Najmeh Nikpour and Fiona Alum provided suggestions and edited this manuscript. Department of Biochemistry at McGill University supported HM and VM with the CIHR Training Initiative in Chemical Biology. This work was supported by Canadian Institute of Health Research (CIHR) grant 119464 (to R. S.).

아래 프로토콜은 형광 계 RNA 편집 분석을 수행하기위한 절차를 설명한다. 분석은 단일 PCR 튜브, 실험의 범위에 따라 96 - 웰 또는 384 - 웰 플레이트에서 수행 될 수있다. 이어서 형광 신호는 적합한 실시간 PCR 검출 시스템에서 판독 될 수있다. 여기서 분석은 384 - 웰 플레이트의 맥락에서 설명된다. 1. 배양 T. brucei 세포 <ol><li> T.위한 성장 배지를 준비 brucei 형태의 세포를 procyclic. 매체의 1 L의 경우 : <ol><li> 800 ㎖의 miliQ 물에 25.4 g SDM-79 분말을 용해. </li><li> 10 M NaOH로 7.3 2 탄산 수소 나트륨의 g의 산도를 추가합니다. </li><li> 900 ㎖, 소독 필터의 최종 볼륨에 nanopure 물을 추가합니다. </li><li> 10 %의 최종 농도에 태아 혈청 (FBS), 페니실린 - 스트렙토 마이신 솔루션 헤민 (2.5 ㎎ / ㎖)를 추가 (V / V), 100 U / ㎖ 및 7.5 ㎎ / L이었다. </li></ol></li><li> T. &lt;300 ㎖를 성장EM&gt; 1.5 × 10 7 세포 / ml의 밀도로 70 rpm으로 흔들어 28 ° C에서 brucei의 1.7A 야생형 (procyclic 양식) 세포. 참고 :이과 활성 editosome 3 ㎖를 생산해야 ~ 600 편집 반응에 대한 충분한 총 단백질, 0.5 MG. </li><li> 4 ℃에서 10 분 동안 6,000 XG에서 원심 분리하여 세포를 수확 </li><li> 냉장 PBSG 버퍼 50 ㎖ (10 mM의 나 2 HPO 4, 10 밀리미터의 NaH 2 PO 4, 145 mM의 NaCl을, 6 mM의 포도당)와 펠렛을 씻어 10 분에서 10,000 XG에서 원심 분리하여 다시 세포를 스핀 다운 4 ° C. </li></ol> 원유 미토콘드리아의 2. 격리 참고 : 모든 단계를 editosome 활동을 유지하기 위해 얼음 또는 4 ° C에서 수행해야합니다. <ol><li> DTE 완충액 30 ㎖ (1 mM 트리스 - 염산 pH를 8.0 및 1 mM의 EDTA)에서 수확 한 세포를 재현 탁. 위로 쓰다듬​​어 아래로 얼음에 10 배 이상으로 세포막을 방해하는 40 ㎖ 멸균 다운스 호모 게 나이저 (사전 냉장)를 사용합니다. </리&gt; <li> 우선적으로 미토콘드리아를 가지고, 4 ° C에서 10 분 동안 15,800 XG에 0.25 M. 원심 분리기의 최종 농도에 균질로, 즉시 4.3 ml의 60 % 자당 (즉, 1.75 M W / V)를 추가합니다. </li><li> STM 버퍼 (20 MM 트리스 - 염산 산도 8.0, 250 MM의 자당과 2 mM의 MgCl2를) 4.6 ㎖에 미토콘드리아 펠렛을 Resuspend. I 각각 0.3 ㎜, 9 U / ㎖의 최종 농도 0.1 M 염화칼슘의 13.8 μL 및 RNA 분해 효소가없는 DNA 분해 효소의 4 μl를 추가합니다. 얼음에 1 시간 동안 혼합물을 품어. </li><li> 4 ℃에서 10 분 동안 15,800 XG에서 DNA 분해 효소 I. 원심 분리기를 불 활성화 STE 버퍼의 4.6 ML (20 MM 트리스 - 염산 산도 8.0, 250 MM의 자당과 2 mM의 EDTA)를 추가 </li><li> 400 용해 버퍼의 μL (10 MM 트리스 - 염산의 pH 7.2, 10 mM의 MgCl2를, 100 ㎜의 KCl, 1 ㎍ / ㎖의 펩 스타틴, 1 mM의 DTT 및 1X 완전한 EDTA없는 단백질 분해 효소 억제제) 및로 전송에서 펠렛을 재현 탁 의 미세 관. </li><li> 1 %의 최종 농도를 10 % 트리톤 X-100을 추가차 튜브 회전에서 4 ° C에서 15 분 동안 해물을 품어. </li><li> 4 ° C에서 15 분 동안 17,000 XG에 두 번 원심 분리하여 미토콘드리아 해물을 취소; 취소 뜨는 때마다 유지. </li></ol> 3. Editosome 정화 <ol><li> 부어 10 ㎖의 10 % -30 % (40 mM의 HEPES 산도 7.9, 20 밀리미터 밀리그램 (OAC) 2, 100 mM의 KCl을 2 배 HHE 그라데이션 버퍼를 사용하여 초 원심 분리기 튜브 (V / V) 선형 글리세롤 그라데이션 (표 1), 및 2 mM의 EDTA) 및 설명서를 다음으로 그라데이션 메이커. </li><li> 조심스럽게 글리세롤 그라데이션의 상단에서 솔루션 500 μl를 제거하고 부드럽게 지워 미토콘드리아 용해 액 500 μl를로드합니다. 초 원심 분리기를 사용하여 4 ° C에서 6 시간 동안 178,000 XG에 스핀. </li><li> 4 ° C에서 그라데이션의 위에서 아래로 순차적으로 500 μL의 분수를 수집 그런 다음 사용 때까지 -80 ° C에서 액체 질소와 저장소를 사용하여 분수를 동결 스냅. </li></ol><ol><li> 3 분 90 ° C에서 가열하여 1:1의 몰비 T7 프로모터 올리고 뉴클레오타이드 (5&#39;-TAATACGACTCACTATAGGG-3 &#39;)와 T7 프로모터 서열 (표 2)에 상보 시퀀스를 포함하고, 실온에서 냉각 각각의 DNA 템플릿을 어닐링 적어도 10 분. </li><li> 사용 설명서에 따라 시험 관내 전사 키트를 사용하여 RNA를 고쳐 쓰다. </li><li> 7 M 요소 염료 (7 M 요소, 0.05 % 크실렌 Cynol, 0.05 % 브로 모 페놀 블루)의 동일한 볼륨을 추가하여 전사 반응을 중지합니다. 9 %는 폴리 아크릴 아마이드 겔 (9 % 아크릴 아미드, 7 M 요소, 1X TBE)을 변성 살균 필터를 실행합니다. </li><li> 찾을 수있는 단파 UV 램프와 소비세 각각의 RNA와 자외선 (UV) 그림자를 사용합니다. 미세 원심 분리 튜브에 절개 된 젤 조각을 놓고 겔 용출 버퍼 400 μL (20 MM 트리스 - 염산의 pH 7.5, 250 ㎜의 NaOAc, 1 ㎜ EDTA 0.25 % SDS)를 추가합니다. 튜브 회전기에 RT에서 밤새 용리. </li><li> 프리 시즌차가운 100 % 에탄올 1 ㎖를 추가하고 30 분 또는 -20 ° C 하룻밤 -80 ° C에서 하나를 배양하여 용출 RNA를 pitate. </li><li> RNA를 펠렛 4 ° C에서 30 분 동안 16,000 XG에 원심 분리기. </li><li> 75 %의 에탄올 1 ㎖로 펠렛을 씻으십시오. 4 ℃에서 20 분 동안 16,000 XG에 원심 분리기 </li><li> 표 2에 나타낸 바와 같이, 원하는 농도를 달성하기의 RNase없는 물에 적절히 RNA 펠렛을 재현 탁. </li></ol> 5. 형광 기반의 RNA 편집 분석 <ol><li> 하나의 반응,, 미세 원심 분리 튜브에 preA6Rbz 1 pmol의 (1 μL) 2.5 pmol의 gA6Rbz (1 μL) (1:2.5 몰비)를 결합하여 3 분 동안 70 º C에서 배양 해에 대한 RT에 앉아 보자 적어도 10 분. </li><li> 한편 (25 mM의 HEPES pH가 7.9, 10 mM의 밀리그램 (OAC) 2, 50 mM의 KCl을 10 mM의 EDTA), 1 mM의 1X HHE 버퍼를 포함하는 편집 반응, preA6Rbz 및 gA6Rbz 않고, 표 3을 이용하여 마스터 믹스를 준비ATP, 5 MM의 염화칼슘, Torula 효모 RNA, 0.1 % 트리톤 X-100, 및 정제 editosome 16 NG / μL. </li><li> 마스터 믹스를 완료하기 위해 단련 preA6Rbz 및 gA6Rbz를 추가합니다. </li><li> RNase가없는 물 2 μL (무 화합물과 우물) 또는 200 μM의 화합물의 2 μL 하나를 포함하는 우물에 마스터 믹스 (표 3)의 18 μl를 분배하고 그림 5에 따라 플레이트 제어 샘플이 (가) 있습니다. </li><li> 접시 실러와 플레이트를 밀봉하고 공기 방울을 제거하기 위해, 아래 판을 회전. 4 시간 동안 28 ℃에서 배양한다. </li><li> 물론 각 gA6Rbz 경쟁의 25 pmol의 (2 μL)를 추가합니다. 아래 판을 회전 및 실시간 PCR 기계에 배치, 신선한 봉인을 놓습니다. 다음과 같은 실험을 프로그램 : 1 단계 : 5 분 동안 85 ° C; 2 단계 : 10 분 동안 24 ° C; 3 단계 : 중지합니다. </li><li> 23 μL의 최종 볼륨에 각 웰에 FRET 기판의 15 pmol의 (1 μL)를 추가합니다. 신선한 실러와 플레이트를 밀봉.신속하게 판을 회전 및 실시간 PCR 시스템에 다시 배치합니다. </li><li> 다음 단계로 새로운 실험을 프로그램 : 1 단계 : 1 분 37 ° C; 2 단계 : 읽기; 3 단계 : 1, 40 번 단계로 이동합니다; 4 단계 : 중지합니다. </li><li> 독서를 필요로 FAM 필터를 선택하는 모든 우물을 선택하여 설치 판을. 23 μL 및 실행을 시작으로 입력 볼륨. </li><li> 분석 용 막대 그래프에 슬로프를 플로팅하여 운동 측정을 얻기 위해 각 웰 / 샘플에서 얻은 값의 기울기를 계산한다. NOTE : 운동 판독은 시료와 배경 사이의 신호 대 잡음비를 향상시킨다; 배경 샘플은 제로에 가까운 경사를하는 것처럼. 엔드 포인트 독서는 높은 배경 잡음이 있습니다. </li></ol>

