이 작품은 보조금 CRUK 15043 및 CRU​​K 14251에 의해 지원되었다. 우리는 기술 지원 및 원고의 중요한 읽기 다니엘 Wetterskog 및 카 케이 호 감사합니다.

응답 마커 1. 실험 섭동과 셀 라벨 (역 형질의 siRNA 화면) <ol><li> 멸균 조직 문화 후드 피펫에서 멸균, 일반 96 웰 플레이트의 우물에서 1X siRNA를 버퍼에 200 nM의 siRNA를 70 μL. 무 혈청 DMEM 매체의 볼륨 (40)로 형질 전환 된 지질 희석시키고 각 웰에 siRNA를 함유하는 105 μl를 분배. 참고 : 무 혈청 DMEM의 10.5 ml의에 262.5 μL 지질를 희석은 물론 당 지질의 2.6 μl를 제공, siRNA를의 전체 96 웰 플레이트에 적합한 마스터 믹스를 얻을 수 있습니다. 이 단계에서 200 nM의 siRNA를 시작 농도의 사용 단계 1.3에서 20 nm의 작업 농도를 제공 할 것입니다,하지만 절차는 적절하게 조정 시작 농도 (즉, 50 ㎚)로, 5 nm의 아래로 농도를 작업에 작동합니다. 그들에 응답하여 타겟의 크기를 감소시킬 수 있지만, 낮은 농도는 작동 온 타지 증가로 이어지는, 오프 - 타겟 스코어 위양성을 감소시킬 수있다위음성 율을 t. </li><li> 실온 전해조 부드럽게 진동 플레이트 섞는다. 세 50 μL로 결과 175 μl를 하위 분할은 투명 기재와, 96 웰 플레이트 처리 불투명, 조직 배양에 목표 PER 복제합니다. </li><li> 50 μL - 지질 복합체에 직접 siRNA를 10 % 혈청을 함유하는 150 μL의 DMEM에 웰 당 8,000 세포를 분배함으로써 역방향 트랜. 사용 HCT116 인간의 대장 암 세포를 안정적으로 CDK2 활동 5,8를보고 GFP 태그가 지정된 마커를 표현. 더 이상 혼합이 필요하지 않습니다. 습도를 제어하고 판 &#39;에지 효과&#39;를 방지하고 48 시간 동안 37 ° C, 5 % CO 2에서 가습 인큐베이터에 접시를 배치 멸균, 접착제 통기성 멤브레인 플레이트를 밀봉합니다. </li><li> 용지의 잔량이 적은 것을 웰에 남아 매체는 기음. 각 웰에 4 % 완충 포름 알데히드 100 ㎕를 첨가하여 세포를 고정시키고 실온 t에서 10 분 동안 흄 후드에서 부화칼 럼. </li><li> 접시를 흡입하여 고정 솔루션을 제거합니다. 어느 이때하는 플레이트를 한 다음 100 ㎕의 인산 완충 식염수 (PBS)로 세 번 세척하여 실험 중지는 주까지 4 ℃에서 어둠 속에서, PBS 100 ㎕ 하에서 밀봉 또는 진행 저장할 세포 투과성으로. 참고 : 우리는 고정 후 가능한 빨리 처리 판을 추천, 일반적으로 완전히 처리 플레이트의 스토리지를 선호합니다. 예컨대 치메로살, 아 지드 화 나트륨, 또는 상업적 대안으로서 살충 보존제 micoroganismal 성장을 방지하기 위해 첨가 될 수있다. 포스파타제 억제제를 첨가 포스 에피토프를 유지하도록 돕고, 다른 수단에 관련된 분석 콘텍스트에서 유용 할 수있는 단백질의 변형 상태를 보존 </li><li> 플레이트로부터 제거하고 PBS를 투과성으로 용액 100 ㎕를 첨가하여 세포를 Permeabilize 하시려면. 진탕없이 실온에서 10 분 동안 인큐베이션. multich를 사용하여 투과성으로 솔루션을 기음annel 피펫. 이 단계를 세 번 반복합니다. </li><li> 실온에서 30 분 동안 웰 당 100 μL 블록 용액을 첨가하여 세포를 차단. 실온에서 어둠 속에서 2 시간 동안 차단 용액에 500 배 희석 안티 P-S780의 RB1 항체 50 μL와 프로브, 플레이트를 흡입하여 블록 용액을 제거한다. </li><li> 5 분마다의 접시에 솔루션을 떠나, 100 μL 판 세척 용액으로 판을 세 번 씻으십시오. 염색질 특정 DNA 염료 Bisbenzimide 2 μM 보충 블록 솔루션 50 μl의 형광 표지 된 이차 항체 희석 1,000 배와 4 ° C에서 밤새 어둠 속에서 접시를 프로브. 4 ° C에서 어둠 속에서 100 μl의 PBS에서, 이전에 저장 밀봉으로 판을 세 번 씻으십시오. 이미지 2 주 이내에 접시입니다. </li></ol> 2. 이미징 및 영상 분할 <ol><li> 별도 취할 20 배의 목적으로 공 초점 또는 회전하는 디스크 형광 현미경을 사용하여 16- 비트, DNA 염료, GFP 및 면역 염색 형광체에 해당하는 세 개의 채널에서 그레이 스케일 TIFF 이미지. 비 중첩 이미지 세트 많은, 잘 당 이미지, 프레임으로 여기에 약 1,000-2,000 세포를 언급 캡처합니다. </li><li> 각각의 파일 이름 &#39;실험 이름&#39;, &#39;잘 어드레스&#39;의 순서로 &#39;프레임 번호&#39;및 &#39;채널 식별자&#39;(도 3)의 고유 한 조합이되도록 체계적 이미지 파일 이름. 예를 들어, 데이터 세트는 &quot;블루&quot;(염색질의 DNA 염색) 또는 &quot;녹색&quot;(GFP) 또는 &quot;레드&quot;채널 식별자로 (면역 염색 형광)을 사용합니다. 웰 주소, 프레임 번호 및 채널 식별자는 상기 이미지에 메타 데이터라고 칭한다. 혼란 잘 프레임 메타 데이터를 피하기 위해 밑줄 기호를 사용합니다. </li><li> 지정된 순서에 따라 메타 데이터 요소와 파일 이름을 지정합니다. 이는 후속 단계들은 소프트웨어 이리와! 빨리되도록하는 데 필요분석을위한 이미지 ctly 그룹 설정합니다. </li><li> 프리웨어 셀 프로파일을 다운로드하여 설치, 액티브 펄 커뮤니티 에디션, R 통계 프로그래밍 환경과 RStudio. 설치시 기본 옵션을 모두 수락; 액티브 펄을 설치 한 PC 사용자는 메시지 곳 PATH, 파일 확장자 협회 및 스크립트 매핑과 관련된 모든 옵션을 사용하도록 설정해야합니다. 액티브 펄은 Mac 사용자를위한 선택 사항이지만 그들은 그렇지 않으면 터미널 명령 줄에서 단계 3.2보다는 아이콘 클릭을 사용하여 Perl 스크립트를 실행해야합니다. </li><li> &#39;파일&#39; &#39;파일&#39;다음 &#39;가져 오기 파이프 라인&#39;을 클릭, 셀 프로파일 러 소프트웨어를 열고 파일 3_channels_pipeline.cppipe (그림 S1A 및 S1B)를 선택합니다. 이 파일은 설명 파일 이름 규칙에서 이미지 파일의 메타 데이터를 해석 할 수있는 소프트웨어에 필요한 지침이 포함되어 있습니다. 셀 프로파일 러는 이제 일에서 핵 DNA 항체 농도를 추출, 이미지에 관한양반과 각 셀에 대해 검출 (도 4 및 5) 세포질 강도 대 핵의 비율을 계산하는 GFP 채널을 사용한다. </li><li> 셀 프로파일 러 창의 왼쪽 아래 모서리에있는 버튼을 &#39;보기 출력 설정&#39;을 클릭합니다. 새로운 화면 상단의 &#39;기본 입력 폴더&#39;와 &#39;기본 출력 폴더&#39;라고 표시된 텍스트 상자입니다. 한번에 하나는,이 상자의 우측에 폴더 아이콘을 클릭하고 (S1C도)를 각각 추출 된 데이터에 대한 분석을위한 이미지 파일의 위치와 목적지를 선택한다. </li><li> 셀 프로파일 러의 왼쪽 하단 모서리에있는 &#39;분석 이미지&#39;버튼을 눌러 이미지 분석을 시작합니다. 화면 하단에있는 데이터 추출, &#39;STOP 분석&#39;과 &#39;일시 정지&#39;버튼의 남은 시간을 관찰합니다. 필요한 경우에 유용합니다 언제든지에서 &#39;일시 정지&#39;버튼을 선택하여 분석을 일시 중지영상을 시청하는 것이 분석되는 경우 (단계 2.8 참조). </li><li> 선택적으로, 프로그램 창 (그림 S1D)의 맨 왼쪽에있는 패널에서 눈 아이콘을 클릭하여 이미지 분석 단계 중 하나의 창을 엽니 다. 셀 프로파일의 현재 설정은 이미지 분할이 적합한 수행 (이러한 설정 수정에 대한 조언을 그림 1 및 토론 참조) 확인하기 위해 &#39;IdentifyPrimaryObjects&#39;창 &#39;차&#39;와 &#39;고등 객체&#39;에 대한 사람들을 관찰한다. </li><li> 분석이 완료되면 메시지 상자가 나타나면 &#39;확인&#39;을 클릭합니다. 결과에 모든 데이터 파일이 쉼표로 구분 된 값 (.csv) 파일 (그림 S2A)로 저장되는 위치 &#39;기본 출력 폴더&#39;로 이동합니다. </li></ol> 3. 데이터 추출 <ol><li> 사이에 포함 된 새 파일 &#39;Nuclei.csv&#39;을 찾기셀 프로파일에서 출력. 이 파일은 형광 핵 항체 강도, 핵 DNA 강도와 GFP-CDK2 기자 비율 값 (도 6A 및 S2A)에 대한 개별 셀의 데이터가 포함되어 있습니다. 주의 : 다른 실험실 분석 자신의 성질에 맞게 이러한 유형의 데이터를 처리 할 것이다. 항체 제공된 데이터 및 펄 스크립트 &#39;2_gate_classifier.pl&#39;를 이용하여 GFP-CDK2 리포터 값에 따라 각각의 처리 조건에서 세포의 게이팅은 현재 제안 된 데이터이다. </li><li> &#39;Nuclei.csv&#39;데이터 파일 (그림 S2A)와 동일한 폴더에 제공 Perl 스크립트 파일 &#39;2_gate_classifier.pl&#39;를 복사합니다. 두 번 클릭하여 Perl 스크립트의 아이콘과 메시지가 표시되면, 세포가 항체 마지막으로 게이트 값 게이트 및 작성할 수있는 파일의 &#39;.CSV&#39;파일 이름 이름 다음에 데이터 파일의 전체 이름을 입력형광 및 GFP-CDK2 기자 데이터. 참고 : 주로 게이트 설정을 확인하고 데이터의 분석을 위해 이러한를 적용하는 방법이 대표적인 데이터 섹션 및 그림 6에 아래에 설명되어 있습니다 (데이터 제공 사용 &#39;0.004&#39;각각 &#39;1.5&#39;, 분석). Mac 사용자가 입력하여 터미널 명령 행에서 Perl 스크립트를 실행해야합니다 : &#39;펄 2_gate_classifier.pl을&#39;. </li><li> 각 웰에서 각 셀은 모두 게이트 (그림 6C)에 대해 수행하는 방법을 보여 하위 집단 레이블 원래 셀 프로파일 데이터로부터 원료 개별 셀의 분석 값을 결합하여 새로 생성 된 파일을 확인하십시오. </li><li> RStudio 소프트웨어를 개방함으로써 개별 셀 모집단 라벨을 사용하여 각 실험 조건에 대한 데이터를 그린다. &#39;파일&#39;과 &#39;파일 열기&#39;를 클릭 한 후 제공 &#39;analysis.r&#39;파일을 선택합니다. 도 6B 음모 명령을 관찰, <sRStudio (도 S2B)의 상부 좌측 창 trong&gt; (7, 8). 왼쪽 창에서, 선, 5, 6에 큰 따옴표 기호 사이에, 게이트 데이터를 포함하는 폴더의 컴퓨터 주소를 입력합니다. ( &quot;/ 분석 폴더 / 분석 출력 C&quot;와 &quot;nuclei_gated.csv&quot;예를 들어,) 드라이브 문자와 각각 파일 자체의 이름을 포함합니다. 주 : RStudio 주어진 컴퓨터를 처음 사용하는 경우, R 그래픽 패키지 &#39;ggplot2&#39;이 처음 설치 될 필요가있을 것이다. 이는이 단계가 중복이되는 후 RStudio의 새 설치에 대해 한 번만 단계입니다. &#39;ggplot2&#39;를 설치하려면, RStudio의 오른쪽 하단 모서리에있는 창 위의 &#39;패키지&#39;라는 탭을 클릭이 아래에 나타납니다 &#39;패키지 설치&#39;버튼을 클릭합니다. 새 창이 나타납니다. &#39;패키지의 타입으로&#39;ggplot2 &#39;(생략 인용)이 새 창에서 속도와 마지막 단계 3.6에서 계속 창을 닫으 필요한 ggplot2 기능을 설치하고 주 RStudio 창으로 돌아갑니다 &#39;설치&#39;버튼을 클릭합니다. </li><li> RStudio의 왼쪽 창에서 17을 통해 강조 라인 한 후 &#39;실행&#39;버튼을 클릭합니다. 이 R (그림 S2C)에 실험 데이터, 임계 값과 잘 위치 세부 정보를 입력 할 수 있습니다. R 지금은 일시적으로 플로팅 관련 데이터를 개최한다. </li><li> 라인 (17) 아래에있는 나머지 코드의 각각의 블록을 선택하고 이전과 &#39;실행&#39;버튼을 클릭하여 해당 플롯을 만들 수 있습니다. RStudio의 오른쪽 하단 모서리에있는 창에 플롯을 관찰하고 &#39;내보내기&#39;버튼 (그림 S2D)을 클릭하여 형식의 수를 저장합니다. </li><li> RStudio을 닫는 동안 메시지가 표시되면 &#39;저장 안함&#39;을 클릭합니다. 이것은 그렇지 않으면 데이터를 개최한다 RStudio의 다음 사용에 혼란을 방지이전 세션에서. </li></ol>

