Name: production and targeting of monovalent quantum dots
Uploaded: 2014-10-23T15:00:00.000+00:00
Duration: 10 min 16 s
Description: Watch this Scientific Journal Video about Production and Targeting of Monovalent Quantum Dots at JoVE.com

DOD W81XWH-1023년 10월 1일 (ZJG) 시스템을위한 UCSF 센터 및 합성 생물학 (ZJG)에서 부여 P50의 GM081879, NIH 5R21EB015088-02 (YJ)와 NIH 1R21EB018044 (ZJG &amp; YJ)가 제공하는 자금. DS는 인간 프론티어 과학 프로그램 크로스 - 징계 박사 후 연구원 연구 친교에 의해 지원되었다.

가의 양자 도트의 1 생산 <ol><li> 수상에 유기에서 양자점의 위상 전송 <ol><li> 5 ㎖의 유리 병에 클로로포름 400 μL 유기 상 양자점의 1 μM 용액 200 μl를 희석. </li><li> 깔끔한 mpeg 및 티올 (CH 3 O (CH 2 CH 2 O) 6 C 2 H 5 SH)의 36 μL와 0.3 M 테트라 부틸 암모늄 브로마이드 (TBAB) 클로로포름 용액 400 μl를 혼합하고 / N을 O를 흔들. </li><li> 0.2 M 수산화 나트륨 수용액 800 μl를 추가하고 30 초 동안 흔들어. 상전이는 조밀 한 유기상을 상기 수 성상에 착색 입자의 이동에 의해 지시 된 몇 분 내에 발생한다. </li><li> 입자는 수성 및 유기 상 사이에 세 번째 단계 응집 경우 엠펙 티올과 배양 시간을 증가시킨다. 수성 상 명확 남아 있으면, 양자점은 상 전이 (도 3a 참조)하지 않았다. 선택적으로, 증가 concent2 단계에서의 MPEG 티올의 배급이 좋지 상 이동을 경감 할 수 있도록하고있다. </li><li> (컬러) 수상을 복구 한 후 1 ml의 센트 리콘 스핀 컬럼 (30 kDa의 분자량 컷 - 오프)와 수집 된 양자점을 집중한다. </li><li> 세파 덱스 NAP10 열 30 mM의 염화나트륨 (산도 8.0)를 포함하는 10 mM 트리스 완충액으로 미리 평형에 집중 QD 솔루션을 추가합니다. 중력 흐름 용출 완충액 1.5 ㎖로 용출 양자점. </li><li> 350 nm에서 흡광을 가진 양자점의 농도를 측정한다. </li></ol></li><li> mQDs의 준비 <ol><li> 구매 (또는를 합성) ptDNA. 이 프로토콜 시퀀스를 사용하여 5&#39;-A S 50 (CT) (10) (ACTG) 5 -3 &#39;(표 1 참조). </li></ol></li></ol><table border="0" cellpadding="0" cellspacing="0"><tbody><tr><td> DNA </td><td> 순서 </td></tr><tr><td> 5&#39;-S 50 (CT) 10 (ACTG) 5 </sub&gt; -3 &#39; </td><td> S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S CTCTCTCTCTCTCTCTCTCTACTGACTGACTGACTGACTG </td></tr><tr><td> 5&#39;-NH 2 - (CT) 10 (CAGT) 5 -3 &#39; </td><td> NH 2 - / C6spacer / CTCTCTCTCTCTCTCTCTCTCAGTCAGTCAGTCAGTCAGT </td></tr><tr><td> BG-DNA </td><td> BG- / C6spacer / CTCTCTCTCTCTCTCTCTCTCAGTCAGTCAGTCAGTCAGT </td></tr></tbody></table> 표 1 DNA 서열은 생산 목표 mQDs하는 데 사용됩니다. <ol start="2" style="margin-left: 40px;"><li> 30 mM의 염화나트륨 (pH를 8)를 포함하는 10 mM 트리스 버퍼에 100 나노 QD 용액 1 ㎖를 준비합니다. </li><li> 격렬하게 교반하면서 1 분 동안 수성 양자점에 100 nm의 ptDNA 솔루션의 현명한 500 μl를 떨어 추가. 저어 또는 추가 9 시간 동안 진탕에 배치합니다. 참고 : ptDNA의이 비율 : QD이 이론적으로 하나를 생성해야한다. 그러나, 실제의 화학량 론은 결코 완벽 - 보통 결과는 1에 가깝다 : 1.5. 1 ptDNA의 비율 : 1 제조하기 위해서는 QD를 겔 전기 영동 후 농도계는 위에서 사용 공지 볼륨 주어진 접합의 정확한 비율을 정량화하는 것이 필요하다. </li><li> 분석 아가 로스 젤에서 실행 QD 혼합물의 ~ 10 μl를 제거합니다. 또한 (단계 1.2.1부터) 수상의 비 결합 양자점의 비슷한 농도를 제거합니다. <ol><li> ~ 2 μ 추가; 배 피콜 로딩 완충액 난 (용액 농도를 증가) 및 주변 마이그레이션 비 결합 제어 차선 150 V.에서 15 분 동안 붕산 나트륨 완충액 0.8 중량 % / V 아가 로스 겔상에서 함께 하나의 주파수 대역을 두 샘플을 실행할 잘하고 결합 된 양자점과 차선이 밴드 (그림 2B에서 젤 참조) 볼 수 있습니다. </li></ol></li><li> 두 밴드의 상대 강도를 이용하여 비 접합 QD 분율을 계산 (도 2b의 방정식을 참조). 그런 양자점의 수와 일치 할 필요는 100nM ptDNA 용액의 추가적인 부피를 계산하는 것을 분획을 사용한다. </li><li> 반복이 계산 된 볼륨 또는 모든 양자점의 완전한 활용을 나타내는 겔의 단일 밴드로 결합 된 양자점 붕괴 할 때까지 한 번 더 1.2.5하기 1.2.3 단계를 반복합니다. </li><li> 10 mM 트리스 버퍼 공동 10 밀리미터 (CO 2 H) CH 2 O (CH 2 CH 2 O) 6 C 11 H 23 SH (카르복시 PEG6 알칸 티올)의 100 μl를 추가위의 생산 공액 mQDs에 30 mM의 염화나트륨 (pH를 8) ntaining, 10 분 동안 흔들어. 참고 : 이러한 PEG 리간드는 QD 표면 보호막. 이상 PEG 그러나, 그것은 또한 자신의 크기를 증가, 양자점을 더 잘 패시베이션됩니다. 소수성 알칸 티올 기능은 상 전이 대 덜 소수성 PEG-티올 전보다, 골재에, 양자점에 대한 더 높은 친 화성을 갖는다. 따라서,이 단계가 너무 오래 계속하는 것을 허용하지 않거나 ptDNA는 알칸-PEG-티올로 대체됩니다. ~ 30 분 배양 후, DNA의 상당 부분은 양자점 (그림 3B)에서 변위 된 것이다. </li><li> 초과 알칸 PEG-티올을 제거 세파 덱스 NAP5 열에 QD 솔루션의 0.5 ML을 추가하려면 용출 버퍼가 미리 평형 (30 mM의 염화나트륨을 포함하는 10 mM 트리스 버퍼). 중력 흐름에 의해 용출 버퍼의 1.0 mL를 mQDs를 수집합니다. </li><li> 센트 리콘 스핀 컬럼 (30 kDa의)와 함께 수집 된 양자점을 집중. 달 동안 4 ° C에서 이러한 mQDs를 저장합니다. 호텔 fr하지 마십시오그들을 eeze. 주 : 상기 튜브의 하단에 착색 펠릿을 본 경우, 도트는 응집되어 더 이상 유용한 가능성이있다. </li></ol> 타겟팅 (Benzylguanine-) DNA의 2 생산 <ol><li> 생산 또는 아민 종결 된 DNA를 구입할 수 있습니다. 이 프로토콜 시퀀스를 사용하여 5&#39;-NH 2 - (CT) (10) - (CAGT) 5 -3 &#39;(표 1 참조). 폴리 CT 링커는 글리코 칼 릭스에 깊이 묻혀있는 기능에 대한 접근성을 증가 시키지만 모든 응용 프로그램에 필요하지 않을 수 있습니다. DNA 합성기에 대한 액세스가 발생하면, 적절한 5 &#39;아미노 개질 재 (5&#39;아미노 모디파이어 C6)를 사용하여 아미노 - 개질 된 DNA를 생산한다. </li><li> 10 ㎎ / ㎖의 농도에서 건조 디메틸 술폭 시드 (DMSO)에 BG-N-히드 록시 숙신이 미드 (NHS-BG)을 녹인다. 주 : BG-NHS 특히 DMSO 및 디메틸 포름 아미드 (DMF)와 같은 용매 중에서 흡습성, 반응성 NHS-에스테르의 가수 분해로 공기로부터 수분을 흡수하고 이어질 것이다. BG-NHS는 최고의 가게보조 용기 포함 건조제 내 자신의 병에 분말로 -80 ° C에서 D. 유리 병을 열기 전에 실온으로 따뜻한. 또는, 즉시 단일 사용하기 위해 건조 극성 용매로 BG-NHS 에스테르를 나누어지는 및 -80 ° C에서 동결 또는 단계 2.2에서 아민 DNA와 완전히 반응한다. </li><li> HEPES의 아민 종결 된 DNA (4 - (2 - 히드 록시 에틸) -1 - 피페 라진 에탄 술폰산) 버퍼 (pH를 8.5) 물을 단계 2.1에서 DMSO에 BG-NHS를 혼합하여 반응한다. (CT) - 10 - (CAGT) 20 ㎕의 0.5 M HEPES pH를 8.5로 버퍼 5 58 ㎕의 탈 이온수 일반적인에서 2 밀리미터 NH 2의 2 μL로 DMSO에 10 mg을 20 μl를 반응 / ㎖ BG-NHS. 1.5 ml의 microcentrifuge 관에서 반응을 수행하십시오. 반응이 빠르게 진행으로 신속하게 혼합하고 NHS-에스테르 가수 분해와 경쟁해야합니다. </li><li> 철저한 혼합을 보장하기 위해 50-10 분 동안 초음파 처리. RT에서 ~ 1 시간을 품어. BG의 화학 양론 비 : DNA는 반응 완료를 구동하기 위해 변경 될 수있다. </li><l난&gt; 100 MM의 트리 에틸 아민 아세테이트 (TEAA, 산도 7)에 표준 NAP5 열을 사용하여 반응을 탈염. </li><li> 8 %, 30 분에 걸쳐 95 % 아세토 니트릴 사이 아세토 니트릴 (ACN) 구배 : 3.94 인치 TEAA 실행 역상 HPLC에 의해, 미 반응 아민 DNA로부터 BG-DNA를 정제 하였다. 미 반응 아민은 DNA-DNA-BG 전에 용출된다. 원뿔 튜브에있는 BG-DNA 분획을 수집합니다. <ol><li> 표준 올리고 뉴클레오티드 정제 C 18 조르 열 다음과 같은 그라데이션을 사용하여 0 → 15 분 : 8 30 % ACN →; 15 → 21 분 : 30-90% ACN; 21 → 25 분 : 90 → 8 % ACN; 25 → 30 분 : 8 % ACN; </li></ol></li><li> 액체 질소에 냉동 및 수집 된 분획을 동결 건조. 탈 이온수에서 DNA를 재현 탁. 잔류 TEAA을 제거하기 위해 두 번 더 동결 건조, 여분의 조심하십시오. 잔류 TEAA는 높은 농도에서 세포 독성이있을 수 있습니다. </li><li> 일의 측면을 씻어 확인하고, 물에 동결 건조 BG-DNA를 재현 탁전자 튜브 및 ~ 25 μm의 주식을 희석한다. 4 ° C에서 나누어지는 및 저장. 샘플은 눈에 띄는 성능 저하없이 ~ 9개월에 보관 하였다. </li></ol> 가의 양자 도트와 3 라벨링 라이브 셀 <ol><li> 임의로, 그러한 카제인 (0.5 %) 또는 소 혈청 알부민 (BSA 1-3 %)을 시약을 사용하여 촬상 실험 직전 mQDs 보호막. </li><li> 총 내부 반사 형광 (TIRF) - 품질 유리에 SNAP - 태그 단백질을 발현 플레이트 세포. 이 실험에서는, SNAP-태그 Notch1 수용체 및 고품질 유리 표면 발현 U2OS 세포 라인을 사용한다. </li><li> 세포가 유리 (~ 24 시간)에 부착 한 후, PBS로 씻어, 성장 배지를 제거하고, ~에 실온에서 10 ~ 30 분 동안 100 ~ 150 PBS의 μL 또는 ~ 1 μM을 포함하는 셀 미디어 세포를 배양 BG- 위의 단계 2.6에서 DNA. </li><li> BG와 배양 후, 조심스럽게 PBS 또는 세포 매체와 세포를 씻으십시오. 회와 함께 ~ ~ 10 분 동안 세포를 품어단계 1.2.9에서 생산 된 전자 mQDs (그리고 선택적으로 3.1 단계에서 비활성화). </li><li> 선택적으로, 언 바운드 mQDs 씻어 이미징 및 문화 모두에 적합한 버퍼 / 미디어에 세포를 반환합니다. 솔루션 언 바운드 mQDs 분석하는 동안 감지 될뿐만 바운드 mQDs에 비해 급속히 확산으로 TIRF 모드에서 이미지를 만들 수 있었다 세포를 들어, 최종 세척 단계는 종종 불필요. </li></ol> (4) 현미경 및 분석 <ol><li> 이미지 TIRF 현미경을 사용하여 세포. 참고 : 범위는 분리 여기 및 방출 필터, 또는 사용자 정의 QD 필터 큐브가 있어야합니다. 양자점은 낮은 파장 레이저 (405 또는 488 nm의) 최고의 기쁘게 생각합니다. 다른 직경의 양​​자점은 일반적으로 큰 토크의 변화와 관련된 특이한 발광 파장을 가지고있다. </li><li> 라이브 셀의 기저 측면을 이미징하는 동안 때문에 mQDs의 밝기에, TIRF에서 높은 프레임 속도로 이미지를 수집합니다. 참고 : 또는 단일 분자 역학 FOLLO 될 수 있습니다회전하는 디스크 공 초점 현미경을 사용하여 다른 초점 비행기에서 결혼. 자동화 된 단일 입자 추적 소프트웨어는 정확하게 밝고 광 안정성 mQDs 추적에 일반적으로 성공적이다. </li></ol>