<ol>
	<li>Benne, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=transcript+of+the+frameshifted+coxII+gene+from+trypanosome+mitochondria+contains+four+nucleotides+that+are+not+encoded+in+the+DNA.">transcript of the frameshifted coxII gene from trypanosome mitochondria contains four nucleotides that are not encoded in the DNA.</a> Cell. 46, 819-826 (1986).</li><li>Hajduk, S., Ochsenreiter, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA+editing+in+kinetoplastids.">RNA editing in kinetoplastids.</a> RNA biology. 7, 229-236 (2010).</li><li>Aphasizhev, R., Aphasizheva, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Uridine+insertion/deletion+editing+in+trypanosomes:+a+playground+for+RNA-guided+information+transfer.">Uridine insertion/deletion editing in trypanosomes: a playground for RNA-guided information transfer.</a> Wiley interdisciplinary reviews RNA. 2, 669-685 (2011).</li><li>Seiwert, S. D., Stuart, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA+editing:+transfer+of+genetic+information+from+gRNA+to+precursor+mRNA+in+vitro.">RNA editing: transfer of genetic information from gRNA to precursor mRNA in vitro.</a> Science. 266, 114-117 (1994).</li><li>Weng, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Guide+RNA-binding+complex+from+mitochondria+of+trypanosomatids.">Guide RNA-binding complex from mitochondria of trypanosomatids.</a> Molecular. 32, 198-209 (2008).</li><li>Hashimi, H., Zikova, A., Panigrahi, A. K., Stuart, K. D., Lukes, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TbRGG1,+an+essential+protein+involved+in+kinetoplastid+RNA+metabolism+that+is+associated+with+a+novel+multiprotein+complex.">TbRGG1, an essential protein involved in kinetoplastid RNA metabolism that is associated with a novel multiprotein complex.</a> RNA. 14, 970-980 (2008).</li><li>Ammerman, M. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Architecture+of+the+trypanosome+RNA+editing+accessory+complex,+MRB1.">Architecture of the trypanosome RNA editing accessory complex, MRB1.</a> Nucleic Acids Res. 40, 5637-5650 (2012).</li><li>Huang, C. E., O'Hearn, S. F., Sollner-Webb, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Assembly+and+function+of+the+RNA+editing+complex+in+Trypanosoma+brucei+requires+band+III+protein.">Assembly and function of the RNA editing complex in Trypanosoma brucei requires band III protein.</a> Molecular and cellular biology. 22, 3194-3203 (2002).</li><li>Carnes, J., Trotter, J. R., Peltan, A., Fleck, M., Stuart, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA+editing+in+Trypanosoma+brucei+requires+three+different+editosomes.">RNA editing in Trypanosoma brucei requires three different editosomes.</a> Molecular and cellular biology. 28, 122-130 (2008).</li><li>Hearn, S. F., Huang, C. E., Hemann, M., Zhelonkina, A., Sollner-Webb, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Trypanosoma+brucei+RNA+editing+complex:+band+II+is+structurally+critical+and+maintains+band+V+ligase,+which+is+nonessential.">Trypanosoma brucei RNA editing complex: band II is structurally critical and maintains band V ligase, which is nonessential.</a> Molecular and cellular biology. 23, 7909-7919 (2003).</li><li>Schnaufer, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+RNA+ligase+essential+for+RNA+editing+and+survival+of+the+bloodstream+form+of+Trypanosoma+brucei.">An RNA ligase essential for RNA editing and survival of the bloodstream form of Trypanosoma brucei.</a> Science. 291, 2159-2162 (2001).</li><li>Tarun, S. Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=KREPA6+is+an+RNA-binding+protein+essential+for+editosome+integrity+and+survival+of+Trypanosoma+brucei.">KREPA6 is an RNA-binding protein essential for editosome integrity and survival of Trypanosoma brucei.</a> RNA. 14, 347-358 (2008).</li><li>Croft, S. L., Barrett, M. P., Urbina, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chemotherapy+of+trypanosomiases+and+leishmaniasis.">Chemotherapy of trypanosomiases and leishmaniasis.</a> Trends in parasitology. 21, 508-512 (2005).</li><li>Denise, H., Barrett, M. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Uptake+and+mode+of+action+of+drugs+used+against+sleeping+sickness.">Uptake and mode of action of drugs used against sleeping sickness.</a> Biochemical pharmacology. 61, 1-5 (2001).</li><li>Seiwert, S. D., Heidmann, S., Stuart, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Direct+visualization+of+uridylate+deletion+in+vitro+suggests+a+mechanism+for+kinetoplastid+RNA+editing.">Direct visualization of uridylate deletion in vitro suggests a mechanism for kinetoplastid RNA editing.</a> Cell. 84, 831-841 (1996).</li><li>Igo, R. P., Palazzo, S. S., Burgess, M. L., Panigrahi, A. K., Stuart, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Uridylate+addition+and+RNA+ligation+contribute+to+the+specificity+of+kinetoplastid+insertion+RNA+editing.">Uridylate addition and RNA ligation contribute to the specificity of kinetoplastid insertion RNA editing.</a> Molecular and cellular biology. 20, 8447-8457 (2000).</li><li>Igo, R. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Role+of+uridylate-specific+exoribonuclease+activity+in+Trypanosoma+brucei+RNA+editing.">Role of uridylate-specific exoribonuclease activity in Trypanosoma brucei RNA editing.</a> Eukaryotic cell. 1, 112-118 (2002).</li><li>Wang, B., Salavati, R., Heidmann, S., Stuart, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+hammerhead+ribozyme+substrate+and+reporter+for+in+vitro+kinetoplastid+RNA+editing.">A hammerhead ribozyme substrate and reporter for in vitro kinetoplastid RNA editing.</a> RNA. 8, 548-554 (2002).</li><li>Moshiri, H., Salavati, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+fluorescence-based+reporter+substrate+for+monitoring+RNA+editing+in+trypanosomatid+pathogens.">A fluorescence-based reporter substrate for monitoring RNA editing in trypanosomatid pathogens.</a> Nucleic Acids Res. 38, e138 (2010).</li><li>Jenne, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+identification+and+characterization+of+hammerhead-ribozyme+inhibitors+using+fluorescence-based+technology.">Rapid identification and characterization of hammerhead-ribozyme inhibitors using fluorescence-based technology.</a> Nature. 19, 56-61 (2001).</li><li>Hartig, J. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protein-dependent+ribozymes+report+molecular+interactions+in+real+time.">Protein-dependent ribozymes report molecular interactions in real time.</a> Nature. 20, 717-722 (2002).</li><li>Famulok, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Allosteric+aptamers+and+aptazymes+as+probes+for+screening+approaches.">Allosteric aptamers and aptazymes as probes for screening approaches.</a> Current opinion in molecular therapeutics. 7, 137-143 (2005).</li><li>Teng, B., Burant, C. F., Davidson, N. O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+cloning+of+an+apolipoprotein+B+messenger+RNA+editing+protein.">Molecular cloning of an apolipoprotein B messenger RNA editing protein.</a> Science. 260, 1816-1819 (1993).</li><li>Jurica, M. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Searching+for+a+wrench+to+throw+into+the+splicing+machine.">Searching for a wrench to throw into the splicing machine.</a> Nature chemical biology. 4, 3-6 (2008).</li><li>Spahn, C., Prescott, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Throwing+a+spanner+in+the+works:+antibiotics+and+the+translation+apparatus.">Throwing a spanner in the works: antibiotics and the translation apparatus.</a> Journal of molecular medicine. 74, 423-439 (1996).</li></ol>

