recursively challenge tumor-targeted T cells, which allows for phenotypic and functional analysis of antitumor T cell activity.

체 외 종양 세포 Rechallenge 공상 항 원 수용 체 T 세포 Antitumor 기능 예측 평가

The field of chimeric antigen receptor (CAR) T cell therapy is rapidly advancing with improvements in CAR design, gene-engineering approaches and ...

Assessing Cell Viability and Death in 3D Spheroid Cultures of Cancer Cells

Three-dimensional spheroids of cancer cells are important tools for both cancer drug screens and for gaining mechanistic insight into cancer cell biology. The power of this preparation lies in its ability to mimic many aspects of the in vivo conditions of tumors while being fast, cheap, and versatile enough to allow relatively high-throughput screening. The spheroid culture conditions can recapitulate the physico-chemical gradients in a tumor, including the increasing extracellular acidity, increased lactate, and decreasing glucose and oxygen availability, from the spheroid periphery to its core. Also, the mechanical properties and cell-cell interactions of in vivo tumors are in part mimicked by this model. The specific properties and consequently the optimal growth conditions, of 3D spheroids, differ widely between different types of cancer cells. Furthermore, the assessment of cell viability and death in 3D spheroids requires methods that differ in part from those employed for 2D cultures. Here we describe several protocols for preparing 3D spheroids of cancer cells, and for using such cultures to assess cell viability and death in the context of evaluating the efficacy of anticancer drugs.

Here, we present several simple methods for evaluating viability and death in 3D cancer cell spheroids, which mimic the physico-chemical gradients of in vivo tumors much better than the 2D culture. The spheroid model, therefore, allows evaluation of the cancer drug efficacy with improved translation to in vivo conditions.

암세포의 3D 스페로이드 배양에서 세포 생존력과 사망 평가

Three-dimensional spheroids of cancer cells are important tools for both cancer drug screens and for gaining mechanistic insight into cancer cell biology. ...

Profiling Sensitivity to Targeted Therapies in EGFR-Mutant NSCLC Patient-Derived Organoids

Novel 3D cancer organoid cultures derived from clinical patient specimens represent an important model system to evaluate intratumor heterogeneity and treatment response to targeted inhibitors in cancer. Pioneering work in gastrointestinal and pancreatic cancers has highlighted the promise of patient-derived organoids (PDOs) as a patient-proximate culture system, with an increasing number of models emerging. Similarly, work in other cancer types has focused on establishing organoid models and optimizing culture protocols. Notably, 3D cancer organoid models maintain the genetic complexity of original tumor specimens and thus translate tumor-derived sequencing data into treatment with genetically informed targeted therapies in an experimental setting. Further, PDOs might foster the evaluation of rational combination treatments to overcome resistance-associated adaptation of tumors in the future. The latter focuses on intense research efforts in non-small-cell lung cancer (NSCLC), as resistance development ultimately limits the treatment success of targeted inhibitors. An early assessment of therapeutically targetable mechanisms using NSCLC PDOs could help inform rational combination treatments. This manuscript describes a standardized protocol for the cell culture plate-based assessment of drug sensitivities to targeted inhibitors in NSCLC-derived 3D PDOs, with potential adaptability to combinational treatments and other treatment modalities.

This protocol describes a standardized evaluation of drug sensitivities to targeted signaling inhibitors in NSCLC patient-derived organoid models.

EGFR 돌연변이 NSCLC 환자 유래 오가노이드에서 표적 치료법에 대한 민감도 프로파일링

Novel 3D cancer organoid cultures derived from clinical patient specimens represent an important model system to evaluate intratumor heterogeneity and ...

A Combined 3D Tissue Engineered In Vitro/In Silico Lung Tumor Model for Predicting Drug Effectiveness in Specific Mutational Backgrounds

In the present study, we combined an in vitro 3D lung tumor model with an in silico model to optimize predictions of drug response based on a specific mutational background. The model is generated on a decellularized porcine scaffold that reproduces tissue-specific characteristics regarding extracellular matrix composition and architecture including the basement membrane. We standardized a protocol that allows artificial tumor tissue generation within 14 days including three days of drug treatment. Our article provides several detailed descriptions of 3D read-out screening techniques like the determination of the proliferation index Ki67 staining&#39;s, apoptosis from supernatants by M30-ELISA and assessment of epithelial to mesenchymal transition (EMT), which are helpful tools for evaluating the effectiveness of therapeutic compounds. We could show compared to 2D culture a reduction of proliferation in our 3D tumor model that is related to the clinical situation. Despite of this lower proliferation, the model predicted EGFR-targeted drug responses correctly according to the biomarker status as shown by comparison of the lung carcinoma cell lines HCC827 (EGFR -mutated, KRAS wild-type) and A549 (EGFR wild-type, KRAS-mutated) treated with the tyrosine-kinase inhibitor (TKI) gefitinib. To investigate drug responses of more advanced tumor cells, we induced EMT by long-term treatment with TGF-beta-1 as assessed by vimentin/pan-cytokeratin immunofluorescence staining. A flow-bioreactor was employed to adjust culture to physiological conditions, which improved tissue generation. Furthermore, we show the integration of drug responses upon gefitinib treatment or TGF-beta-1 stimulation - apoptosis, proliferation index and EMT - into a Boolean in silico model. Additionally, we explain how drug responses of tumor cells with a specific mutational background and counterstrategies against resistance can be predicted. We are confident that our 3D in vitro approach especially with its in silico expansion provides an additional value for preclinical drug testing in more realistic conditions than in 2D cell culture.