<ol>
	<li>Carpenter, A. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CellProfiler:+image+analysis+software+for+identifying+and+quantifying+cell+phenotypes.">CellProfiler: image analysis software for identifying and quantifying cell phenotypes.</a> Genome Biol. 7 (10), 100 (2006).</li><li>Khan, A., Eldaly, H., Rajpoot, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+gamma-gaussian+mixture+model+for+detection+of+mitotic+cells+in+breast+cancer+histopathology+images.">A gamma-gaussian mixture model for detection of mitotic cells in breast cancer histopathology images.</a> J Pathol Inform. 4, 11 (2013).</li><li>Selzer, P., Beibel, M., Gubler, H., Parker, C. N., Gabriel, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparison+of+multivariate+data+analysis+strategies+for+high-content+screening.">Comparison of multivariate data analysis strategies for high-content screening.</a> J Biomol Screen. 16 (3), 338-347 (2011).</li><li>Lyman, S. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High+content,+high-throughput+analysis+of+cell+cycle+perturbations+induced+by+the+HSP90+inhibitor+XL888.">High content, high-throughput analysis of cell cycle perturbations induced by the HSP90 inhibitor XL888.</a> PLoS One. 6 (3), e17692 (2011).</li><li>Richardson, E., Stockwell, S. R., Li, H., Aherne, W., Cuomo, M. E., Mittnacht, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mechanism-based+screen+establishes+signalling+framework+for+DNA+damage-associated+G1+checkpoint+response.">Mechanism-based screen establishes signalling framework for DNA damage-associated G1 checkpoint response.</a> PLoS One. 7 (2), e17692 (2012).</li><li>Heynen-Genel, S., Pache, L., Chanda, S. K., Rosen, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Functional+genomic+and+high-content+screening+for+target+discovery+and+deconvolution.">Functional genomic and high-content screening for target discovery and deconvolution.</a> Expert Opin Drug Discov. 7 (10), 955-968 (2012).</li><li>Krausz, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-content+siRNA+screening.">High-content siRNA screening.</a> Mol Biosyst. 3 (4), 232-240 (2007).</li><li>Gu, J., Xia, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell+Cycle-dependent+Regulation+of+a+Human+DNA+Helicase+That+Localizes+in.">Cell Cycle-dependent Regulation of a Human DNA Helicase That Localizes in.</a> DNA Damage Foci. Mol Biol Cell. 15 (7), 3320-3332 (2004).</li><li>Mittnacht, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Control+of+pRB+phosphorylation.">Control of pRB phosphorylation.</a> Curr Opin Genet Dev. 8 (1), 21-27 (1998).</li><li>Mittnacht, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+retinoblastoma+protein--from+bench+to+bedside.">The retinoblastoma protein--from bench to bedside.</a> Eur J Cell Biol. 84 (2-3), 97-107 (2005).</li><li>Nybo, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=GFP+imaging+in+fixed+cells.">GFP imaging in fixed cells.</a> BioTechniques. 52 (6), 359-360 (2012).</li><li>Schwartz, R. L., Foy, B. D., Phoenix, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Learning Perl - Making Easy Things Easy and Hard Things Possible. , 1-363 (2011).</li><li>Wickham, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> ggplot2: Elegant Graphics for Data Analysis. , 978-970 (2009).</li></ol>