The authors have nothing to disclose.

Trypanosomes의 RNA 편집 복잡한에 대한 억제제를 식별하는 새로운 높은 처리량 검사 방법은 trypanosomatids으로 인한 질병에 대응하기 위해 약물 발견을위한 새로운 도구를 제공하고, 제시했다. FRET 기반 리보 자임 분석은 광범위하게 다양한 용도 20-22에 사용되었다; 그러나, 우리는 RNA 편집 활동 (19)의 생체 모니터링을위한 FRET 기반 리보 자임의 분석의 능력을 활용했다. 이 분석은 잠재적으로 포유 동물 (23)의 핵 RNA를 인코딩의 뉴클레오티드 치환 편집과 같은 진핵 생물의 RNA 편집의 다른 유형에 적응 될 수있다. 이 분석의 참신 자체 FRET 기반 리보 자임의 분석을 확립 아니라, editosome에 대한 화학 물질의 높은 처리량 검사에 대한 의무가 RNA 편집 분석에이 기술을 통합하는 방법을 개발. 리보 자임 분석 기반의 방법은 다른 화면과 엉덩이에 비해 몇 가지 장점을 가지고있다AYS는 현재 이러한 목적을 위해 이용했다. 특히,이 기술은 따라서이 높은 처리량 검사 (19)를 위해 적합하고, 방사성 표지 한 반대로 형광 기판에 의존 민감하고 재현성 &quot;믹스 앤 측정&quot;분석을 제공합니다. 대신 간단한 종점 신호의 기판의 첨가 후 형광 신호의 실시간 모니터링이 가능 더 정확하게 정량의 화합물 (19)의 IC 50 값을 결정하도록한다. 또한, 각각의 재조합 단백질 반대로 전체 - editosome 착체의 화합물의 억제 효과의 시험을 허용한다. 단백질 복합체 내에서의 상호 작용의 동적 특성을 감안할 때,이 방법은 생물학적으로 대표에 editosome 단백질에 대한 억제제의 식별 (24)를 설정 할 수 있습니다 것을 제안 할 수있다. 또, 전체 - editosome 복합체를 표적 잠재적 RNA 편집의 진행을 파악 할 수있는 기회를 제공한다다양한 과도 단계에서 그 이전에 확인되지 않았다. 따라서,이 기술은 RNA 편집의 과정에 매우 중요하다 상호 작용과 활동에 대해 더 나은 관점을 확보하실 수 있습니다. 이 방식은 복잡한 24,25의 억제제로서 작용하는, 원핵 리보솜 복합체 어셈블리와 같은 기능 viomycin 및 에리스로 마이신과 같은 항생제를 이용하는 해명에 의해 예시 된 바와 같이 과거에는 성공적인 것으로 밝혀졌다. 방법의 성공적인 완료를 보장하기 위해 프로토콜의 특정 조정이 필요할 수 있습니다. 첫째, 적절한 글리세롤 그라데이션 미토콘드리아 추출 분획의 선택은 매우 중요합니다. 여기서, 그라데이션 ~ 20S 영역에 대응하는 11 내지 12 분획은 분획 9가 최대 활성을 나타내는 함께 편집 높은 활성을 보였다. 이 분획은 제시된 모든 테스트 선정되었지만, 그것은 어느 FRA에서 평가하기 위해 미리 모든 분획을 테스트하는 것이 필수적이다편집 활동의 피크를 CTION. 둘째, 분획 선택을 검증하기 위해, 그것은 Z&#39;-인자 값을 산출하여 신호대 잡음비를 평가하는 예비 테스트를 수행하는 것이 중요하다. 적절한 미토콘드리아 엑기스 글리세롤 구배 분획이 완료되는 경우에, 0.6의 Z&#39;-값이 달성 될 수있다. 다음으로,이 적정 (19)를 통하여 최대 편집 작업을 달성하기 위해 필요한 미토콘드리아 추출물의 재평가 반응 부피에 좋습니다. 이 논문에서 제시 한 기술의 중요한 제한은 editosome 단지는 19 정제하는 미토콘드리아 추출 글리세린 그라데이션 분별의 힘들고 시간이 많이 소요되는 프로세스에 관한 것이다. 이러한 단점에도 불구하고,이 기술은 우선적으로하여 높은 처리량 검사에 응용 프로그램을 위해 자격을 항복 잠재력에 비해 저렴한 비용 주어진 원유 editosome의 분수를 취득하는 것이 좋습니다. 이러한 TAP 태그 PU 등의 대비, 다른 방법에rification, 더 정제 editosome 분획을 줄 수있는 그런 차 분석의 경우와 같이 중간 처리량 분석에 저를 위해 권장되는. 더욱이, 화합물의 구체적인 억제 효과를 보장하기 위해, 그것의 editosome 부재 리보 자임 (A6Rbz)의 활성에 대하여이를 테스트하는 컨트롤을 포함 할 필요가있다. 그것은 이전의 연구는이 방법으로 인해 높은 화합물의 농도가 19에서 가능한 간섭에 염료와 같은 화합물에 대한 IC50 값을 계산에 비 효과적 일 수 있다는 것을 강조했다는 것을 주목해야한다. 상기 사전 개열 미리 편집 한 리보 자임과 관련된 유사한 형광 기반 분석법을 개발 제시 HTS 기법의 감도를 증가하는 것은 유익하다. 이 editosome 복잡 엔도 뉴 클레아에 의해 촉매 속도 제한 endonucleolytic 분열의 단계를 생략 할 수있다. 이러한 변형 분석의 또 다른 장점은 이차 스크리닝 도구로서 응용 될ExoUase, TUTase 및 결찰 촉매 활동의 기본 화면을 통해 확인 된 억제제의 효과를 모니터링 할 수 있습니다. 현재 제안 된 분석은 RNA 편집의 삭제 형식에 대한 억제제의 검출로 제한됩니다. 따라서 탐구하는 또 다른 수단은 RNA 편집의 삽입 유형에 대한 화합물의 효과를 모니터링 할 수 있도록 제시된 분석의 수정이 될 것입니다.