A Combined 3D Tissue Engineered In Vitro/In Silico Lung Tumor Model for Predicting Drug Effectiveness in Specific Mutational Backgrounds

We present a three-dimensional (3D) lung cancer model based on a biological collagen scaffold to study sensitivity towards non-small-cell-lung-cancer-(NSCLC)-targeted therapies. We demonstrate different read-out techniques to determine the proliferation index, apoptosis and epithelial-mesenchymal transition (EMT) status. Collected data are integrated into an in silico model for prediction of drug sensitivity.

결합 된 3 차원 조직은 엔지니어링<em&gt; 체외</em&gt; /<em&gt; 인 실리코</em특정 돌연변이 배경에서 약물의 효과를 예측&gt; 폐 종양 모델

In the present study, we combined an in vitro 3D lung tumor model with an in silico model to optimize predictions of drug response based on a specific ...

생체공학

<meta charset="utf8"></head><body>Clonogenic Assay를 사용한 환자 유래 종양 오가노이드의 방사선 반응

Live Imaging to Quantify Cellular Radiosensitivity in Patient-Derived Tumor Organoids

Radiation therapy (RT) is one of the mainstays of modern clinical cancer management. However, not all cancer types are equally sensitive to irradiation, often (but not always) because of differences in the ability of malignant cells to repair oxidative DNA damage as elicited by ionizing rays. Clonogenic assays have been employed for decades to assess the sensitivity of cultured cancer cells to ionizing irradiation, largely because irradiated cancer cells often die in a delayed manner that is difficult to quantify with short-term flow cytometry- or microscopy-assisted techniques. Unfortunately, clonogenic assays cannot be employed as such for more complex tumor models, such as patient-derived tumor organoids (PDTOs). Indeed, irradiating established PDTOs may not necessarily abrogate their growth as multicellular units, unless their stem-like compartment is completely eradicated. Moreover, irradiating PDTO-derived single-cell suspensions may not properly recapitulate the sensitivity of malignant cells to RT in the context of established PDTOs. Here, we detail an adaptation of conventional clonogenic assays that involves exposure of established PDTOs to ionizing radiation, followed by single-cell dissociation, replating in suitable culture conditions and live imaging. Non-irradiated (control) PDTO-derived stem-like cells reform growing PDTOs with a PDTO-specific efficiency, which is negatively influenced by irradiation in a dose-dependent manner. In these conditions, PDTO-forming efficiency and growth rate can be quantified as a measure of radiosensitivity on time-lapse images collected until control PDTOs achieve a predefined space occupancy.

<meta charset="utf8"></head><body>저자 스포트라이트: 암 연구 및 맞춤형 의학 발전을 위한 방사선 요법 및 클론 생성 분석

Here, we detail a straightforward live imaging approach for quantifying the sensitivity of patient-derived tumor organoids to ionizing radiation.

환자 유래 종양 오가노이드에서 세포 방사선 민감도를 정량화하기 위한 Live Imaging

Radiation therapy (RT) is one of the mainstays of modern clinical cancer management. However, not all cancer types are equally sensitive to irradiation, ...

암 약물 과민 반응의 효과를 평가

요약

더 많은 비디오 탐색

폐 선 암 세포에서 생체 외에서 2 단계 복용량 단계적 확대 절차와 EGFR TKI와 만난 TKI 듀얼 저항 설정

Spheroids, 식민지 대형 분석 실험, 그리고 Zebrafish Xenografts 제 Coumarin OT48의 Bioactivity의 전 임상 평가

Potentiation Antineoplastic 약물으로 항 암 항 체 효능: 조합 인덱스 방정식을 사용 하 여 항 체-마약 성분의 검출

체 외 종양 세포 Rechallenge 공상 항 원 수용 체 T 세포 Antitumor 기능 예측 평가

암세포의 3D 스페로이드 배양에서 세포 생존력과 사망 평가

EGFR 돌연변이 NSCLC 환자 유래 오가노이드에서 표적 치료법에 대한 민감도 프로파일링

결합 된 3 차원 조직은 엔지니어링

환자 유래 종양 오가노이드에서 세포 방사선 민감도를 정량화하기 위한 Live Imaging

환자 유래 종양 오가노이드에서 세포 방사선 민감도를 정량화하기 위한 Live Imaging

환자 유래 종양 오가노이드에서 세포 방사선 민감도를 정량화하기 위한 Live Imaging