저자는 공개 아무것도 없어

설명한 워크 플로우의 siRNA, 후속 마커 검출을 통해 세포의 멀티 웰 동요하는 절차를 구성하고, 최종적으로 얻어진 형광 현미경 이미지에서 정량적 데이터의 추출을 용이하게하기 위해 소프트웨어를 지원하는 일련의 단계의 사용. 접근 방식은 많은 셀 기반 응용 프로그램의 광범위한 실용적인 응용 프로그램을 가지고 각각의 세포 핵 및 세포질 강도 값의 전달에 초점을 맞추고 있습니다. 여기에 사용되는 예시적인 데이터는 G1 단계에서 세포주기 통과 두 형광 분석법을 시험하고 다시 핵 DNA 함량의 직접적인 상관 관계를 측정하기 위해 생물 물리학 된 siRNA의 설정 화면이 생성 되었음. 그것은 개별 셀을 식별 할 수있게하고, 생성 된 &#39;핵 마스크&#39;대응 cytoplasmi를 식별 할 시작점 역할로서 화상 핵 DNA에 형광 DNA 얼룩의 사용은 이미지 분할 과정에서 필수적인 단계이다C 지역. 안정적으로 세포에서 발현되는 GFP-CDK2 태그 기자, 아직이 구획 묘사 될 수있는 세포질 배경 신호보다 일관되게 더 높은 변수를 제공한다. 동일한 분석 파이프 라인은 다른 적합한 형광 결합 기자 동요 그들의 응답을 이용하여 단백질 전좌 이벤트의 분석에 적용 할 수 있어야한다. 또한, 세포질 특정 형광 염료로 GFP 리포터-CDK2 치환하면이 알고리즘의 대안적인 사용은 세포질의 치수와 이미지의 상대적인 세포의 크기를 측정 할 수있는 것이다. 여기에 설명 된 영상 분할 전략 디자인의 또 다른 고려 사항은 DNA 정량화 통합 강도 값들을 제공하는 셀 프로파일의 사용이다. 강도의 통합 염색 데이터가 핵의 크기는 가능한 변화를 허용 핵 DNA에 대한 값 및 본 정량 프로파일 근접한을 나타냅니다대한 프로피 디움 요오드 스테인드 FACS 데이터. 그러나, 통합 강도는 항원 형광의 평균 강도로 예시 평균 농도가 더 생물학적 세포 구획 내 단백질 (및 관련 형광)의 집적 총량보다 중요한 곳 단백질 기능을 평가하는 적절한 수단을 제공하지 않을 수있다. 따라서 강도 값이 P-S780 RB1 및 GFP 데이터에 사용 된 것을 의미한다. 이 옵션은 셀 프로파일 러 소프트웨어의 &#39;ExportToSpreadsheet&#39;패널에서 발견되는 두 가지 모드 (평균 또는 통합) 데이터 평가의 사이에 변경합니다. 3_channels_pipeline.cppipe 파일 분석 설정은 예를 들어 데이터 세트의 이미지에 대해 최적화된다. 이 프로토콜을 사용하여 새 이미지 세트의 분석은 파일 이름이 명명 규칙은 위의 (그림 3) 기술 채택 할 것을 요구합니다. 또한, 감도는 배경에 대한 핵 DNA 염색 및 임계 값의 밝기에 맞게 값새 이미지 세트의 강도가 셀 프로파일 설정에서 조정해야 할 수도 있습니다. DNA 염색은 다양한 이미지 분할 마스크를 구축하기위한 보유 중요한 역할을 감안할 때,이 채널에 대한 정확한 감도 설정의인가는 셀 프로파일 소프트웨어와 새로운 영상 데이터의 성공적인 분석에 중요하다. 제공되는 셀 프로파일 설정 파일 (3_channels_pipeline.cppipe)는 새로운 데이터에 대한 분석을 적응에 가장 자주 유용한 매개 변수에 대한 메모가 포함되어 있습니다. 이 노트는 셀 프로파일 메인 윈도우 화면 상단의 텍스트 박스에 있고 민감도 설정을 변경하고 채널 수가 분석 될 조정에 대한 지침을 포함한다. 새로운 이미지 데이터에 대한 설정을 테스트하는 프로토콜의 2.8 절에 기소로 (그림 S1D &#39;... 확인 된 개체&#39;의 각각에 대해 &#39;눈&#39;아이콘을 열고 클릭하여 프로토콜 단계를 이미지 분석시 이미지 분할을 관찰 할 필요가있다 </strong&gt;). 핵 마스크가 올바르게 DNA 염색 이미지에서 식별된다면 특히, &#39;IdentifyPrimaryOjects&#39;를 통해 화상 데이터의 시각화 보여줄 것이다. &#39;IdentifyPrimaryOjects&#39;모듈의 셀 프로파일 러 소프트웨어 페이지에서 임계 값 보정 계수이다. 이 값의 시행 착오를 조정은 대부분의 핵 인식 오류를 수정합니다. 값은 각 이미지에 대해 배경 강도 DNA 채널 균형. 임계 값 보정 계수의 값은이보다 더 (일반 이미지에 대 한 좋은) 엄격한 미만 1 관대 한 (염색 및 배경의 적은 콘트라스트 이미지에 적합)입니다 1, 주위에 힌지. 셀 프로파일에서 개별 셀 데이터의 출력은 원시 다른 연구의 요구에 맞는 다양한 방식으로 분석 될 수있다. 여기에 도시 한 데이터로부터 생물학적 경향을 추출 돕기 위해 셀에 따라 측정 파라미터의 2 개에 게이트를 적용하는 펄 스크립트의 사용이다추가 측정으로 확인 된 개체군의 개발 허가 상호 참조. 그것이 셀 프로파일의 프레임 워크 내에서 게이팅의 요소를 포함 할 수도 있지만 동등하게, 여기서 사용되는 대체 경로가 큰 데이터 세트가 평가 될 필요가있는 경우 특히, 유연성 및 속도를 제공한다. 현재 프로토콜의 사후 이미지 수집 단계에서 가장 느린 단계는 셀 프로파일 러 소프트웨어의 실행이다. 필요한 경우 셀 프로파일 러는 여기에 다른 게이트 값을 반복적으로,보다 신속하게 후속 펄 스크립트를 재분석 할 수있는 게이팅 원시 데이터 세트를 생성하기 위해 게이트를 부과하지 않고 실행됩니다. 모든 연구는이 같은 적합한 게이트 값이 잠재적으로 시간이 지남에 따라 데이터의 특정 세트에 시약과 다를 수 있고 사전에 알 수 있습니다. 이 때문에, 적합한 가치있는 게이트를 식별하기 위해 양성 대조군 및 모델 섭동 전지용 셀 프로파일로부터 얻어진 원시 데이터 분포를 나타내는 히스토그램을 생성하는 추천관심의 매개 변수에 대한 말이지. 펄 스크립트는 셀 프로파일의 데이터를 엄격하게 정의 된 열 구조를 받아 작성하고 사용자가 &#39;ExportToSpreadsheet&#39;설정을 사용하여 셀 프로파일에 의해 매개 변수 출력의 수를 수정하는 경우 작동하지 않을 수 있습니다. 노트 펄 스크립트 파일에 포함 된 설정의 수정을 구현하는 데 도움합니다. 이러한 텍스트 편집기에서 스크립트보기를 참조하기 위해, 바람직하게는 프로그래머의 텍스트 편집기 (예를 들어, http://www.activestate.com/komodo-edit) 컬러 코드 펄 요소로 설정. 데이터 형식의 변화에​​ 적응하기 위해 스크립트를 조정하는 곳이 노트를 나타냅니다. 펄 스크립트와 유사하게, 이미지 분석 데이터로부터 인물 플로팅 명령을 포함 제공된 R-코드 파일 (analysis.r)는, 사용 및 적응에 대한 추가적인 정보를 참조하는 텍스트 편집기 또는 RStudio 소프트웨어에서 판독 할 수있다. 이 노트는 정규 표현식 펄 &lt;에 대한 자세한 내용을 보충 할 수있다SUP&gt; (12) 및 데이터 판독 주석 각각 플롯 방법에 대한 기초를 형성하는 둘 R, 13 대 ggplot2 패키지. 형광 현미경을 사용하여 새로운 연구뿐만 아니라 오픈 소스 공보 증착 원 데이터는 여기에 기재된 것과 같은 분석 방법 의무이다. 하이 콘텐츠 데이터의 본질은 임의의 주어진 관찰자의 연구 분야에 따라 다른 분석 역점으로 재귀 분석 빌려 준다. 상기 데이터의 요청받을 수 질문 원래 사용 프로브에 의해 제한되지만, 화상 데이터는 종종 의미들을 생성 연구 다루지 재분석 될 수있다.