RNA 편집, mRNA의 전사 후 개질 공정은, 제 1 trypanosomatids에서 발견되었다. 그 이후로, 실질적인 작업은 Trypanosoma brucei 2,3에서 RNA 편집의 뒤에 기계를 연구 실시하고있다. 일련의 효소 반응에서 editosome 약 20 단백질의 코어 복합체는, 에너지 발생 산화 적 인산화 시스템의 여러 구성 요소를위한 성숙한 미토콘드리아의 mRNA를 생성한다. 촉매 이벤트의 순서는 가이드 RNA를 (gRNAs)에 의해 결정으로, endonucleolytic 분열, 우리 딜 (U) 추가 또는 삭제, 결찰입니다 4. 코어 editosome 복잡한 단백질 외에도 소품 요인도 5-7을 확인되었다. 이 단백질은 주로 독립적 인 단지로 분류 볼 수 있습니다. 그러나, 코어 editosome 복잡 단백질 어셈블리의 순서와 소품과 코어 복합체의 상호 작용 패턴착물은 아직 결정되지하다. trypanosomatids에서 RNA 편집 과정을 대상으로하는 화학 dissectors를 제공 할 수 있다는 editosome 복합체의 조립 및 기능을 공부에 도움. 또한, 여러 editosome 단백질의 기능 연구는 약 8 ~ 12을 대상으로 자신의 잠재력을 나타내는 다른 생활 단계에 걸쳐 요점을 보여 주었다. 따라서 editosome의 발견 억제제도 trypanosomatids 대하여 리드 화합물로서 작용할 수있다. trypanosomatid으로 인한 질병에 대한 현재 사용 가능한 약물, 독성이 비효율적이고 비용이 13, 14로이시의 적절하다. 효율적이고 편리한 시험 관내 분석은 RNA 편집을 차단 특정 억제제 화학 우주를 탐구 할 필요가있다. 세 가지 분석법이 개발 editosome 활동을 모니터링하는 데 사용되었다 : 시험 관내 RNA 편집 세이 15 (a) 전체 라운드, (b) 시험 관내 RNA 편집 분석 16,17에 미리 절단ND (C) 망치 리보 자임 (HHR) 분석 18 기반. 처음 두 개의 분석 실험은 방사능의 도움으로 편집 된 제품 (ATPase의 6의 mRNA)의 직접 시각화에 의존하고 있습니다. HHR 기반 분석은 편집시 리보 자임로 동작하는 모델로 ATPase의 6의 mRNA의 수정 된 버전을 사용합니다. 기능 리보 자임은 특히 기자로서, 방사성 동위 원소 표지 된 RNA 기판을 절단한다. 최근 Moshiri는 외. 개발 &#39;혼합 측정&#39;방사성 표지 된 RNA 기판은 형광 공명 에너지 전달 (FRET) 기판 (19)으로 교체되는 경우 RNA 편집을 모니터하기 위해 시험 관내 리포터 분석에서 HHR 기반한다. 이 분석의 원리 장점이 있습니다 : (A)는 활성 리보 자임 및 기판 절단의 생산이 낮은 볼륨 (즉, 20 μL)에서 동일한 관에서 동시에 발생하는, 신속하고 편리한 믹스와 분석의 측정 유형입니다, (B )는 방사성 표지 된 물질의 사용을 피하고, (c) 감도 즉이다형광 마이크로 타이 터 플레이트 포맷으로 계측하고, (d) 노이즈 비율이 높은 신호에 의해 fforded. 이 분석을 이용하여, 정제 된 editosome 대하여 공지 RNA 편집 리가 아제 억제제의 효과 (19)를 확인 하였다. 이 실험은 주로 T.에서 전체 editosomes에 대해, RNA 편집 억제제의 신속한 식별을 위해 분석을 확인 brucei. 도 1의 상세한 단계별 개략적 인 형광 계 관내 RNA 편집 분석에서. 이 프로토콜은 두 시험 관내에서 RNA 편집을 모니터링하거나 쉽게 다양한 스케일의 화합물 라이브러리를 스크리닝 적응 될 위해 사용될 수있다.

<table><tbody><tr><td>SDM-79 Medium</td><td>Gibco by Life Technologies</td><td></td><td></td></tr><tr><td>Fetal Bovine Serum</td><td>Life Technologies</td><td>12483-020</td><td>heat inactivation at 55 &amp;#176;C for 1 hr</td></tr><tr><td>Hemin, minimum 80%</td><td>Sigma</td><td>H5533-10G</td><td></td></tr><tr><td>Penicillin-Streptomycin Sollution</td><td>Fisher Scientific</td><td>MT-30-002-CI</td><td></td></tr><tr><td>Dnase 1 recombinant, Rnase Free&amp;nbsp;</td><td>Roche</td><td>4716728001</td><td></td></tr><tr><td>T7 RiboMax Express Large&amp;nbsp; scale RNA&amp;nbsp; production system</td><td>Promega</td><td>P1320</td><td></td></tr><tr><td>Kimble Kontes Dounce Tissue Grinders&amp;nbsp;&amp;nbsp;</td><td>Fisher Scientific</td><td>K885300-0040&amp;nbsp;&amp;nbsp;</td><td></td></tr><tr><td>Gradient Master, ver 5.25&amp;nbsp;</td><td>Biocomp</td><td>107-201M</td><td></td></tr><tr><td>Ultra Clear Tube, 13.2 ml</td><td>Beckman Coulter</td><td>344059</td><td></td></tr><tr><td>Optima L-100XP&amp;nbsp; Ultracentrifuge&amp;nbsp;</td><td>Beckman Coulter</td><td>392052</td><td></td></tr><tr><td>SW 41 Ti ROTOR</td><td>Beckman Coulter</td><td>331336</td><td></td></tr><tr><td>MicroSeal &#039;B&#039; Seal, Seals</td><td>Biorad</td><td>MSB1001</td><td></td></tr><tr><td>CFX 384 Touch Real-Time PCR Detection System</td><td>Biorad</td><td>185-5484</td><td></td></tr><tr><td>Acryl/Bis solution (19:1), 40% (w/v)</td><td>Bio Basic</td><td>A0006-500ML</td><td></td></tr><tr><td>Urea, Molecular biology grade, 1 kg</td><td>Life Technologies</td><td>AM9902</td><td></td></tr></tbody></table>

rna catalyst as a reporter for screening drugs against rna editing in trypanosomes

실질적인 진전은 trypanosomes에있는 미토콘드리아 RNA 편집의 메커니즘을 결정을했다. 마찬가지로, 상당한 진전은 RNA 편집을 촉매 editosome 착체의 구성 요소를 식별하는 제되었다. 그러나, 그 단백질이 함께 작동하는 방법을 아직 분명하지 않다. editosome 대하여 높은 처리량 스크린에서 얻어진 화합물은 편집주기에서 하나 이상의 단계를 차단하거나 영향을 미칠 수있다. 따라서, 새로운 화합물의 확인은 editosome 기능과 어셈블리를 해부에 대한 가치있는 분자 프로브를 생성합니다. 이전 연구에서, 시험 관내 편집 분석법은 무선 - 표지 된 RNA를 사용하여 수행 하였다. 이러한 분석은 시간에 비효율적이고 높은 처리량의 목적에 적합하지, 소모적이다. 여기서, 균일 한 형광 기반의 &quot;혼합 측정&quot;RNA 편집을 모니터링하는 망치 리보 자임 체외 기자의 분석을 제시한다. 만의 RNA 편집의 결과로해머 헤드 리보 자임 형광 공명 에너지 전달 (FRET) 올리고 리보 뉴클레오타이드 기판 분열을 거친다. 이것은 차례로하여 신호를 생성하는 형광 소광로부터의 분리를 초래한다. editosome 기능이 저해되는 경우 반대로, 형광 신호가 급냉 될 것이다. 이 체외 RNA 편집 또는 editosome 기능을 억제 할 수있는 화학 물질의 높은 처리량 검사에 모니터에 일반적으로 적용되어야 매우 민감하고 간단한 분석이다.