<ol>
	<li>Sako, Y., Minoghchi, S., Yanagida, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single-molecule+imaging+of+EGFR+signaling+on+the+surface+of+living+cells.">Single-molecule imaging of EGFR signaling on the surface of living cells.</a> Nature Cell Biology. 2 (3), 168-172 (2000).</li><li>Luo, W., He, K., Xia, T., Fang, X. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single-molecule+monitoring+in+living+cells+by+use+of+fluorescence+microscopy.">Single-molecule monitoring in living cells by use of fluorescence microscopy.</a> Analytical and Bioanalytical Chemistry. 405 (1), 43-49 (2013).</li><li>Chung, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Spatial+control+of+EGF+receptor+activation+by+reversible+dimerization+on+living+cells.">Spatial control of EGF receptor activation by reversible dimerization on living cells.</a> Nature. 464 (7289), 783-787 (2010).</li><li>Fern&#225;ndez-Su&#225;rez, M., Ting, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fluorescent+probes+for+super-resolution+imaging+in+living+cells.">Fluorescent probes for super-resolution imaging in living cells.</a> Nature Reviews Molecular Cell Biology. 9 (12), 929-943 (2008).</li><li>Sark, W. G. J. H. M., Frederix, P. L. T. M., Vanden Heuvel, D. J., Gerritsen, H. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Photooxidation+and+photobleaching+of+single+CdSe/ZnS+quantum+dots+probed+by+room-temperature+time-resolved+spectroscopy.">Photooxidation and photobleaching of single CdSe/ZnS quantum dots probed by room-temperature time-resolved spectroscopy.</a> The Journal of Physical Chemistry B. 105 (35), 8281-8284 (2001).</li><li>Pinaud, F., Clarke, S., Sittner, A., Dahan, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Probing+cellular+events,+one+quantum+dot+at+a+time.">Probing cellular events, one quantum dot at a time.</a> Nature Methods. 7 (4), 275-285 (2010).</li><li>Michalet, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantum+dots+for+live+cells,+in+vivo+imaging,+and+diagnostics.">Quantum dots for live cells, in vivo imaging, and diagnostics.</a> Science. 307 (5709), 538-544 (2005).</li><li>Howarth, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Monovalent,+reduced-size+quantum+dots+for+imaging+receptors+on+living+cells.">Monovalent, reduced-size quantum dots for imaging receptors on living cells.</a> Nature Methods. 5 (5), 397-399 (2008).</li><li>Iyer, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Aromatic+aldehyde+and+hydrazine+activated+peptide+coated+quantum+dots+for+easy+bioconjugation+and+live+cell+imaging.">Aromatic aldehyde and hydrazine activated peptide coated quantum dots for easy bioconjugation and live cell imaging.</a> Bioconjugate Chemistry. 22 (6), 1006-1011 (2011).</li><li>Tikhomirov, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA-based+programming+of+quantum+dot+valency,+self-assembly+and+luminescence.">DNA-based programming of quantum dot valency, self-assembly and luminescence.</a> Nature Nanotechnology. 6 (8), 485-490 (2011).</li><li>Farlow, J., Seo, D., Broaders, K. E., Taylor, M. J., Gartner, Z. J., Jun, Y. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Formation+of+targeted+monovalent+quantum+dots+by+steric+exclusion.">Formation of targeted monovalent quantum dots by steric exclusion.</a> Nature Methods. 10 (12), 1203-1205 (2013).</li><li>Gartner, Z. J., Bertozzi, C. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Programmed+assembly+of+3-dimensional+microtissues+with+defined+cellular+connectivity.">Programmed assembly of 3-dimensional microtissues with defined cellular connectivity.</a> Proceeding of the National Academy of Sciences USA. 106 (12), 4606-4610 (2009).</li><li>Selden, N. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chemically+programmed+cell+adhesion+with+membrane-anchored+oligonucleotides.">Chemically programmed cell adhesion with membrane-anchored oligonucleotides.</a> Journal of the American Chemical Society. 134 (2), 765-768 (2012).</li></ol>