여기에 제시된 작품은 각각의 세포와 정의 세포 내 영역을 식별하기 위해 부착 세포의 형광 현미경 이미지의 알고리즘을 유도 분석을 수행하기 위해 무료로 사용할 수있는 소프트웨어 셀 프로파일 러를 사용하는 방법을 설명한다. 이미지 분할이라고도 이러한 접근 방식은, 각 셀 또는 (분절화 된 객체 라 함) 세포 내 영역에 국부적 인 형광 표지 된 마커를 정량함으로써 묘화 셀의 후속 멀티 파라미터 분석을 허용한다. 이 흐름은 높은 함량 분석을 가능하게하기위한 기초를 구성하고, 추가로 개발 된 멀티 파라 맞게 수정, 개별 셀은 특수 고 함량 악기 또는 독점 소프트웨어에 액세스하지 않고도 실험실에서 분석 할 수있는 도구의 역할을하도록 의도된다. 이 원고가 공급 설명한 파일을 생성하는 분석 관련 미가공 이미지 데이터, 알고리즘 설정 및지지 스크립트 테스트 세트를 포함한다. 제공된 알고리즘 설정 F또는 셀 프로파일 설정 예제 데이터 및 조정이 다른 연구에서 이미지 데이터의 사용을 활성화 할 필요가있다 어떤 토론 섹션 세부 사항에 최적화되어 있습니다. 정량적 데이터 셀 프로파일을 사용하여 추출되고 나면, 다른 실험실 원시 데이터의 개별 셀 값에 의해 제공된 정보를 사용하는 방법에 대해 다른 요건을 가질 수있다; 여기에 표시된 게이트는 각각의 분석에 대한 원시 데이터에 적용되는 하나의 방법입니다. 이러한 게이트 사용 데이터는 게이트에 의해 정의 된 응답을받은 세포의 개체군과 다른 처리를 연결 추세 시각화를 허용 응답 이진면으로 변환된다. 게이트는 각 관련 측정을 위해 적절한 음성 및 양성 컨트롤에 대한 얻은 데이터 분포의 관찰에 기초하여 설정된다. 게이트의 사용 원료, 셀 기반 측정을 관리하는 방법의 한 예이다. 또한 여기에 표시된 핵 DNA 강도의 사용이다 나게이트 데이터와 함께 값의 연속적인 범위로 자신의 원시 형태 asurements. 이미지 분석 데이터를 관리 할 수​​있는 다른 방법들이 연구의 특성에 따라 고려되어야한다; 소집단에 셀을 할당하는 게이트를 사용하는 대안 통계적 파라미터들의 많은 수를 세보고되었다 걸쳐 높은 컨텐츠 데이터를 요약하는 전략이 체계적인 비교를보고되었다. 6 - 이미지 데이터의 고 함량의 분석은 약물 반응 세포 연구에도 사용되어왔다 유전학 4 시그널링 환경 스트레스 역방향. 고 함량 분석의 장점은 형광 현미경 데이터의 알고리즘 분석 및 정량 공간 파라미터가 개별 셀 7 걸쳐 동시에 고려 될 수 있다는 사실로부터 유래한다. 이러한 방식으로, 다수의 분석 결과는 셀룰러 분석-D의 상호 참조, 차동 동작 될 수있다efined 세포 개체군은 형태 학적 변수의 고려를 포함 할 수 있습니다 실험 조건과 분석에서 추적 할 수 있습니다. 전략 및 분석 워크 플로우는 다른 높은 콘텐츠 접근에 관해서는, 각각의 세포에 교차 참조 다중화 된 데이터를 제공 할 수있다, 여기에서 논의. 형광 현미경 이미지를 생성하고 이미지의 수천을 통해 처리량이 낮은 기존의 형광 기반의 현미경에서 생성 된 이미지의 수십에 이르기까지 데이터의 분석에 적용 할 수있는 높은 콘텐츠 방법 정장 연구 자동화 높은 콘텐츠 심사 플랫폼을 사용하여 제조. 흐름은 별도 분석법 핵 형광 표지 강도 또는 각각 형광 리포터 단백질의 핵 / 세포질 전좌, 하나의 관점에서 측정되는 예를 들어 데이터와 함께 여기에 설명된다. 흐름은이 분석법 별도로 또는 조합하여 고려 EAC에 따라 될 수 있다는 점에서 유연시간은 다른 연구자들에 의해 연구 문제를 주어진. 예를 들어 데이터는 RNA 간섭 (RNAi의) 실험 (도 1)의 일부로서 생성된다. 작은 간섭 RNA 올리고 뉴클레오티드 (siRNA의)는 사이클린 의존성 키나제 (CDK) 활동의 두 형광 기자의 변경 사항이 발생할 HCT116 인간의 대장 암 세포에서 특정 단백질을 녹다운하는 데 사용됩니다. 세린 핵 망막 모세포종 단백질 780 (P-S780의 RB1)의 CDK6 의존성 인산화 항체 염색에 의해 평가된다. 동일한 셀에서, CDK2 활성 (GFP-CDK2 기자)의 녹색 형광 단백질 표지 된 리포터는 CDK2 활성의 부재하에 리포터가 세포질로 핵 및 CDK2 활성 셔틀에있는 세포질 비율 핵에 의해 평가되고 8. 또한, 각 셀의 DNA는 핵 DNA 인터 - 염료를 사용하여 염색하고, 이미지의 경계를 핵 세포를 식별하고 정의하기위한 수단을 구성한다 Bisbenzimide뿐만DNA 풍부 세포의 세포주기의 위치에 대한 정보를 제공한다 (그림 2)의 SA 측정. CDK2 및 CDK6의 활성은 세포주기 (5)의 S G1 단계로의 세포 수송과 같은 검출 가능한 그러한 개별 셀 내의 두 기자 간의 일치도 확대가 예상되는 바와 같이, 서로 9,10 성공할. 여기서 사용되는 데이터 세트는 데모의 siRNA의 효과 CDK6, 망막 모세포종 단백질 (RB1) 및 비 - 타겟팅 음성 대조군 (표 1)을 대상으로 예로서 분석한다. CDK6의 녹다운 P-S780의 RB1 에피토프의 저하 및 세포주기의 G1 단계에서 세포의 축적을 유도한다 모두. RB1 녹다운는 포스 S780 항체의 특이성 시약 제어부로서 기능한다. 포르말린에서 형광 현미경 이미지는 형광 염색 HCT116 조직 배양 세포를 이미지 분석 알고리즘에 사용되는, 11 고정. 결과 숫자 데이터는 데 사용됩니다상호 참조 기자와는 다른 최저 상태의 영향을 측정. 이러한 유형의 분석에 의해 생성 된 데이터의 크기는 정상 전위 분석 도구에 도전을 제공 할 수있다. 예를 들어, 개별 데이터 셀은 스프레드 시트 소프트웨어 일부가 수용 할 수보다 클 수있다. 큰 데이터 세트의 분석을 돕기 위해 데이터의 단순, 높은 반복, 감독 처리를 수행 펄 스크립트가 포함되어 있습니다. 펄 스크립트는 특정 파일 명명 규칙 (도 3)와 함께 이미지 파일을 처리 할 때 셀 프로파일에 의해 생성되는 출력 파일에 대해 특별히 기록하고 분석에 사용되는 웰 당 분야의 가변 수 있도록되어있다. 그것은 세포 아 집단 5 ​​동향을 추적 게이트 개별 세포 분석 데이터에 자주 중요하고 여기에 도시 각 분석 유형에 대해 소정 세트 게이트에 기초하여 각각의 셀은 플래그 펄 스크립트의 사용이다. 또한 포함 된 옵션 펄 스크립트는이는 개별 우물 (또는 조건)에 대한 데이터 결과를 요약, 제공 : 세트 게이트 내에서 세포와 원시 분석 점수의 평균 값의 비율입니다. 응답이 전부 또는 웰 내의 다수의 셀에 영향을주는 곳 시청 데이터를 후자보다 균질 방법은 유효하다. 전술 한 바와 같이, 이러한 평가는 응답이 모집단 내의 셀의 서브 세트로 한정되는 개별 셀 데이터 게이팅 의해 수득보다 덜 유용하다. 설명한 워크 플로우의 유틸리티 또는 siRNA에 기재된 마커 분석에 의해 섭동에 한정되지 않는다. 연구는 siRNA를 조합, 화학 억제제 및 방사선 치료를 사용하여 조직 배양 실험에서와 CDK6 이외의 마커와 CDK2 활동 (5)의 평가에 대한 응답을 분석하기 위해이 방법을 사용했다. 개념적으로, 실험적 전략은 생물학적으로 유용한 세포 내 영역의 다양한 자동으로 등록 할 수 있습니다형광 현미경 이미지에 존재하는 각각의 세포에. 이와 같이,이 접근 방법은 개체군보다는 개별 셀에 초점 기술을 통해 누락 될 수 정량, 다중화 데이터 드러내는 생체 정보를 얻을 수있다. 약간의 수정으로 기술 된 접근 및 분석 워크 플로우는 형광 기반의 분석 출력 및 세포 생물학적 반응에 대한 양적, 개별 셀의 데이터를 얻을 수있는 DNA 함량의 정량적 평가, 핵이나 세포질 형광의 정량 또는 이들 사이에 마커의 셔틀 링 두 구획 개별적으로 또는 다중화 방식은 흥미 롭다. 출판 요구 사항은 점점 더 게시 된 데이터를 재분석을 찾고 실험실에도 직접적인 관심이 될 것입니다 여기에 설명 된 것과 같은 공개적으로 접근 원시 데이터에 대한 액세스 및 현미경 이미지 분석을위한 무료 도구에 익숙 제출을 향해 경향이있다.