대형 화면을 설정하기 위해 필요한 필수 단계를 설명하기 위해 2-5 분석의 질과 관련된 대표적인 제어 실험이다 피규어. 이러한 검사의 며칠 동안 일관된 분석 또는 다른 화면의 비교를위한 필수 제어 실험이다. 형광 신호 대 잡음비를 평가할 대규모 설정에서 형광 표지 된 올리고 리보 뉴클레오타이드 기판의 안정성과 품질을 보장​​하기 위해, 분석 배경 및 최대 신호 사이의 차이로 정의 Z&#39;-인자는 활성 리보 자임 분자 (A6Rbz)을 사용하여 계산 하였다. . &#39;(; 터 FAM), 3 플루&#39;N, N &#39;- 테트라 메틸 Z&#39;인자 분석은&gt; 0.5는 높은 처리량 화면에 적합하다고 간주되는 그림 2는 무서워 5 레이블이 기판을 사용하는 대표적인 데이터를 보여줍니다thylrhodamine (TAMRA, 거제) (A6Rbz_F / T). A6Rbz의 존재 및 부재하에 72 회 반복을 사용하여 계산하면이 기판은 0.64의 Z&#39;-인자를 생산. 이 분석에서 아이오와 블랙 다크 퀸처 (A6Rbz_F/Ib)를 사용하여 다른 기판 TAMRA에 비해 더 나은 신호 대 잡음비를 얻을 수있다. 아이오와 블랙, TAMRA는 달리, 방출하는 열이나 빛없는 것으로 에너지를 흡수하기 때문이다. FAM / 아이오와 블랙 (F / IB) 표지 기판을 사용하여 얻은 Z &#39;계수는 0.68이었다. TAMRA 표지 기판 상에 F / IB 표지 기판 Z&#39; 요인의 개선이 때문에 상대적으로 낮은 배경입니다. 이러한 대표적인 결과는 두 기판은 높은 처리량 화면에 사용 가능한 옵션입니다 것을 보여줍니다. 글리세롤 그라데이션 분수의 편집 활동을 결정 , 실험 글리세을 가장 적극적으로 editosome 분획을 결정하고 선택하려면L 구배 분획 형광 계 분석 (단계 V)를 사용하여 시험 관내 편집에 대해 시험 하였다. 이러한 데이터는 대부분의 활성 분획물로 (그림 3) 분수 7-12 표시 (≥ 50 %의 편집 활동을, 100 %로 가장 활성 분획과). 더 editosome가 필요할 때 이들 분획을 결합 할 수있다. Editosome 분수가 결합 될 때 Z &#39;계수를 계산 대부분의 활성 분획 (F8 + + F9 F10의가) editosome의 소스로 사용될 때 editosome 분율 combinig의 효과를 결정하기 위하여, 0.6의 Z&#39;-인자 값을 산출 하였다. 72 회 반복이 editosome의 유무 (그림 4)에서 테스트 된 Z &#39;계수를 계산합니다. F / IB 기판을이 실험에 사용 하였다. 이러한 데이터는 글리세롤 구배 분획을 조합 Z&#39;-계수에 기초하여 상기 분석의 질에 미치는 영향을 보여준다. 엉덩이 = &quot;jove_content&quot;&gt; 분석을위한 대표적인 제어 실험 다른 제어 샘플을 비교하는 대표 데이터는 분석에서 변수를 분석하는데 사용 하였다. 도 5에 도시 된 바와 같이, 임의의 RNA 편집 컴퍼넌트 (반응 1-4) 누락 반응은 기판을 절단하지 않는다. 형광 및 상대 편집 작업에 의해 측정 된 기판의 절단은 억제 (반응 4)의 부재 또는 모든 편집 컴포넌트의 존재 및 비활성 화합물 (반응에서 편집 반응의 모든 성분의 존재하에 관찰 6). 대조적으로, 억제 성 화합물은 RNA 편집을 차단할 수 있고, 양성 대조군 (반응 7)로서 사용된다. 여기서, 점착제 블랙 (MRB) 및 C53 화합물은 각각 양성 및 음성 대조군으로 사용 하였다. ghres.jpg &quot;폭 =&quot;500 &quot;/&gt; 그림 1. 해머 리보 자임 기반 체외 RNA 편집 분석에서. 의 A) 단계별 개략적 형광 기반의 생체 편집 분석에 : 그 가이드 RNA (gA6Rbz)와 미리 편집 된 망치 리보 자임 (사전 편집 A6Rbz)의 () 하이브리드. (나) 인식과 정제 된 editosome 단지로 RNA 이중의 상호 작용. editosome에 의해 촉매 (C) 삭제 RNA 편집. (D) 85 ° C에서 가열 및 가이드 RNA의 경쟁 (gA6Rbz_comp)의 첨가에 의한 editosome 및 gA6Rbz에서 편집 A6Rbz의 해리. (E) 활성 A6의 귀상어 리보 자임 (활성 A6Rbz)와 FRET 기판의 하이브리드. (F) 활성 리보 자임. B) 사전 편집 망치 리보 자임 (A6Rbz 사전 편집)에 의해 FRET 기판의 절단을 다음 FAM 신호의 검출은 세 회사의 삭제 (양방향 자만을 지정 gA6Rbz와 협회에 표시됩니다편집 사이트 (ES)에서 W). 기능적 editosome의 존재하에 RNA 편집의 결과가 이제 비활성 리보 자임 FRET 기판 (화살표로 나타낸 절단 부위)를 절단 할 수의 활성 형태 (편집 A6Rbz)로 편집된다. 5&#39;-CUGA-3 &#39;리보 자임 활동 (편집 사이트)에 필수적인 촉매 코어의 편집 A6Rbz의가 (이 그림은 Moshiri 19에서 수정 된) 강조 보존. <a href="https://www-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/51712/51712fig1highres.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> <img alt="그림 2" fo:content-width="5in" src="/files/ftp_upload/51712/51712fig2highres.jpg" width="500" /> 그림 2. 신호 대 잡음의 다른 소광을 품고 FRET 기판 사이의 비율을 비교. FAM / TAMRA (F / T)와 FAM / 아이오와 블랙 FQ (F / IB) 기판을 사용하는 라이 보자 임 (A6Rbz) 활동. Y 축 represe분당 국세청 형광 임의의 단위 (FAU). <img alt="그림 3" fo:content-width="5in" src="/files/ftp_upload/51712/51712fig3highres.jpg" width="500" /> 미토콘드리아 해물의 글리세롤 구배 원심 분리. 분수 # 9 (F9)에서 얻은 선택 분수의 그림 3. RNA 편집 활동은 가장 높은 활성을 갖는다. y 축은 100 %로 F9를 고려 백분율에 대하여 편집 동작을 나타낸다. <img alt="그림 4" fo:content-width="5in" src="/files/ftp_upload/51712/51712fig4highres.jpg" width="500" /> 그림 4. editosome 원으로 가장 활성 분획 (F8 + F9 +의 F10)를 사용하여 Z &#39;계수 계산. 실험 변화는 반응의 각 유형의 72 회 반복에서 얻었다. Z&#39;-계수는 0.6로 계산되었다. y 축은 상대적인 편집 활성을 나타낸다. <img alt="그림 5" fo:content-width="5in" src="/files/ftp_upload/51712/51712fig5highres.jpg" width="500" /> 도 5. 형광 기반 RNA 편집 분석을위한 대표적인 실험. 반응은 잘 CFX384 TouchTM 실시간 PCR 검출 시스템 당 20 μL의 최종 부피에서 수행 하였다는 형광 신호를 측정하는데 사용 하였다. 