The authors have nothing to disclose.

mQD 설계의 모듈은 실험적인 유연성의 증가 정도를 할 수 있습니다. 예를 들어, mQDs 다양한 빨리 복수의 타겟의 동시 촬상을 가능하게 고유 한 색상으로 제조 할 수있다. ssDNA를 대상 시퀀스는 단백질 당 12, 지질 mQDs을 지시하고 13을 표면 수 있습니다. 효소 태그의 수는 여러 대상이 차등 대상 mQDs과 동시에 이미지를 만들 수 있도록 직교 반응성 사용할 수 있습니다. SNAP 태그 타겟팅 외에도 CLIP 태그, HALO 태그를 사용 mQDs 및 바이오틴 단백질과 목적 단백질의 라벨은 또한 성공적이었다. 이 프로토콜은 이러한 mQDs와 생균상의 표면 수용체의 특정 라벨을 설명하지만, 프로토콜은 쉽게 다른 컨텍스트의 수에 적응 될 수있다. 정의 가의 mQDs 생산에 중요한 방법 론적 통찰력입니다 ~ 50 포스는 링크기지는 양자점을 래핑 (그리고 동시에 바인딩이 분자를 방지)해야합니다. 폴리 S (50) 순서는 재현성 및 안정적 생활 기술에서 605 나노 양자점을 결합. 이 제품은 단종되었지만, 입체 배제 전략은 서로 다른 크기, 모양, 스펙트럼 특성을 갖는 다른 공급 업체의 유사 제품에 일반화이다. ptDNA 포장 된 양자점의 효율과 안정성은 양자점의 표면 화학 구조에 따라 크게 달라진다. 따라서, 프로토콜의 성공은 양자점의 상업적인 소스 및 화학 구조에 의존 할 것이다. 이 프로토콜의 목적을 위해, 차의 세 가지 주요 포인트는 양자점의 다양한 상업적인 소스간에 존재 상전이에 필요한 조건의 차이; ptDNA에 의해 초기 PEG-티올 - 리간드 결합, 아마도 방해 변위의 강도의 차이; 노출 된 CdSe 코어의 양의 차이, 어떤 수 르티올은 MPEG 상 전이 조건 QD의 급냉에 등록. 간행물로, mQDs의 생산을위한 최적의 구조를 가진 양자점은 545, 585, 605 및 625 nm의 (그림 2A)에서 방출 스펙트럼과 생활 기술에서 구입 한 4-10 나노 미터의 CdSe /의 ZnS 코어 / 쉘 양자점이다. &#39;생생한&#39;제제 (545, 605 등)에 따라 양자점에는 MPEG 티올의 추가에 해소 및이 응용 프로그램에 적합하지 않습니다. 알드리치 해양 나노텍에서 양자점은 잘 작동하지만, 더 이상 상 전이 단계와 트리 옥틸 산화물로 전처리를 필요로합니다. 이 프로토콜은 라이프 테크놀로지스의 양자점에 최적화되어 있습니다. 양자점을 포장하는 데 사용되는 폴리-A 서열을 포스 표적 가닥에 혼성화 할 수있는 (ACTG) (5)의 서열을 함유 네이티브 20 량체의 DNA 테일로 종결된다. 이 시퀀스는 더 차 구조에 거의 없다로, 편리하고, hybridiz 남아PBS에서 37 ° C에서의 에디션. DNA 합성기에 대한 액세스가있는 경우 ptDNA는 C 8 컬럼을 사용하여 합성 한 후 역상 고속 액체 크로마토 그래피 (HPLC)로 정제 할 수있다. ptDNA는 기본 백본 해당하는 올리고 뉴클레오티드보다 HPLC 나중에 용출됩니다. 우리는 일반적으로 정제 한 후 우리의 포스 올리고 뉴클레오티드에 그룹을 보호 DMT &#39;5 둡니다. ptDNA 감싸 양자점의 패시베이션은 일반적 양자점 콜로이드 안정성 향상 및 대부분의 응용에 대한 실험적 바인딩 배경을 감소시키기 위해 필요하다. 프로토콜은 양자점 보호막을하기 위해 PEG-층을 사용한다. 카르복시 PEG 추가 PEG 단위로 알칸 티올 ((CO 2 H) CH 2 O (CH 2 CH 2 O) 12 C 11 H 23의 SH, 카르복시 PEG12 알칸 티올이) 상당히 배경을 감소 제공 긴 나무못은 모두 큰 불구하고, 일반적으로 더 비싼. 카복시 PEG 알카 코팅 mQDs북동 티올 리간드는 인산염 완충 살리 네스와 문화 매체로 생리 버퍼 매우 안정적이다. 4 ° C에서 mQDs의 장기 저장 (&gt; 7 개월) 유의 집계 또는 ptDNA 부대 11 없었다. 실험에 따라, 양자점의 PEG의 보호는 항상 혼자 충분히 비 특정 mQDs의 결합을 감소하지 않습니다. 이 50 % ~ 의해 mQDs의 외관상 유체 역학적 반경을 증가 않지만 실질적으로 사용하기 전에 20 분 동안 3 % BSA를 함유하는 인산염 완충 식염수 (PBS)으로 세포 mQDs 모두 배양하면, 세포에 결합하는 비특이적 감소시킨다. 0.5 % 카제인과 패시베이션은 비특이적 결합이 더욱 감소하지만 BSA보다 큰 정도로 겉보기 크기를 증가시킨다. mQDs에 상보적인 DNA 가닥의 5 &#39;말단이 다른 생체 분자의 다수의 타겟팅 있도록 수정 될 수있다. 공유 결합 단백질을 수정은 가능 설정된 다수의 기술, L이있다ipids 및 단일 가닥 DNA (ssDNA를)와 당. ssDNA를이 세포 외로 제시로 너무 오래, 그것은 수용성 mQDs에 액세스 할 수 있습니다. 상기 시퀀스 mQDs 빠르게 세포 배양 조건 하에서 그들의 상보 적 DNA 가닥으로 혼성화 할 것이다. 셀의 두께와 음으로 하전 된 글리코 칼 릭스 위에 결합 서열을 상승하도록 ptDNA 및 표적 서열 사이 10-20x 폴리 (CT)은 스페이서 효율적인 타겟팅을 위해 필요할 수있다. 이 프로토콜을 위해 우리 모두 mQDs 하이브리드 화 및 공유 신속하고 특정 라벨에 대한 SNAP - 태그 단백질에 자신을 연결됩니다 (CAGT) 5의 상보 서열과 BG-DNA를 생산하기로 결정했습니다. 잘 아미노 변성 올리고 뉴클레오티드 다른 NHS-에스테르 결합하기위한 유사한 프로토콜 기능을 제공합니다. 단일 분자 이미징의 경우, 라벨의 낮은 밀도는 일반적으로 개별 분자를 해결하기 위해 필요합니다. 패시 에이전트 PBS에서 ~ 0.5 ㎚의 최종 농도 mQD좋은 대상이다. 그러나 이러한 높은 희석 때로는 아래 표지 세포에서 발생했습니다. 이 경우 라벨의 최적 농도가 관찰 될 때까지, 추가 mQD 첨가 할 수있다. 0.5 nm의 mQD 타겟 셀의 기저 표면에서 20 mQDs (그림 (b) 참조) ~의 첨부 파일에 결과 동안 SNAP-태그 인간 Notch1의 경우,&gt; 10 nM의 mQD의 농도는 밀도 라벨 세포를 생산했다. mQDs와 셀 라벨 도금 세포의 포화 상태의 매우 의존적이었다. 지나치게 합류 세포는 기저 표면에 레이블을하지 않습니다. 요약하면, 간단한 방법은 일가를 생성하는 모듈러 양자점 설명 하였다. 라이브 U2OS 세포의 노치 수용체를 영상화에 의해 입증 이러한 mQDs는 라이브 세포 이미징 응용 프로그램의 다양한 유틸리티를 찾을 수 있습니다. mQDs의 적용은 이러한 특정 경우에 한정되지 않고, 잠재적으로 다른 단백질, 핵산, 효소와 같은 다른 셀룰러 대상에 대해 확장 될 수있다.