<table><tbody><tr><td>AllStars negative control siRNA</td><td>Qiagen</td><td>1027280</td><td>Negative control siRNA.</td></tr><tr><td>CDK6 siRNA</td><td>Dharmacon/ Custom synthesis</td><td>NA</td><td>Antisense sequence: 5&#039; CUCUAGGCCAGUCUUCUUCUU</td></tr><tr><td>RB1 siRNA</td><td>Dharmacon/ Custom synthesis</td><td>NA</td><td>Antisense sequence: 5&#039; GGUUCAACUACGCGUGUAATT</td></tr><tr><td>5x siRNA buffer</td><td>Thermo Scientific</td><td>B-002000-UB-100</td><td>To be diluted with nuclease-free, non-DEPC treated water.</td></tr><tr><td>Nulcease-free water (non-DEPC)</td><td>Applied Biosystems</td><td>AM9937</td><td>For dilution of siRNA buffer.</td></tr><tr><td>Hiperfect</td><td>Qiagen</td><td>301705</td><td>Transfection lipid.</td></tr><tr><td>DMEM</td><td>Life Technologies</td><td>41966052</td><td>Pyruvate and high-glucose supplemented tissue culture media.</td></tr><tr><td>96 well tissue culture plate</td><td>Falcon</td><td>3072</td><td>Plain, 96 well tissue culture plate for the parallel, compartmentalized mixing of transfection complexes.</td></tr><tr><td>Packard Viewplate</td><td>Perkin Elmer LAS</td><td>6005182</td><td>96 well TC plate with optical base on which cells are transfected, grown, fixed and eventually imaged. Supplied with opaque, adhesive plate seals, which are used during storage of used plates.</td></tr><tr><td>Breathable membrane</td><td>Alpha Labs</td><td>LW2783</td><td>Sterile, gas-permeable, adhesive membrane.</td></tr><tr><td>Neutral buffered formalin, 10%</td><td>Sigma-Aldrich</td><td>HT5012-1CS</td><td>10% Formalin (4% formaldehyde) fixative used neat in protocol.</td></tr><tr><td>Triton X-100</td><td>Sigma-Aldrich</td><td>X100PC</td><td>Non-ionic detergent</td></tr><tr><td colspan="4">[header]</td></tr><tr><td>Tris</td><td>Sigma-Aldrich</td><td>T1503</td><td>Trizma base (tris(hydroxymethyl)aminomethane)</td></tr><tr><td>Tween 20</td><td>Sigma-Aldrich</td><td>P2287</td><td>For plate wash solution.</td></tr><tr><td>Anti-P-S780 RB1 antibody</td><td>Abcam</td><td>ab32513</td><td>Rabbit monoclonal</td></tr><tr><td>AlexaFluor647 Anti-rabbit</td><td>Invitrogen</td><td>A21245</td><td>Highly cross-adsorbed, fluorescently labelled secondary antibody.</td></tr><tr><td>Hoechst 33342 (Bisbenzimide)</td><td>Sigma-Aldrich</td><td>B2261</td><td>Fluorescent, chromatin-intercalating, DNA dye.</td></tr><tr><td>Permeabilization solution</td><td>NA</td><td>NA</td><td>0.1% Triton X-100 in 50 mM Tris-buffered saline, pH 8.0.</td></tr><tr><td>Plate wash solution</td><td>NA</td><td>NA</td><td>Tris-buffered saline containing 0.1% Tween-20.</td></tr><tr><td>Block solution</td><td>NA</td><td>NA</td><td>5% powdered milk in Tris-buffered saline and 0.1% Tween-20. For blocking plate prior to immuno-staining and dilution of antibodies.</td></tr><tr><td>Cell Profiler 2.1</td><td>Broad Institute</td><td></td><td>http://www.cellprofiler.org/download.shtml</td></tr><tr><td>Active Perl Community Edition</td><td>ActiveState</td><td></td><td>http://www.activestate.com/activeperl/downloads</td></tr><tr><td>R programming environment</td><td>The R Foundation</td><td></td><td>http://www.r-project.org</td></tr><tr><td>Rstudio</td><td>Rstudio</td><td></td><td>http://www.rstudio.com/</td></tr></tbody></table>