그래프 분석 (# 5)에 대한 모든 구성 요소를 포함하는 완전한 편집 반응뿐만 아니라 다양한 컨트롤을 제공합니다. 형광 단독 (# 1) 기판의 무결성을 평가하기 FRET 기판의 존재하에 측정 하였다. 샘플 # 2는 이전에 편집에 대한 리보 자임 활성을 모니터링 할 editosome의 부재하에 수행 하였다. 기판 상 변성 editosome의 효과를 평가하기 위해, 형광 editosome 및 FRET 기판의 존재하에 측정 하였다 만 (# 3). 가이드 감독 편집 특이도, 샘을 테스트하려면PLE gA6Rbz의 부재 (# 4)를 사용 하였다. 비 억제 (C53, # 6)와 억제 화합물 (MRB, # 7) 편집 분석에 대한 효과를 테스트하기 위해 사용되었다. RNA 편집이 MRB에 의해 크게 억제되는 동안, C53은 무시할 효과가있다. 오차 막대는 10 회 반복 사이의 실험적인 변화 (표준 편차)에 해당합니다. y 축은 100 %로서 완전한 반응 (# 5)을 고려하여, 백분율에 대하여 편집 동작을 나타낸다. <table border="0" cellpadding="0" cellspacing="0" width="614"><tbody><tr><td></td><td> 10 % </td><td> 30 % </td></tr><tr><td> 배 HHE 그라데이션 버퍼 </td><td> 5 ㎖ </td><td> 5 ㎖ </td></tr><tr><td> 글리세린 </td><td> 1 ㎖ </td><td> 3 ㎖ </td></tr><tr><td> DEPC H 2 O </td><td> 4 ML </td><td> 2 ㎖ </td></tr><tr><td> 1 M DTT </td><td> 10 μL </td><td> 10 μL </td></tr></tbody></table>표 1. 10 % 및 30 % 글리세롤 용액 (10 ㎖ 각). <table border="0" cellpadding="0" cellspacing="0" width="600"><tbody><tr><td colspan="2"> 사전 편집 A6 리보 자임 (preA6Rbz) </td></tr><tr><td> preA6Rbz DNA 템플릿 </td><td> 5&#39;-ACATTTGATCTATTGTTTCGTCCTCACGGACTCA TCAAAAGTCACAACTTTCCCTTTCTCTCCTCCCCCTAACCTTT CC CCCTATAGTGAGTCGTATTA -3 &#39; </td></tr><tr><td> preA6Rbz RNA </td><td> 5&#39;-GGGAAAGGUUAGGGGGAGGAGAGAAAGGGAAA GUUGUGACUUUUGAUGAGUCCGUGAGGACGAAACAAUAGA UCAAAUGU-3 &#39; </td></tr><tr><td> RNA의 재고 진한. </td><td> 1 μM </td></tr><tr><td colspan="2"> 가이드 A6 리보 자임 (gA6Rbz) </td></tr><tr><td> gA6RBz DNA 템플릿 </td><td> 5&#39;-AAAAAAAAAAAAAAAAATAATTATCATATCACTGT CAAGGGAAAGTTGTGAGGGTGATGAGTCCGTGTATATCC CC CTATAGTGAGTCGTATTA -3 &#39; </td></tr><tr><td> gA6Rbz RNA </td><td> 5&#39;-GGGAUAUACACGGACUCAUCACCCUCACAACUU UCCCUUGACAGUGAUAUGAUAAUUAUUUUUUUUUUUUUUUUU-3 &#39; </td></tr><tr><td> RNA의 재고 진한. </td><td> 2.5 μM </td></tr><tr><td colspan="2"> 가이드 A6 리보 자임의 경쟁자 (gA6RBz_comp) </td></tr><tr><td> gA6Rbz_comp DNA 템플릿 </td><td> 5&#39;-GGATATACACGGACTCATCACCCTCACAACTTTC CCTTGACAGTGATATGATAATTATTTTTTTTTTTTTTTTT CCCTAT AGTGAGTCGTATTA -3 &#39; </td></tr><tr><td> gA6Rbz_comp RNA </td><td> 5&#39;-AAAAAAAAAAAAAAAAAUAAUUAUCAUAUCACUG UCAAGGGAAGUUGUGAGGGUGAUGAGUCCGUGUAUAUCC-3 &#39; </td></tr><tr><td> RNA의 재고 진한. </td><td> 12.5 μM </td></tr><tr><td colspan="2"> 활동 A6 리보 자임 (A6RBz) </td></tr><tr><td> A6Rbz DNA 템플릿 </td><td> 5&#39;-ACATTTGATCTATTGTTTCGTCCTCACGGACTCAT CAGTCACAACTTTCCCTTTCTCTCCTCCCCCTAACCTTTCC CC CTATAGTGAGTCGTATTA -3 &#39; </td></tr><tr><td> A6Rbz RNA </td><td> 5&#39;-GGGAAAGGUUAGGGGGAGGAGAGAAAGGGAAA GUUGUGACUGAUGAGUCCGUGAGGACGAAACAAUAGAUCA AAUGU-3 &#39; </td></tr><tr><td> RNA의 재고 진한. </td><td> 1 μM </td></tr><tr><td colspan="2"> 기판을 FRET </td></tr><tr><td> TAMRA의 소광 </td><td> 5&#39;-FAM-GAUCUAUUGUCUCACA-TAMRA-3 &#39;(Eurogentec) </td></tr><tr><td> 아이오와 블랙 소광 </td><td> 5&#39;-FAM-GAUCUAUUGUCUCACA 아이오와 블랙 3 &#39;(IDT) </td></tr><tr><td> RNA의 재고 진한. </td><td> 15 μM (모두) </td></tr></tbody></table> 표 2. DNA 템플릿 및 RNA 기판. <table border="0" cellpadding="0" cellspacing="0"><tbody><tr><td> 구성 </td><td> 편집 반응 (μL) </td></tr><tr><td> 배 HHE </td><td> 1.5 </td></tr><tr><td> 0.1 M 염화칼슘 </td><td> 1 </td></tr><tr><td> 100 mM의 ATP </td><td> 0.2 </td></tr><tr><td> 10 % 트리톤-100 </td><td> 0.2 </td></tr><tr><td> 500 NG / Torula 효모 RNA를 μL </td><td> 1 </td></tr><tr><td> Editosome </td><td> 5 </td></tr><tr><td> 의 RNase 무료 H 2 O </td><td> 7.1 </td></tr><tr><td> 1 μM preA6Rbz </td><td> 1 </td></tr><tr><td> 2.5 μM gA6Rbz </td><td> 1 </td></tr><tr><td> 합계 </td><td> 18 </td></tr></tbody></table> 표 3. 반응의 구성 및 마스터 믹스.