살아있는 세포에 단일 분자의 역학은 생물학적 기능에 기여한다. 단일 분자 형광 이미징은 세포 표면 1,2,3에 단일 분자 역학을 연구하는 인기있는 방법입니다. 그러나, 이러한 연구에 가장 흔히 사용되는 이미징 프로브는 몇몇 중요한 단점이있다. 예를 들어, 종래의 유기 염료와 형광 단백질 -1 10 5 -10 6 M, cm -1 적당한 밝기를 제공하지만, 광 화학적으로 불안정하여, 전형적인 라이브 세포 이미징 조건 하에서 약 105 -10 6 광자 방출 후 표백 4,5. 대조적으로, 반도체 나노 입자, 양자점 자주 호출 (양자점), 10 (6) -10 (7) M -1 cm -1의 범위 photobl 전에 10 7 -10 8 방출 광자를 초과의 흡광 계수와 상당히 더 밝고 안정한5 eaching. 유기 형광 물질을 통해 양자점의 개선 된 밝기와 광 안정성은 훨씬 빠른 프레임 속도에서 단일 분자의 관찰을 통해 더 이상 6 탄도를 가능하게한다. 자신의 장점과 상용화에도 불구하고, 여러 부채는 이러한 강력한 이미징 에이전트 남아있다. 첫째, 그들은 가난 대상으로 생체 분자 6의 가교가 발생할 수 있습니다 대상 원자가를 정의했습니다. 둘째, 일반적으로 특정 붐비는 세포 환경 7 접근성을 제한하는 큰 유체 역학적 크기 (&gt; 20 nm의)를 가지고있다. 셋째, 이들은 모듈화 7 타겟팅 제한. 몇 가지 전략은 이러한 문제 8,9,10를 해결하기 위해 시도하지만, 일반적으로 구현하기 위해 전문 지식과 시약을 필요로했다. 이러한 문제를 해결하기 위해 최근 가의가 작은 제조 &quot;입체 제외&quot;전략을보고하고,모듈 형 양자점 11. 양자점은 하나의 긴 포스 DNA (ptDNA) 폴리머와 함께 포장되어 있습니다. ptDNA 표면 노출 아연 원자 및 ptDNA 중합체의 포스 그룹 간의 여러 Zn으로 S-상호 작용을 통해 QD 표면에 결합한다. 단일 결합 중합체는 입체 및 정전 크게 입자의 전체 크기 (약 2 나노 미터)를 증가시키지 않고, 중합체의 추가 당량의 결합을 제외한다. 모든 시약은 제품을 높은 수율로 형성되고, 시판되고, 처리는 오직 탈염 정제 단계를 필요로한다. 일단, 대상 도메인 (예를 들어, benzylguanine (BG), benzylcytosine 또는 alkylhalides)가있는 보완적인 DNA 가닥에 대한 단일 ptDNA (mQDs) 바인드으로 포장 양자점을 표시. 이 기능은 유 전적으로 관심의 단백질에 융합 등 SNAP, CLIP &amp; HALO 등의 효소 태그에 특별히 mQDs을 대상으로. 이것은 합성 프로토콜, 타겟팅, 그리고 입체 배제에 의해 생산 mQDs의 라이브 세포 이미징.