workflow for high-content, individual cell quantification of fluorescent markers from universal microscope data, supported by open source software

점착성 포유 동물 조직 배양 세포 모델에서의 동작을 관장하는 제어 메커니즘을 이해의 발전은 단일 셀 형태의 분석에 점점 의존하게된다. 세포 집단에서 바이오 마커의 평균 값을 반영하는 복합 데이터를 전달하는 방법은 연구 생물학적 시스템의 이질성을 반영 하위 집단 역학을 잃고 위험이 있습니다. 이을 유지, 전통적인 접근 방법에 의해 대체되고있다, 또는 높은 콘텐츠 현미경에 의해 평가를 할 수 있도록 개발 된 세포 분석의,보다 정교한 형태의 지원. 이러한 분석은 잠재적으로 독점 소프트웨어 패키지와 함께 제공으로 활성화 형광 바이오 마커의 이미지의 큰 숫자를 생성, 셀 당 멀티 파라미터 측정이 가능합니다. 그러나, 상대적으로 높은 자본 비용과 이러한 장치의 많은 overspecialization 많은 연구자 자신의 접근성을 방지했다. 여기에 설명입니다대부분의 형광 현미경의 이미지와 함께 사용하기에 적합 개별 세포의 특정 세포 내 지역의 여러 형광 마커 강도의 정량화를위한​​ 보편적으로 적용 워크 플로우. 이 워크 플로의 핵심 형광 마커 강도를 이러한 이미지로 각 셀, 정의 세포 내 영역으로 세그먼트를 구분하고 제공하는 무료로 사용할 수있는 휴대 프로파일 러 소프트웨어 (1)의 구현은이 지역에 특정 값입니다. 이미지 데이터로부터 개별 셀 세기 값의 추출이 워크 플로우의 중앙 목적 및 인간 세포에 부착 G1 체크 포인트 레귤레이터 siRNA의 화면에서 제어 데이터의 분석을 예시한다. 그러나, 여기에 제시된 플로 셀 섭동의 다른 수단으로부터의 데이터의 분석에 적용될 수있다 (예를 들면, 복합 화면) 이와 같이 형광 계 세포 마커의 다른 형태와는 실험실의 다양한 유용 할 것이다.

Watch this Scientific Journal Video about Workflow for High-content, Individual Cell Quantification of Fluorescent Markers from Universal Microscope Data, Supported by Open Source Software at JoVE.com

Workflow for High-content, Individual Cell Quantification of Fluorescent Markers from Universal Microscope Data, Supported by Open Source Software

형광 표지 된 세포의 다중 이미지 기반 분석을 가능하게하는 유연한 정보학 워크 플로우입니다 발표. 워크 플로는 핵 및 세포질 마커를 정량화하고 이러한 구획 사이에 마커 전위를 계산한다. 절차 96- 웰 포맷으로 간접 면역 형광에 의해 마커 검출 용 siRNA를 안정적인 방법을 사용하여 세포의 섭동 제공된다.

높은 콘텐츠, 오픈 소스 소프트웨어에 의해 지원되는 범용 현미경 데이터에서 형광 마커, 개별 셀 정량화를위한​​ 워크 플로우

Advances in understanding the control mechanisms governing the behavior of cells in adherent mammalian tissue culture models are becoming increasingly ...

workflow-for-high-content-individual-cell-quantification-fluorescent

Universidad San Sebastian

Research

JoVE Journal

Biology

12.9K 조회수.  UCL Cancer Institute.  형광 표지 된 세포의 다중 이미지 기반 분석을 가능하게하는 유연한 정보학 워크 플로우입니다 발표. 워크 플로는 핵 및 세포질 마커를 정량화하고 이러한 구획 사이에 마커 전위를 계산한다. 절차 96- 웰 포맷으로 간접 면역 형광에 의해 마커 검출 용 siRNA를 안정적인 방법을 사용하여 세포의 섭동 제공된다. 

비디오: Workflow for High-content, Individual Cell Quantification of Fluorescent Markers from Universal Microscope Data, Supported by Open Source Software

Isolation and Quantitative Immunocytochemical Characterization of Primary Myogenic Cells and Fibroblasts from Human Skeletal Muscle

The repair and regeneration of skeletal muscle requires the action of satellite cells, which are the resident muscle stem cells. These can be isolated from human muscle biopsy samples using enzymatic digestion and their myogenic properties studied in culture. Quantitatively, the two main adherent cell types obtained from enzymatic digestion are: (i) the satellite cells (termed myogenic cells or muscle precursor cells), identified initially as CD56+ and later as CD56+/desmin+ cells and (ii) muscle-derived fibroblasts, identified as CD56&#8211; and TE-7+. Fibroblasts proliferate very efficiently in culture and in mixed cell populations these cells may overrun myogenic cells to dominate the culture. The isolation and purification of different cell types from human muscle is thus an important methodological consideration when trying to investigate the innate behavior of either cell type in culture. Here we describe a system of sorting based on the gentle enzymatic digestion of cells using collagenase and dispase followed by magnetic activated cell sorting (MACS) which gives both a high purity (&#62;95% myogenic cells) and good yield (~2.8 x 106 &#177; 8.87 x 105 cells/g tissue after 7 days in vitro) for experiments in culture. This approach is based on incubating the mixed muscle-derived cell population with magnetic microbeads beads conjugated to an antibody against CD56 and then passing cells though a magnetic field. CD56+ cells bound to microbeads are retained by the field whereas CD56&#8211; cells pass unimpeded through the column. Cell suspensions from any stage of the sorting process can be plated and cultured. Following a given intervention, cell morphology, and the expression and localization of proteins including nuclear transcription factors can be quantified using immunofluorescent labeling with specific antibodies and an image processing and analysis package.

The main adherent cell types derived from human muscle are myogenic cells and fibroblasts. Here, cell populations are enriched using magnetic-activated cell sorting based on the CD56 antigen. Subsequent immunolabelling with specific antibodies and use of image analysis techniques allows quantification of cytoplasmic and nuclear characteristics in individual cells.

인간의 골격근에서 기본 근육 조직 세포와 섬유 아 세포의 분리 및 정량 면역 세포 화학 특성

The repair and regeneration of skeletal muscle requires the action of satellite cells, which are the resident muscle stem cells. These can be isolated ...