Watch this Scientific Journal Video about RNA Catalyst as a Reporter for Screening Drugs against RNA Editing in Trypanosomes at JoVE.com

RNA Catalyst as a Reporter for Screening Drugs against RNA Editing in Trypanosomes

A highly sensitive ribozyme-based assay, applicable to high-throughput screening of chemicals targeting the unique process of RNA editing in trypanosomatid pathogens, is described in this paper. Inhibitors can be used as tools for hypothesis-driven analysis of the RNA editing process and ultimately as therapeutics.

Trypanosomes에서 RNA 편집에 대한 마약 검사에 대한 기자로 RNA 촉매

Substantial progress has been made in determining the mechanism of mitochondrial RNA editing in trypanosomes. Similarly, considerable progress has been ...

rna-catalyst-as-reporter-for-screening-drugs-against-rna-editing

Universidad San Sebastian

Research

JoVE Journal

Biology

8.4K 조회수.  McGill University. A highly sensitive ribozyme-based assay, applicable to high-throughput screening of chemicals targeting the unique process of RNA editing in trypanosomatid pathogens, is described in this paper. Inhibitors can be used as tools for hypothesis-driven analysis of the RNA editing process and ultimately as therapeutics.

비디오: RNA Catalyst as a Reporter for Screening Drugs against RNA Editing in Trypanosomes

Antibody-Free Assay for RNA Methyltransferase Activity Analysis

There are more than 100 chemically distinct modifications of RNA, two thirds of which consist of methylations. Interest in RNA modifications, and especially methylations, has re-emerged due to the important roles played by the enzymes that write and erase them in biological processes relevant to disease and cancer. Here, a sensitive in vitro assay for accurate analysis of RNA methylation writer activity on synthetic or in vitro transcribed RNAs is provided. This assay uses a tritiated form of S-adenosyl-methionine, resulting in direct labeling of methylated RNA with tritium. The low energy of tritium radiation makes the method safe, and pre-existing methods of tritium signal amplification, make it possible to quantify and to visualize the methylated RNA without the use of antibodies, which are commonly prone to artifacts. While this method is written for RNA methylation, few tweaks make it applicable to the study of other RNA modifications that can be radioactively labeled, such as RNA acetylation with 14C acetyl coenzyme A. Overall, this assay allows to quickly assess RNA methylation conditions, inhibition with small molecule inhibitors, or the effect of RNA or enzyme mutants, and provides a powerful tool to validate and expand results obtained in cells.

Here, an antibody-free in vitro assay for direct analysis of methyltransferase activity on synthetic or in vitro transcribed RNA is described.

RNA 메틸 트랜스퍼라제 활성 분석을 위한 항체 무첨가 분석

There are more than 100 chemically distinct modifications of RNA, two thirds of which consist of methylations. Interest in RNA modifications, and ...

연구

유전학

Optimizing the Genetic Incorporation of Chemical Probes into GPCRs for Photo-crosslinking Mapping and Bioorthogonal Chemistry in Live Mammalian Cells

The genetic incorporation of non-canonical amino acids (ncAAs) via amber stop codon suppression is a powerful technique to install artificial probes and reactive moieties onto proteins directly in the live cell. Each ncAA is incorporated by a dedicated orthogonal suppressor-tRNA/amino-acyl-tRNA-synthetase (AARS) pair that is imported into the host organism. The incorporation efficiency of different ncAAs can greatly differ, and be unsatisfactory in some cases. Orthogonal pairs can be improved by manipulating either the AARS or the tRNA. However, directed evolution of tRNA or AARS using large libraries and dead/alive selection methods are not feasible in mammalian cells. Here, a facile and robust fluorescence-based assay to evaluate the efficiency of orthogonal pairs in mammalian cells is presented. The assay allows screening tens to hundreds of AARS/tRNA variants with a moderate effort and within a reasonable time. Use of this assay to generate new tRNAs that significantly improve the efficiency of the pyrrolysine orthogonal system is described, along with the application of ncAAs to the study of G-protein coupled receptors (GPCRs), which are challenging objects for ncAA mutagenesis. First, by systematically incorporating a photo-crosslinking ncAA throughout the extracellular surface of a receptor, binding sites of different ligands on the intact receptor are mapped directly in the live cell. Second, by incorporating last-generation ncAAs into a GPCR, ultrafast catalyst-free receptor labeling with a fluorescent dye is demonstrated, which exploits bioorthogonal strain-promoted inverse Diels Alder cycloaddition (SPIEDAC) on the live cell. As ncAAs can be generally applied to any protein independently on its size, the method is of general interest for a number of applications. In addition, ncAA incorporation does not require any special equipment and is easily performed in standard biochemistry labs.

A facile fluorescence assay is presented to evaluate the efficiency of amino-acyl-tRNA-synthetase/tRNA pairs incorporating non-canonical amino-acids (ncAAs) into proteins expressed in mammalian cells. The application of ncAAs to study G-protein coupled receptors (GPCRs) is described, including photo-crosslinking mapping of binding sites and bioorthogonal GPCR labeling on live cells.

사진-가교 매핑 및 라이브 포유류 세포에서 Bioorthogonal 화학 GPCRs에 프로브 화학의 유전 결합을 최적화

The genetic incorporation of non-canonical amino acids (ncAAs) via amber stop codon suppression is a powerful technique to install artificial probes and ...

화학

CRISPR/Cas9 Editing of the C. elegans rbm-3.2 Gene using the dpy-10 Co-CRISPR Screening Marker and Assembled Ribonucleoprotein Complexes.

The bacterial Clustered Regularly Interspaced Short Palindromic Repeat (CRISPR)/Streptococcus pyogenes CRISPR-associated protein (Cas) system has been harnessed by researchers to study important biologically relevant problems. The unparalleled power of the CRISPR/Cas genome editing method allows researchers to precisely edit any locus of their choosing, thereby facilitating an increased understanding of gene function. Several methods for editing the C. elegans genome by CRISPR/Cas9 have been described previously. Here, we discuss and demonstrate a method which utilizes in vitro assembled ribonucleoprotein complexes and the dpy-10 co-CRISPR marker for screening. Specifically, in this article, we go through the step-by-step process of introducing premature stop codons into the C. elegans rbm-3.2 gene by homology-directed repair using this method of CRISPR/Cas9 editing. This relatively simple editing method can be used to study the function of any gene of interest and allows for the generation of homozygous-edited C. elegans by CRISPR/Cas9 editing&#160;in less than two weeks.

CRISPR/Cas9 Editing of the C. elegans rbm-3.2 Gene using the dpy-10 Co-CRISPR Screening Marker and Assembled Ribonucleoprotein Complexes.

The goal of this protocol is to enable seamless CRISPR/Cas9 editing of the C. elegans genome using assembled ribonucleoprotein complexes and the dpy-10 co-CRISPR marker for screening. This protocol can be used to make a variety of genetic modifications in C. elegans including insertions, deletions, gene replacements and codon substitutions.

CRISPR/Cas9 Dpy-10 공동 CRISPR 스크리닝 마커 및 조립된 리보뉴클레오단백질 복합체를 사용하여 C. elegans rbm-3.2 유전자의 편집.

The bacterial Clustered Regularly Interspaced Short Palindromic Repeat (CRISPR)/Streptococcus pyogenes CRISPR-associated protein (Cas) system has been ...

Monitoring Protein-RNA Interaction Dynamics In Vivo at High Temporal Resolution Using &#967;CRAC

The interaction between RNA-binding proteins (RBPs) and their RNA substrates exhibits fluidity and complexity. Within its lifespan, a single RNA can be bound by many different RBPs that will regulate its production, stability, activity, and degradation. As such, much has been done to understand the dynamics that exist between these two types of molecules. A particularly important breakthrough came with the emergence of &#8216;cross-linking and immunoprecipitation&#8217; (CLIP). This technique allowed stringent investigation into which RNAs are bound by a particular RBP. In short, the protein of interest is UV cross-linked to its RNA substrates in vivo, purified under highly stringent conditions, and then the RNAs covalently cross-linked to the protein are converted into cDNA libraries and sequenced. Since its conception, many derivative techniques have been developed in order to make CLIP amenable to particular fields of study. However, cross-linking using ultraviolet light is notoriously inefficient. This results in extended exposure times that make the temporal study of RBP-RNA interactions impossible. To overcome this issue, we recently designed and built much-improved UV irradiation and cell harvesting devices. Using these new tools, we developed a protocol for time-resolved analyses of RBP-RNA interactions in living cells at high temporal resolution: Kinetic CRoss-linking and Analysis of cDNAs (&#967;CRAC). We recently used this technique to study the role of yeast RBPs in nutrient stress adaptation. This manuscript provides a detailed overview of the &#967;CRAC method and presents recent results obtained with the Nrd1 RBP.

Kinetic cross-linking and analysis of cDNA is a method that allows investigation of the dynamics of protein-RNA interactions in living cells at high temporal resolution. Here the protocol is described in detail, including the growth of yeast cells, UV cross-linking, harvesting, protein purification, and next generation sequencing library preparation steps.