<table><tbody><tr><td colspan="4">&lt;strong&gt;mQD Production&lt;/strong&gt;</td></tr><tr><td>Phosphorothioate DNA:</td><td></td><td></td><td></td></tr><tr><td>(A*)x50-(ACTG)x5</td><td>IDT</td><td></td><td>Most DNA Synthesis companies</td></tr><tr><td>Quantum Dots:</td><td></td><td></td><td></td></tr><tr><td>QDots 525, 585, 605 &amp;amp; 625</td><td>Invitrogen</td><td>Q21791MP (545), Q21711MP (585), Q21701MP (605)</td><td>Custom QD synthesis for QD625.</td></tr><tr><td>QD610</td><td>Ocean Nanotech</td><td>QSP-610-10&amp;nbsp;</td><td></td></tr><tr><td>QD 610 lamda</td><td>Aldrich</td><td>731854</td><td></td></tr><tr><td>Chloroform, 99.8%</td><td>ACROS</td><td>67-66-3</td><td></td></tr><tr><td>Tetrabutylammonium bromide, 98.0%</td><td>Sigma-Aldrich</td><td>426288</td><td></td></tr><tr><td>mPEG thiol [2,5,8,11,14,17,20-Heptaoxadocosane-22-thiol], MW 354.5, 95%</td><td>Polypure</td><td>11156-0695</td><td></td></tr><tr><td>HSC&lt;sub&gt;11&lt;/sub&gt;EG&lt;sub&gt;6&lt;/sub&gt;CO&lt;sub&gt;2&lt;/sub&gt;H&amp;nbsp; [HS-(CH&lt;sub&gt;2&lt;/sub&gt;)&lt;sub&gt;11&lt;/sub&gt;-(OCH&lt;sub&gt;2&lt;/sub&gt;CH&lt;sub&gt;2&lt;/sub&gt;)&lt;sub&gt;6&lt;/sub&gt;-OCH&lt;sub&gt;2&lt;/sub&gt;CO&lt;sub&gt;2&lt;/sub&gt;H]</td><td>ProChimia</td><td>TH 003-m11.n6-0.1</td><td></td></tr><tr><td>Boric Acid, 99.5%</td><td>Sigma-Aldrich</td><td>B0394</td><td></td></tr><tr><td>Sodium Hydroxide, 99.0%</td><td>ACROS</td><td>S/4845</td><td></td></tr><tr><td>Sodium Chloride, 98%</td><td>Sigma-Aldrich</td><td>310166</td><td></td></tr><tr><td>Agarose LE</td><td>U.S. Biotech Sources</td><td>G02PD-125</td><td></td></tr><tr><td>Ethanol</td><td>Sigma-Aldrich</td><td>459828</td><td></td></tr><tr><td colspan="4">&lt;strong&gt;BG-DNA Production&lt;/strong&gt;</td></tr><tr><td colspan="4">Amine DNA:</td></tr><tr><td>(CAGT)&lt;sub&gt;5&lt;/sub&gt;-NH&lt;sub&gt;2&lt;/sub&gt;</td><td>IDT</td><td>N/A</td><td>Most DNA Synthesis companies</td></tr><tr><td>(CAGT)&lt;sub&gt;5&lt;/sub&gt;(T)&lt;sub&gt;40&lt;/sub&gt;-NH&lt;sub&gt;2&lt;/sub&gt;</td><td>IDT</td><td>N/A</td><td>Most DNA Synthesis companies</td></tr><tr><td>NHS-GLA-Benzylguanine</td><td>New England Biosciences</td><td>S9151</td><td></td></tr><tr><td>DMSO</td><td>Sigma-Aldrich</td><td>D8428</td><td></td></tr><tr><td>HEPES Buffer</td><td>Sigma-Aldrich</td><td>83264</td><td></td></tr><tr><td>NAP5 Column</td><td>GE Healthcare</td><td>17-0853-01</td><td></td></tr><tr><td>C18 Column</td><td></td><td></td><td></td></tr><tr><td>Acetonitrile</td><td></td><td></td><td></td></tr><tr><td colspan="4">&lt;strong&gt;Mammalian Cell Culture &amp;amp; Imaging&lt;/strong&gt;</td></tr><tr><td>Cell line expressing SNAP-tagged protein</td><td>New England Biosciences</td><td>E9100S</td><td></td></tr><tr><td>McCoys 5A</td><td>UCSF Cell Culture Facility</td><td></td><td>Specific to U2OS culture</td></tr><tr><td>Fetal Bovine Serum</td><td>UCSF Cell Culture Facility</td><td></td><td>Specific to U2OS culture</td></tr><tr><td>PBS</td><td>UCSF Cell Culture Facility</td><td></td><td></td></tr><tr><td>Nunc Lab-tek II Chambered Coverglass</td><td>Thermo-Fischer Scientific</td><td>155409</td><td></td></tr><tr><td>Matriplate 96-well plate</td><td>Brooks Life Science Systems</td><td>MGB096-1-2-LG-L</td><td></td></tr><tr><td>BSA</td><td></td><td></td><td></td></tr><tr><td>5% Alkali-soluble Casein</td><td>EMD Millipore</td><td>70955</td><td>Not all caseins are the same</td></tr><tr><td colspan="4">&lt;strong&gt;(Optional) DNA Synthesis Reagents&lt;/strong&gt;</td></tr><tr><td>5&amp;rsquo; Amine modifier C6</td><td>Glen Research</td><td>Oct-06</td><td></td></tr><tr><td>dA-Thiophosphoramidite</td><td>Glen Research</td><td>10-700</td><td></td></tr><tr><td colspan="4">&lt;strong&gt;Analysis Software&lt;/strong&gt;</td></tr><tr><td>FIJI</td><td>http://valelab.ucsf.edu/~schindelin/</td><td></td><td></td></tr><tr><td>RyTrack.pro</td><td>http://sun.iwu.edu/~gspaldin/rytrack.html</td><td></td><td></td></tr><tr><td>Tracker</td><td>http://www.gartnerlab.ucsf.edu/more/software</td><td></td><td></td></tr></tbody></table>

production and targeting of monovalent quantum dots

The multivalent nature of commercial quantum dots (QDs) and the difficulties associated with producing monovalent dots have limited their applications in biology, where clustering and the spatial organization of biomolecules is often the object of study. We describe here a protocol to produce monovalent quantum dots (mQDs) that can be accomplished in most biological research laboratories via a simple mixing of CdSe/ZnS core/shell QDs with phosphorothioate DNA (ptDNA) of defined length. After a single ptDNA strand has wrapped the QD, additional strands are excluded from the surface. Production of mQDs in this manner can be accomplished at small and large scale, with commercial reagents, and in minimal steps. These mQDs can be specifically directed to biological targets by hybridization to a complementary single stranded targeting DNA. We demonstrate the use of these mQDs as imaging probes by labeling SNAP-tagged Notch receptors on live mammalian cells, targeted by mQDs bearing a benzylguanine moiety.