연구

발생학

Visualizing Cell-to-cell Transfer of HIV using Fluorescent Clones of HIV and Live Confocal Microscopy

By fusing the green fluorescent protein to their favorite proteins, biologists now have the ability to study living complex cellular processes using fluorescence video microscopy. To track the movements of the human immunodeficiency virus core protein during cell-to-cell transmission of human immunodeficiency virus, we have GFP-tagged the Gag protein in the context of an infectious molecular clone of HIV, called HIV Gag-iGFP. We study this viral clone using video confocal microscopy. In the following visualized experiment, we transfect a human T cell line with HIV Gag-iGFP, and we use fluorescently labeled uninfected CD4+ T cells to serve as target cells for the virus. Using the different fluorescent labels we can readily follow viral production and transport across intercellular structures called virological synapses. Simple gas permeable imaging chambers allow us to observe synapses with live confocal microscopy from minutes to days. These approaches can be used to track viral proteins as they move in from one cell to the next.

This visualized experiment is a guide for utilizing a fluorescent molecular clone of HIV for live confocal imaging experiments.

HIV와 라이브 공촛점 현미경의 형광 클론을 사용하여 HIV의 머릿속 휴대 전화 전송

By fusing the green fluorescent protein to their favorite proteins, biologists now have the ability to study living complex cellular processes using ...

면역학 및 감염병학

Quantitative Immunofluorescence to Measure Global Localized Translation

The mechanisms regulating mRNA translation are involved in various biological processes, such as germ line development, cell differentiation, and organogenesis, as well as in multiple diseases. Numerous publications have convincingly shown that specific mechanisms tightly regulate mRNA translation. Increased interest in the translation-induced regulation of protein expression has led to the development of novel methods to study and follow de novo protein synthesis in cellulo. However, most of these methods are complex, making them costly and often limiting the number of mRNA targets that can be studied. This manuscript proposes a method that requires only basic reagents and a confocal fluorescence imaging system to measure and visualize the changes in mRNA translation that occur in any cell line under various conditions. This method was recently used to show localized translation in the subcellular structures of adherent cells over a short period of time, thus offering the possibility of visualizing de novo translation for a short period during a variety of biological processes or of validating changes in translational activity in response to specific stimuli.

This manuscript describes a method to visualize and quantify localized translation events in subcellular compartments. The approach proposed in this manuscript requires a basic confocal imaging system and reagents and is rapid and cost-effective.

정량적 면역 형광 측정 글로벌 현지화 번역

The mechanisms regulating mRNA translation are involved in various biological processes, such as germ line development, cell differentiation, and ...

생화학

Light Sheet-based Fluorescence Microscopy of Living or Fixed and Stained Tribolium castaneum Embryos

The red flour beetle Tribolium castaneum has become an important insect model organism in developmental genetics and evolutionary developmental biology. The observation of Tribolium embryos with light sheet-based fluorescence microscopy has multiple advantages over conventional widefield and confocal fluorescence microscopy. Due to the unique properties of a light sheet-based microscope, three dimensional images of living specimens can be recorded with high signal-to-noise ratios and significantly reduced photo-bleaching as well as photo-toxicity along multiple directions over periods that last several days. With more than four years of methodological development and a continuous increase of data, the time seems appropriate to establish standard operating procedures for the usage of light sheet technology in the Tribolium community as well as in the insect community at large. This protocol describes three mounting techniques suitable for different purposes, presents two novel custom-made transgenic Tribolium lines appropriate for long-term live imaging, suggests five fluorescent dyes to label intracellular structures of fixed embryos and provides information on data post-processing for the timely evaluation of the recorded data. Representative results concentrate on long-term live imaging, optical sectioning and the observation of the same embryo along multiple directions. The respective datasets are provided as a downloadable resource. Finally, the protocol discusses quality controls for live imaging assays, current limitations and the applicability of the outlined procedures to other insect species.
This protocol is primarily intended for developmental biologists who seek imaging solutions that outperform standard laboratory equipment. It promotes the continuous attempt to close the gap between the technically orientated laboratories/communities, which develop and refine microscopy methodologically, and the life science laboratories/communities, which require 'plug-and-play' solutions to technical challenges. Furthermore, it supports an axiomatic approach that moves the biological questions into the center of attention.

Light Sheet-based Fluorescence Microscopy of Living or Fixed and Stained Tribolium castaneum Embryos

Imaging the morphogenesis of insect embryos with light sheet-based fluorescence microscopy has become state of the art. This protocol outlines and compares three mounting techniques appropriate for Tribolium castaneum embryos, introduces two novel custom-made transgenic lines well suited for live imaging, discusses essential quality controls and indicates current experimental limitations.

라이트 시트 기반의 형광 생활의 현미경 또는 고정 및 스테인드<em&gt; Tribolium castaneum</em&gt; 배아

The red flour beetle Tribolium castaneum has become an important insect model organism in developmental genetics and evolutionary developmental biology. ...

Single-Molecule Tracking Microscopy - A Tool for Determining the Diffusive States of Cytosolic Molecules

Single-molecule localization microscopy probes the position and motions of individual molecules in living cells with tens of nanometer spatial and millisecond temporal resolution. These capabilities make single-molecule localization microscopy ideally suited to study molecular level biological functions in physiologically relevant environments. Here, we demonstrate an integrated protocol for both acquisition and processing/analysis of single-molecule tracking data to extract the different diffusive states a protein of interest may exhibit. This information can be used to quantify molecular complex formation in living cells. We provide a detailed description of a camera-based 3D single-molecule localization experiment, as well as the subsequent data processing steps that yield the trajectories of individual molecules. These trajectories are then analyzed using a numerical analysis framework to extract the prevalent diffusive states of the fluorescently labeled molecules and the relative abundance of these states. The analysis framework is based on stochastic simulations of intracellular Brownian diffusion trajectories that are spatially confined by an arbitrary cell geometry. Based on the simulated trajectories, raw single-molecule images are generated and analyzed in the same way as experimental images. In this way, experimental precision and accuracy limitations, which are difficult to calibrate experimentally, are explicitly incorporated into the analysis workflow. The diffusion coefficient and relative population fractions of the prevalent diffusive states are determined by fitting the distributions of experimental values using linear combinations of simulated distributions. We demonstrate the utility of our protocol by resolving the diffusive states of a protein that exhibits different diffusive states upon forming homo- and hetero-oligomeric complexes in the cytosol of a bacterial pathogen.

3D single-molecule localization microscopy is utilized to probe the spatial positions and motion trajectories of fluorescently labeled proteins in living bacterial cells. The experimental and data analysis protocol described herein determines the prevalent diffusive behaviors of cytosolic proteins based on pooled single-molecule trajectories.

단일 분자 추적 현미경 검사법 - 세포화 분자의 확산 상태를 결정하는 도구

Single-molecule localization microscopy probes the position and motions of individual molecules in living cells with tens of nanometer spatial and ...

Quantitative Multispectral Analysis Following Fluorescent Tissue Transplant for Visualization of Cell Origins, Types, and Interactions

With the desire to understand the contributions of multiple cellular elements to the development of a complex tissue; such as the numerous cell types that participate in regenerating tissue, tumor formation, or vasculogenesis, we devised a multi-colored cellular transplant model of tumor development in which cell populations originate from different fluorescently colored reporter gene mice and are transplanted, engrafted or injected in and around a developing tumor. These colored cells are then recruited and incorporated into the tumor stroma. In order to quantitatively assess bone marrow derived tumor stromal cells, we transplanted GFP expressing transgenic whole bone marrow into lethally irradiated RFP expressing mice as approved by IACUC. 0ovarian tumors that were orthotopically injected into the transplanted mice were excised 6-8 weeks post engraftment and analyzed for bone marrow marker of origin (GFP) as well as antibody markers to detect tumor associated stroma using multispectral imaging techniques. We then adapted a methodology we call MIMicc- Multispectral Interrogation of Multiplexed cellular compositions, using multispectral unmixing of fluoroprobes to quantitatively assess which labeled cell came from which starting populations (based on original reporter gene labels), and as our ability to unmix 4, 5, 6 or more spectra per slide increases, we&#39;ve added additional immunohistochemistry associated with cell lineages or differentiation to increase precision. Utilizing software to detect co-localized multiplexed-fluorescent signals, tumor stromal populations can be traced, enumerated and characterized based on marker staining.1

Complex tissue masses, from organs to tumors, are composed of various cellular elements. We elucidated the contribution of cellular phenotypes within a tissue utilizing multi-labeled fluorescent transgenic mice in combination with multiparameter immunofluorescent staining followed by spectral unmixing to decipher cell origin as well as cell characteristics based on protein expression.