수성 상에 유기부터 양자점의 상 전이가 mQDs의 생산에 중요하지만, 컨디셔닝 및 QD 특정 둘 수있다. 1.1 절 양도 단계에서 그림 3의 첫 번째 두 병 청결 나타납니다. 전송이 더 유리 병 3과 같이 나타나는 경우, 다음 하나는 서로 다른 조건을 다시 시도해야합니다. 양자점은 음전하 DNA로 코팅되면 그들은 비 포장 양자점 별도로 겔에서 마이그레이션해야합니다. 도 2b에서 제 겔에서 본 제어, 제 래핑 등 양자점의 분취 액을 사용하여, 빠른 마이그레이션 밴드, ptDNA의 첨가시 표시한다. mQDs의 완전한 형성은 움직 대역의 손실 및도 2b에 최종 겔에서 볼 수 있듯이 이동 대역으로의 붕괴와 함께 설명된다. 당신의 mQD 제품의 나누어지는이 하나의 밴드로 풀어 양자점에서 분리 마이그레이션하는 경우, 다음 mQDs 1가 및 R 아르<html> eady는 상기 단계에 사용될 수있다. 셀 라벨은 당신의 선택의 대상에 해당해야하며, 단백질 발현 수준과 mQD 농도에 의존해야한다. mQD 농도와 mQD 패시베이션 모두의 경험적 최적화는 종종 특정 응용 프로그램이 필요합니다. 그림 (b)는 0.5 nm 내지 10 nm의 농도에 이르기까지 mQDs와 SNAP-태그 노치 수용체를 발현 U2OS 세포의 라벨을 보여줍니다. <img fo:content-width="6in" width="600" alt="그림 1" src="/files/ftp_upload/52198/52198fig1highres.jpg" /> 그림 1은 모듈 형 mQDs의 대상. mQDs 다양한 표적 분자에 의해 작용 ssDNA의 혼성화. 융합 단백질 - 태그 스냅 DNA를 대상으로 mQDs을 Benzylguanine는 링크. 기타 5 &#39;수정 및 DNA 서열은 다른 생체 분자의 다양한 mQDs의 타겟팅을 할 수 있습니다./files/ftp_upload/52198/52198fig1highres.jpg &quot;대상 =&quot;_ 빈 &quot;&gt;이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오. <img fo:content-width="6in" width="600" alt="그림이" src="/files/ftp_upload/52198/52198fig2highres.jpg" /> mQDs의 생산을위한 2 계획 그림. (A) 유기 상 양자점 ptDNA 래핑 된 MPEG TBAB 및 티올로 처리하여 수성 상에 전사하고, 카복시 PEG6 알칸 티올로 비활성화된다. 대표 TEM 이미지는 각각 유기 QD545, QD585 및 QD605입니다. (B) 상기 공정이 경험적으로 양자점과 ptDNA 사이의 상호 작용의 화학량 론을 결정하기위한 방법. 1 (QD : ptDNA) QD 및 화학 양론 ptDNA 경험적 최종 반응 화학량 1되도록 농도계에 의해 확인된다. ptDNA 몰의 초기 수는 QD의 비를 곱하여 : mQD, 실제 부피 AF 조절할<html> 터 접합이 하나 달성하는 데 필요한 몰수 산출하기 :. 한 접합을 <a href="https://www-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/52198/52198fig2highres.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> <img fo:content-width="6in" width="600" alt="그림 3" src="/files/ftp_upload/52198/52198fig3highres.jpg" /> 그림 3 mQDs의 생산을위한 실험 세부 사항. (A) 성공의 대표 사진과 위상 전송을 실패했습니다. 양자점은 시각적으로 고밀도 유기 상과 밀도가 낮은 수상 사이에 전송해야합니다. 불완전 상 분리는 전사 불량을 나타냅니다. (B)는 ptDNA 알칸-PEG-티올로 대체 될 수있다. 오른쪽 겔 ptDNA 데이터의 상당 부분 인해 과다 패시베이션에 양자점로부터 변위 된 반응 나타낸다.es.jpg &quot;대상 =&quot;_ 빈 &quot;&gt;이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오. <img fo:content-width="6in" width="600" alt="그림 4" src="/files/ftp_upload/52198/52198fig4highres.jpg" /> 그림 4 라벨링 살아있는 세포에서 단백질을 SNAP는 태그가 달린. (A) 도식은 BG-대상 mQD와 SNAP-태그 수용체의 발현, 첨부 파일 및 라벨을 보여주는. (B) SNAP-노치 - mCherry 다양한 mQD 농도로 구성 발현하는 세포의 대표 라벨. PEG12으로 비활성화 mQDs는 mCherry 특정 표시를 표시 한 colocalize. 낮은 라벨 밀도 (&lt;0.5 nm의) 단일 입자 추적을위한 일반적으로 바람직하다. 스케일 바는 10 μm의입니다. <a href="https://www-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/52198/52198fig4highres.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a>

Watch this Scientific Journal Video about Production and Targeting of Monovalent Quantum Dots at JoVE.com

Production and Targeting of Monovalent Quantum Dots

We provide detailed instructions for the preparation of monovalent targeted quantum dots (mQDs) from phosphorothioate DNA of defined length. DNA wrapping occurs in high yield, and therefore, products do not require purification. We demonstrate the use of the SNAP tag to target mQDs to cell-surface receptors for live-cell imaging applications.

생산 및 일가 양자점 타겟팅

The multivalent nature of commercial quantum dots (QDs) and the difficulties associated with producing monovalent dots have limited their applications in ...

production-and-targeting-of-monovalent-quantum-dots

Universidad San Sebastian

Research

JoVE Journal

Bioengineering

25.4K 조회수.  University of California, San Francisco. We provide detailed instructions for the preparation of monovalent targeted quantum dots (mQDs) from phosphorothioate DNA of defined length. DNA wrapping occurs in high yield, and therefore, products do not require purification. We demonstrate the use of the SNAP tag to target mQDs to cell-surface receptors for live-cell imaging applications. 

비디오: Production and Targeting of Monovalent Quantum Dots

Compact Quantum Dots for Single-molecule Imaging

Single-molecule imaging is an important tool for understanding the mechanisms of biomolecular function and for visualizing the spatial and temporal heterogeneity of molecular behaviors that underlie cellular biology 1-4. To image an individual molecule of interest, it is typically conjugated to a fluorescent tag (dye, protein, bead, or quantum dot) and observed with epifluorescence or total internal reflection fluorescence (TIRF) microscopy. While dyes and fluorescent proteins have been the mainstay of fluorescence imaging for decades, their fluorescence is unstable under high photon fluxes necessary to observe individual molecules, yielding only a few seconds of observation before complete loss of signal. Latex beads and dye-labeled beads provide improved signal stability but at the expense of drastically larger hydrodynamic size, which can deleteriously alter the diffusion and behavior of the molecule under study.
Quantum dots (QDs) offer a balance between these two problematic regimes. These nanoparticles are composed of semiconductor materials and can be engineered with a hydrodynamically compact size with exceptional resistance to photodegradation 5. Thus in recent years QDs have been instrumental in enabling long-term observation of complex macromolecular behavior on the single molecule level. However these particles have still been found to exhibit impaired diffusion in crowded molecular environments such as the cellular cytoplasm and the neuronal synaptic cleft, where their sizes are still too large 4,6,7.
Recently we have engineered the cores and surface coatings of QDs for minimized hydrodynamic size, while balancing offsets to colloidal stability, photostability, brightness, and nonspecific binding that have hindered the utility of compact QDs in the past 8,9. The goal of this article is to demonstrate the synthesis, modification, and characterization of these optimized nanocrystals, composed of an alloyed HgxCd1-xSe core coated with an insulating CdyZn1-yS shell, further coated with a multidentate polymer ligand modified with short polyethylene glycol (PEG) chains (Figure 1). Compared with conventional CdSe nanocrystals, HgxCd1-xSe alloys offer greater quantum yields of fluorescence, fluorescence at red and near-infrared wavelengths for enhanced signal-to-noise in cells, and excitation at non-cytotoxic visible wavelengths. Multidentate polymer coatings bind to the nanocrystal surface in a closed and flat conformation to minimize hydrodynamic size, and PEG neutralizes the surface charge to minimize nonspecific binding to cells and biomolecules. The end result is a brightly fluorescent nanocrystal with emission between 550-800 nm and a total hydrodynamic size near 12 nm. This is in the same size range as many soluble globular proteins in cells, and substantially smaller than conventional PEGylated QDs (25-35 nm).

We describe the preparation of colloidal quantum dots with minimized hydrodynamic size for single-molecule fluorescence imaging. Compared to conventional quantum dots, these nanoparticles are similar in size to globular proteins and are optimized for single-molecule brightness, stability against photodegradation, and resistance to nonspecific binding to proteins and cells.

단일 분자 이미징을위한 소형 양자 점

Single-molecule imaging is an important tool for  understanding the mechanisms of biomolecular function and for visualizing the  spatial and temporal ...

연구

공학

Nanofabrication of Gate-defined GaAs/AlGaAs Lateral Quantum Dots

A quantum computer is a computer composed of quantum bits (qubits) that takes advantage of quantum effects, such as superposition of states and entanglement, to solve certain problems exponentially faster than with the best known algorithms on a classical computer. Gate-defined lateral quantum dots on GaAs/AlGaAs are one of many avenues explored for the implementation of a qubit. When properly fabricated, such a device is able to trap a small number of electrons in a certain region of space. The spin states of these electrons can then be used to implement the logical 0 and 1 of the quantum bit. Given the nanometer scale of these quantum dots, cleanroom facilities offering specialized equipment- such as scanning electron microscopes and e-beam evaporators- are required for their fabrication. Great care must be taken throughout the fabrication process to maintain cleanliness of the sample surface and to avoid damaging the fragile gates of the structure. This paper presents the detailed fabrication protocol of gate-defined lateral quantum dots from the wafer to a working device. Characterization methods and representative results are also briefly discussed. Although this paper concentrates on double quantum dots, the fabrication process remains the same for single or triple dots or even arrays of quantum dots. Moreover, the protocol can be adapted to fabricate lateral quantum dots on other substrates, such as Si/SiGe.

This paper presents a detailed fabrication protocol for gate-defined semiconductor lateral quantum dots on gallium arsenide heterostructures. These nanoscale devices are used to trap few electrons for use as quantum bits in quantum information processing or for other mesoscopic experiments such as coherent conductance measurements.

게이트 정의 갈륨 비소 / AlGaAs 측면 양자점 나노

A quantum computer is a computer composed of quantum bits (qubits) that takes advantage of quantum effects, such as superposition of states and ...

Solubilization and Bio-conjugation of Quantum Dots and Bacterial Toxicity Assays by Growth Curve and Plate Count

Quantum dots (QDs) are fluorescent semiconductor nanoparticles with size-dependent emission spectra that can be excited by a broad choice of wavelengths. QDs have attracted a lot of interest for imaging, diagnostics, and therapy due to their bright, stable fluorescence1,2 3,4,5. QDs can be conjugated to a variety of bio-active molecules for binding to bacteria and mammalian cells6.
QDs are also being widely investigated as cytotoxic agents for targeted killing of bacteria. The emergence of multiply-resistant bacterial strains is rapidly becoming a public health crisis, particularly in the case of Gram negative pathogens 7. Because of the well-known antimicrobial effect of certain nanomaterials, especially Ag, there are hundreds of studies examining the toxicity of nanoparticles to bacteria 8. Bacterial studies have been performed with other types of semiconductor nanoparticles as well, especially TiO2 9,10-11, but also ZnO12 and others including CuO 13. Some comparisons of bacterial strains have been performed in these studies, usually comparing a Gram negative strain with a Gram positive. With all of these particles, mechanisms of toxicity are attributed to oxidation: either the photogeneration of reactive oxygen species (ROS) by the particles or the direct release of metal ions that can cause oxidative toxicity. Even with these materials, results of different studies vary greatly. In some studies the Gram positive test strain is reportedly more sensitive than the Gram negative 10; in others it is the opposite 14. These studies have been well reviewed 15.
In all nanoparticle studies, particle composition, size, surface chemistry, sample aging/breakdown, and wavelength, power, and duration of light exposure can all dramatically affect the results. In addition, synthesis byproducts and solvents must be considered16 17. High-throughput screening techniques are needed to be able to develop effective new nanomedicine agents.
CdTe QDs have anti-microbial effects alone18 or in combination with antibiotics. In a previous study, we showed that coupling of antibiotics to CdTe can increase toxicity to bacteria but decrease toxicity to mammalian cells, due to decreased production of reactive oxygen species from the conjugates19. Although it is unlikely that cadmium-containing compounds will be approved for use in humans, such preparations could be used for disinfection of surfaces or sterilization of water.
In this protocol, we give a straightforward approach to solubilizing CdTe QDs with mercaptopropionic acid (MPA). The QDs are ready to use within an hour. We then demonstrate coupling to an antimicrobial agent.
The second part of the protocol demonstrates a 96-well bacterial inhibition assay using the conjugated and unconjugated QDs. The optical density is read over many hours, permitting the effects of QD addition and light exposure to be evaluated immediately as well as after a recovery period. We also illustrate a colony count for quantifying bacterial survival.

Nanoparticles such as semiconductor quantum dots (QDs) can be used to create photoactivatable agents for anti-microbial or anti-cancer applications. This technique shows how to water-solubilize cadmium telluride (CdTe) QDs, conjugate them to an antibiotic, and perform a bacterial inhibition assay based upon growth curves and plate count.

성장 곡선 및 플레이트 카운트하여 양자 점 및 세균성 독성 Assays의 Solubilization 및 바이오 활용

Quantum dots (QDs) are fluorescent semiconductor nanoparticles with size-dependent emission spectra that can be excited by a broad choice of wavelengths. ...

생체공학

Silicon Metal-oxide-semiconductor Quantum Dots for Single-electron Pumping

As mass-produced silicon transistors have reached the nano-scale, their behavior and performances are increasingly affected, and often deteriorated, by quantum mechanical effects such as tunneling through single dopants, scattering via interface defects, and discrete trap charge states. However, progress in silicon technology has shown that these phenomena can be harnessed and exploited for a new class of quantum-based electronics. Among others, multi-layer-gated silicon metal-oxide-semiconductor (MOS) technology can be used to control single charge or spin confined in electrostatically-defined quantum dots (QD). These QD-based devices are an excellent platform for quantum computing applications and, recently, it has been demonstrated that they can also be used as single-electron pumps, which are accurate sources of quantized current for metrological purposes. Here, we discuss in detail the fabrication protocol for silicon MOS QDs which is relevant to both quantum computing and quantum metrology applications. Moreover, we describe characterization methods to test the integrity of the devices after fabrication. Finally, we give a brief description of the measurement set-up used for charge pumping experiments and show representative results of electric current quantization.

The fabrication process and experimental characterization techniques relevant to single-electron pumps based on silicon metal-oxide-semiconductor quantum dots are discussed.

As mass-produced silicon transistors have reached the nano-scale, their behavior and performances are increasingly affected, and often deteriorated, by ...

Synthesis of Cd-free InP/ZnS Quantum Dots Suitable for Biomedical Applications

Fluorescent nanocrystals, specifically quantum dots, have been a useful tool for many biomedical applications. For successful use in biological systems, quantum dots should be highly fluorescent and small/monodisperse in size. While commonly used cadmium-based quantum dots possess these qualities, they are potentially toxic due to the possible release of Cd2+ ions through nanoparticle degradation. Indium-based quantum dots, specifically InP/ZnS, have recently been explored as a viable alternative to cadmium-based quantum dots due to their relatively similar fluorescence characteristics and size. The synthesis presented here uses standard hot-injection techniques for effective nanoparticle growth; however, nanoparticle properties such as size, emission wavelength, and emission intensity can drastically change due to small changes in the reaction conditions. Therefore, reaction conditions such temperature, reaction duration, and precursor concentration should be maintained precisely to yield reproducible products. Because quantum dots are not inherently soluble in aqueous solutions, they must also undergo surface modification to impart solubility in water. In this protocol, an amphiphilic polymer is used to interact with both hydrophobic ligands on the quantum dot surface and bulk solvent water molecules. Here, a detailed protocol is provided for the synthesis of highly fluorescent InP/ZnS quantum dots that are suitable for use in biomedical applications.

In this protocol, the synthesis of Cd-free InP/ZnS quantum dots (QDs) is detailed. InP-based QDs are gaining popularity due to the toxicity of Cd2+ ions that may be released through nanoparticle degradation. After synthesis, QDs are solubilized in water using an amphiphilic polymer for use in biomedical applications.

바이오 메디컬 응용 프로그램에 적합 InP를 /의 ZnS 양자점 CD-자유의 합성

Fluorescent nanocrystals, specifically quantum dots, have been a useful tool for many biomedical applications. For successful use in biological systems, ...