세포의 기원, 종류, 그리고 상호 작용의 시각화를위한 형광 조직 이식에 따라 정량 멀티 스펙트럼 분석

With the desire to understand the contributions of multiple cellular elements to the development of a complex tissue; such as the numerous cell types that ...

의학

환자 유래 종양 오가노이드의 약물 평가를 위한 자동 Kinetic Imaging

Multiplexed Live-Cell Imaging for Drug Responses in Patient-Derived Organoid Models of Cancer

Patient-derived organoid (PDO) models of cancer are a multifunctional research system that better recapitulates human disease as compared to cancer cell lines. PDO models can be generated by culturing patient tumor cells in extracellular basement membrane extracts (BME) and plating them as three-dimensional domes. However, commercially available reagents that have been optimized for phenotypic assays in monolayer cultures often are not compatible with BME. Herein, we describe a method to plate PDO models and assess drug effects using an automated live-cell imaging system. In addition, we apply fluorescent dyes that are compatible with kinetic measurements to quantify cell health and apoptosis simultaneously. Image capture can be customized to occur at regular time intervals over several days. Users can analyze drug effects in individual Z-plane images or a Z Projection of serial images from multiple focal planes. Using masking, specific parameters of interest are calculated, such as PDO number, area, and fluorescence intensity. We provide proof-of-concept data demonstrating the effect of cytotoxic agents on cell health, apoptosis, and viability. This automated kinetic imaging platform can be expanded to other phenotypic readouts to understand diverse therapeutic effects in PDO models of cancer.

저자 스포트라이트: Developing Multiplexed Kinetic Assay for Organoid-Based Drug Response Analysis (오가노이드 기반 약물 반응 분석을 위한 다중 역학 분석 개발)

Patient-derived tumor organoids are a sophisticated model system for basic and translational research. This methods article details the use of multiplexed fluorescent live-cell imaging for simultaneous kinetic assessment of different organoid phenotypes.

암의 환자 유래 오가노이드 모델에서 약물 반응을 위한 다중 라이브 셀 이미징

Patient-derived organoid (PDO) models of cancer are a multifunctional research system that better recapitulates human disease as compared to cancer cell ...

암 연구학

Ratiometric Calcium Imaging of Individual Neurons in Behaving Caenorhabditis Elegans

It has become increasingly clear that neural circuit activity in behaving animals differs substantially from that seen in anesthetized or immobilized animals. Highly sensitive, genetically encoded fluorescent reporters of Ca2+ have revolutionized the recording of cell and synaptic activity using non-invasive optical approaches in behaving animals. When combined with genetic and optogenetic techniques, the molecular mechanisms that modulate cell and circuit activity during different behavior states can be identified.
Here we describe methods for ratiometric Ca2+ imaging of single neurons in freely behaving Caenorhabditis elegans worms. We demonstrate a simple mounting technique that gently overlays worms growing on a standard Nematode Growth Media (NGM) agar block with a glass coverslip, permitting animals to be recorded at high-resolution during unrestricted movement and behavior. With this technique, we use the sensitive Ca2+ reporter GCaMP5 to record changes in intracellular Ca2+ in the serotonergic Hermaphrodite Specific Neurons (HSNs) as they drive egg-laying behavior. By co-expressing mCherry, a Ca2+-insensitive fluorescent protein, we can track the position of the HSN within ~ 1 &#181;m and correct for fluctuations in fluorescence caused by changes in focus or movement. Simultaneous, infrared brightfield imaging allows for behavior recording and animal tracking using a motorized stage. By integrating these microscopic techniques and data streams, we can record Ca2+ activity in the C. elegans egg-laying circuit as it progresses between inactive and active behavior states over tens of minutes.

Ratiometric Calcium Imaging of Individual Neurons in Behaving Caenorhabditis Elegans

This protocol describes the use of genetically encoded Ca2+ reporters to record changes in neural activity in behaving Caenorhabditis elegans worms. &#8195;

꼬마 선 충 을 행동에 개별 뉴런의 비율 칼슘 이미징

It has become increasingly clear that neural circuit activity in behaving animals differs substantially from that seen in anesthetized or immobilized ...

높은 콘텐츠, 오픈 소스 소프트웨어에 의해 지원되는 범용 현미경 데이터에서 형광 마커, 개별 셀 정량화를위한 워크 플로우

요약

더 많은 비디오 탐색

이 비디오의 챕터

인간의 골격근에서 기본 근육 조직 세포와 섬유 아 세포의 분리 및 정량 면역 세포 화학 특성

HIV와 라이브 공촛점 현미경의 형광 클론을 사용하여 HIV의 머릿속 휴대 전화 전송

정량적 면역 형광 측정 글로벌 현지화 번역

라이트 시트 기반의 형광 생활의 현미경 또는 고정 및 스테인드

단일 분자 추적 현미경 검사법 - 세포화 분자의 확산 상태를 결정하는 도구

세포의 기원, 종류, 그리고 상호 작용의 시각화를위한 형광 조직 이식에 따라 정량 멀티 스펙트럼 분석

암의 환자 유래 오가노이드 모델에서 약물 반응을 위한 다중 라이브 셀 이미징

암의 환자 유래 오가노이드 모델에서 약물 반응을 위한 다중 라이브 셀 이미징

암의 환자 유래 오가노이드 모델에서 약물 반응을 위한 다중 라이브 셀 이미징

꼬마 선 충 을 행동에 개별 뉴런의 비율 칼슘 이미징

높은 콘텐츠, 오픈 소스 소프트웨어에 의해 지원되는 범용 현미경 데이터에서 형광 마커, 개별 셀 정량화를위한​​ 워크 플로우

요약

더 많은 비디오 탐색

이 비디오의 챕터

인간의 골격근에서 기본 근육 조직 세포와 섬유 아 세포의 분리 및 정량 면역 세포 화학 특성

HIV와 라이브 공촛점 현미경의 형광 클론을 사용하여 HIV의 머릿속 휴대 전화 전송

정량적 면역 형광 측정 글로벌 현지화 번역

라이트 시트 기반의 형광 생활의 현미경 또는 고정 및 스테인드

단일 분자 추적 현미경 검사법 - 세포화 분자의 확산 상태를 결정하는 도구

세포의 기원, 종류, 그리고 상호 작용의 시각화를위한 형광 조직 이식에 따라 정량 멀티 스펙트럼 분석

암의 환자 유래 오가노이드 모델에서 약물 반응을 위한 다중 라이브 셀 이미징

암의 환자 유래 오가노이드 모델에서 약물 반응을 위한 다중 라이브 셀 이미징

암의 환자 유래 오가노이드 모델에서 약물 반응을 위한 다중 라이브 셀 이미징

꼬마 선 충 을 행동에 개별 뉴런의 비율 칼슘 이미징

높은 콘텐츠, 오픈 소스 소프트웨어에 의해 지원되는 범용 현미경 데이터에서 형광 마커, 개별 셀 정량화를위한 워크 플로우