화학

Enhanced Electron Injection and Exciton Confinement for Pure Blue Quantum-Dot Light-Emitting Diodes by Introducing Partially Oxidized Aluminum Cathode

Stable and efficient red (R), green (G), and blue (B) light sources based on solution-processed quantum dots (QDs) play important roles in next-generation displays and solid-state lighting technologies. The brightness and efficiency of blue QDs-based light-emitting diodes (LEDs) remain inferior to their red and green counterparts, due to the inherently unfavorable energy levels of different colors of light. To solve these problems, a device structure should be designed to balance the injection holes and electrons into the emissive QD layer. Herein, through a simple autoxidation strategy, pure blue QD-LEDs which are highly bright and efficient are demonstrated, with a structure of ITO/PEDOT:PSS/Poly-TPD/QDs/Al:Al2O3. The autoxidized Al:Al2O3 cathode can effectively balance the injected charges and enhance radiative recombination without introducing an additional electron transport layer (ETL). As a result, high color-saturated blue QD-LEDs are achieved with a maximum luminance over 13,000 cd m-2, and a maximum current efficiency of 1.15 cd A-1. The easily controlled autoxidation procedure paves the way for achieving high-performance blue QD-LEDs.

A protocol is presented for fabricating high-performance, pure blue ZnCdS/ZnS-based quantum dots light-emitting diodes by employing an autoxidized aluminum cathode.

Stable and efficient red (R), green (G), and blue (B) light sources based on solution-processed quantum dots (QDs) play important roles in next-generation ...

Synthesis of In37P20(O2CR)51 Clusters and Their Conversion to InP Quantum Dots

This text presents a method for the synthesis of In37P20(O2C14H27)51 clusters and their conversion to indium phosphide quantum dots. The In37P20(O2CR)51 clusters have been observed as intermediates in the synthesis of InP quantum dots from molecular precursors (In(O2CR)3, HO2CR, and P(SiMe3)3) and may be isolated as a pure reagent for subsequent study and use as a single-source precursor. These clusters readily convert to crystalline and relatively monodisperse samples of quasi-spherical InP quantum dots when subjected to thermolysis conditions in the absence of additional precursors above 200 &#176;C. The optical properties, morphology, and structure of both the clusters and quantum dots are confirmed using UV-Vis spectroscopy, photoluminescence spectroscopy, transmission electron microscopy, and powder X-ray diffraction. The molecular symmetry of the clusters is additionally confirmed by solution-phase 31P NMR spectroscopy. This protocol demonstrates the preparation and isolation of atomically-precise InP clusters, and their reliable and scalable conversion to InP QDs.

Synthesis of In37P20O2CR51 Clusters and Their Conversion to InP Quantum Dots

A protocol for the synthesis of In37P20(O2C14H27)51 clusters and their conversion to indium phosphide quantum dots is presented.

37P 20(o2CR)51 클러스터의 합성 및 InP 양자 점으로의 변환

This text presents a method for the synthesis of In37P20(O2C14H27)51 clusters and their conversion to indium phosphide quantum dots. The In37P20(O2CR)51 ...

Correlative Light- and Electron Microscopy Using Quantum Dot Nanoparticles

A method is described whereby quantum dot (QD) nanoparticles can be used for correlative immunocytochemical studies of human pathology tissue using widefield fluorescence light microscopy and transmission electron microscopy (TEM). To demonstrate the protocol we have immunolabeled ultrathin epoxy sections of human somatostatinoma tumor using a primary antibody to somatostatin, followed by a biotinylated secondary antibody and visualization with streptavidin conjugated 585 nm cadmium-selenium (CdSe) quantum dots (QDs). The sections are mounted on a TEM specimen grid then placed on a glass slide for observation by widefield fluorescence light microscopy. Light microscopy reveals 585 nm QD labeling as bright orange fluorescence forming a granular pattern within the tumor cell cytoplasm. At low to mid-range magnification by light microscopy the labeling pattern can be easily recognized and the level of non-specific or background labeling assessed. This is a critical step for subsequent interpretation of the immunolabeling pattern by TEM and evaluation of the morphological context. The same section is then blotted dry and viewed by TEM. QD probes are seen to be attached to amorphous material contained in individual secretory granules. Images are acquired from the same region of interest (ROI) seen by light microscopy for correlative analysis. Corresponding images from each modality may then be blended to overlay fluorescence data on TEM ultrastructure of the corresponding region.

A method is described whereby quantum dot (QD) nanoparticles can be used for correlative immunocytochemical studies of epoxy embedded human pathology tissue. We employ commercial antibody fragment conjugated QDs that are visualized by widefield fluorescence light microscopy and transmission electron microscopy.

양자점 나노 입자를 사용하여 상호 빛 - 및 전자 현미경

A method is described whereby quantum dot (QD) nanoparticles can be used for correlative immunocytochemical studies of human pathology tissue using ...

바이오마커 검출에서 향상된 감도를 위한 Quantum Dot Nanobeads

Fluorescent Lateral Flow Immunoassay Based on Quantum Dots Nanobeads

Quantum dots, also known as semiconductor nanocrystals, are novel fluorescent labels for biological imaging and sensing. However, quantum dot-antibody conjugates with small dimensions (~10 nm), prepared through laborious purification procedures, exhibit limited sensitivity in detecting certain trace disease markers using lateral flow immunoassay strips. Herein, we present a method for the preparation of quantum dot nanobeads (QDNB) using a one-step emulsion evaporation method. Using the as-prepared QDNB, a fluorescent lateral flow immunoassay was fabricated to detect disease biomarkers using C-reactive protein (CRP) as an example. Unlike single quantum dot nanoparticles, quantum dot nanobead-antibody conjugates are more sensitive as immunoassay labels due to signal amplification by encapsulating hundreds of quantum dots in one polymer composite nanobead. Moreover, the larger size of QDNBs facilitates easier centrifugation separation when conjugating QDNBs with antibodies. The fluorescent lateral flow immunoassay based on QDNBs was fabricated, and the CRP concentration in the sample was measured in 15 min. The test results can be qualitatively assessed under UV light illumination and quantitatively measured using a fluorescent reader within 15 min.

저자 스포트라이트: 고감도 형광 측면 유동 면역분석을 위한 고품질 Quantum Dot Nanobeads

Here, we describe a protocol for the preparation of quantum dot nanobeads (QDNB) and the detection of disease biomarkers using QDNB-based lateral flow immunoassay strips. The test results can be qualitatively assessed under UV light illumination and quantitatively measured using a fluorescent strip reader within 15 min.

Quantum Dots Nanobeads를 기반으로 한 형광 측면 유동 면역분석법

Quantum dots, also known as semiconductor nanocrystals, are novel fluorescent labels for biological imaging and sensing. However, quantum dot-antibody ...

생산 및 일가 양자점 타겟팅

요약

더 많은 비디오 탐색

이 비디오의 챕터

단일 분자 이미징을위한 소형 양자 점

게이트 정의 갈륨 비소 / AlGaAs 측면 양자점 나노

성장 곡선 및 플레이트 카운트하여 양자 점 및 세균성 독성 Assays의 Solubilization 및 바이오 활용

Silicon Metal-oxide-semiconductor Quantum Dots for Single-electron Pumping

바이오 메디컬 응용 프로그램에 적합 InP를 /의 ZnS 양자점 CD-자유의 합성

Enhanced Electron Injection and Exciton Confinement for Pure Blue Quantum-Dot Light-Emitting Diodes by Introducing Partially Oxidized Aluminum Cathode

₃₇P 20(o2CR)₅₁ 클러스터의 합성 및 InP 양자 점으로의 변환

양자점 나노 입자를 사용하여 상호 빛 - 및 전자 현미경

Quantum Dots Nanobeads를 기반으로 한 형광 측면 유동 면역분석법

Quantum Dots Nanobeads를 기반으로 한 형광 측면 유동 면역분석법