χCRAC를 사용하여 높은 시간 분해능에서 생체 내 단백질-RNA 상호 작용 역학 모니터링

The interaction between RNA-binding proteins (RBPs) and their RNA substrates exhibits fluidity and complexity. Within its lifespan, a single RNA can be ...

생화학

Nonradioactive Assay to Measure Polynucleotide Phosphorylation of Small Nucleotide Substrates

Polynucleotide kinases (PNKs) are enzymes that catalyze the phosphorylation of the 5&#39; hydroxyl end of DNA and RNA oligonucleotides. The activity of PNKs can be quantified using direct or indirect approaches. Presented here is a direct, in vitro approach to measure PNK activity that relies on a fluorescently-labeled oligonucleotide substrate and polyacrylamide gel electrophoresis. This approach provides resolution of the phosphorylated products while avoiding the use of radiolabeled substrates. The protocol details how to set up the phosphorylation reaction, prepare and run large polyacrylamide gels, and quantify the reaction products. The most technically challenging part of this assay is pouring and running the large polyacrylamide gels; thus, important details to overcome common difficulties are provided. This protocol was optimized for Grc3, a PNK that assembles into an obligate pre-ribosomal RNA processing complex with its binding partner, the Las1 nuclease. However, this protocol can be adapted to measure the activity of other PNK enzymes. Moreover, this assay can also be modified to determine the effects of different components of the reaction, such as the nucleoside triphosphate, metal ions, and oligonucleotides.

This protocol describes a nonradioactive assay to measure kinase activity of polynucleotide kinases (PNKs) on small DNA and RNA substrates.

작은 뉴클레오티드 기판의 폴리뉴클레오티드 인산화를 측정하는 비방사성 분석

Polynucleotide kinases (PNKs) are enzymes that catalyze the phosphorylation of the 5&#39; hydroxyl end of DNA and RNA oligonucleotides. The activity of ...

Measurement of Specific Mycobacterial Mistranslation Rates with Gain-of-function Reporter Systems

The translation of genes into proteins is prone to errors. Although the average rate of translational error in model systems is estimated to be 1/10,000 per codon, the actual error rates vary widely, depending on the species, environment, and codons being studied. We have previously shown that mycobacteria use a two-step pathway for the generation of aminoacylated glutamine and asparagine tRNAs and that this is specifically associated with relatively high error rates due to the modulation of mistranslation rates by an essential component of the pathway, the amidotransferase GatCAB. We modified a previously employed Renilla-Firefly dual-luciferase system that had been used to measure mistranslation rates in Escherichia coli for use in mycobacteria to measure specific mistranslation rates of glutamate at glutamine codons and aspartate for asparagine codons. Although this reporter system was suitable for the accurate estimation of specific error rates, lack of sensitivity and requirements for excessive manipulation steps made it unsuitable for high-throughput applications. Therefore, we developed a second gain-of-function reporter system, using Nluc luciferase and green fluorescent protein (GFP), which is more amenable to medium/high-throughput settings. We used this system to identify kasugamycin as a small molecule that can decrease mycobacterial mistranslation. Although the reporters that we describe here have been used to measure specific types of mycobacterial mistranslation, they may be modified to measure other types of mistranslation in a number of model systems.

In this article, we present two complementary methods to measure specific rates of translational error and mistranslation in the model mycobacterium, Mycobacterium smegmatis, using gain-of-function reporter systems. The methods can be employed to measure accurate error rates in low throughput or relative error rates in a more high-throughput setting.

기능 리포터 시스템으로 특정 진 균의 오 번역 비율 측정

The translation of genes into proteins is prone to errors. Although the average rate of translational error in model systems is estimated to be 1/10,000 ...

면역학 및 감염병학

A Nonsequencing Approach for the Rapid Detection of RNA Editing

RNA editing is a process that leads to posttranscriptional sequence alterations in RNAs. Detection and quantification of RNA editing rely mainly on Sanger sequencing and RNA sequencing techniques. However, these methods can be costly and time-consuming. In this protocol, a portable microtemperature gradient gel electrophoresis (&#181;TGGE) system is used as a nonsequencing approach for the rapid detection of RNA editing. The process is based on the principle of electrophoresis, which uses high temperatures to denature nucleic acid samples as they move across a polyacrylamide gel. Across a range of temperatures, a DNA fragment forms a gradient of fully double-stranded DNA to partially separated strands and then to entirely separated single-stranded DNA. RNA-edited sites with distinct nucleotide bases produce different melting profiles in &#181;TGGE analyses. We used the &#181;TGGE-based approach to characterize the differences between the melting profiles of four edited RNA fragments and their corresponding nonedited (wild-type) fragments. Pattern Similarity Scores (PaSSs) were calculated by comparing the band patterns produced by the edited and nonedited RNAs and were used to assess the reproducibility of the method. Overall, the platform described here enables the detection of even single base mutations in RNAs in a straightforward, simple, and cost-effective manner. It is anticipated that this analysis tool will aid new molecular biology findings.

Rapid detection and reliable quantification of RNA editing events at a genomic scale remain challenging and currently rely on direct RNA sequencing methods. The protocol described here uses microtemperature gradient gel electrophoresis (&#181;TGGE) as a simple, quick, and portable method of detecting RNA editing.

RNA 편집의 신속한 검출을 위한 비시퀀싱 접근법

RNA editing is a process that leads to posttranscriptional sequence alterations in RNAs. Detection and quantification of RNA editing rely mainly on Sanger ...

생체공학

High-throughput Screening for Chemical Modulators of Post-transcriptionally Regulated Genes

Both transcriptional and post-transcriptional regulation have a profound impact on genes expression. However, commonly adopted cell-based screening assays focus on transcriptional regulation, being essentially aimed at the identification of promoter-targeting molecules. As a result, post-transcriptional mechanisms are largely uncovered by gene expression targeted drug development. Here we describe a cell-based assay aimed at investigating the role of the 3&#39; untranslated region (3&#8217; UTR) in the modulation of the fate of its mRNA, and at identifying compounds able to modify it. The assay is based on the use of a luciferase reporter construct containing the 3&#8217; UTR of a gene of interest stably integrated into a disease-relevant cell line. The protocol is divided into two parts, with the initial focus on the primary screening aimed at the identification of molecules affecting luciferase activity after 24 hr of treatment. The second part of the protocol describes the counter-screening necessary to discriminate compounds modulating luciferase activity specifically through the 3&#8217; UTR. In addition to the detailed protocol and representative results, we provide important considerations about the assay development and the validation of the hit(s) on the endogenous target. The described cell-based reporter gene assay will allow scientists to identify molecules modulating protein levels via post-transcriptional mechanisms dependent on a 3&#8217; UTR.

Here we describe a cell-based reporter gene assay as a valuable tool to screen chemical libraries for compounds modulating post-transcriptional control mechanisms exerted through 3&#8217; UTR.

후 전사적으로 규제 유전자의 화학 변조기에 대한 높은 처리량 검사

Both transcriptional and post-transcriptional regulation have a profound impact on genes expression. However, commonly adopted cell-based screening assays ...

생물학

A Simple Fluorescence-based Reporter Assay to Identify Cellular Components Required for Ricin Toxin A Chain (RTA) Trafficking in Yeast

Bacterial and plant A/B toxins exploit the natural trafficking pathways in eukaryotic cells to reach their intracellular target(s) in the cytosol and to ultimately kill. Such A/B toxins generally consist of an enzymatically active Asubunit (e.g., ricin toxin A (RTA)) and one or more cell binding Bsubunit(s), which are responsible for toxin binding to specific cell surface receptors. Our current knowledge of how A/B toxins are capable of efficiently intoxicating cells helped scientists to understand fundamental cellular mechanisms, like endocytosis and intracellular protein sorting in higher eukaryotic cells. From a medical point of view, it is likewise important to identify the major toxin trafficking routes to find adequate treatment solutions for patients or to eventually develop therapeutic toxin-based applications for cancer therapy.
Since genome-wide analyses of A/B toxin trafficking in mammalian cells is complex, time-consuming, and expensive, several studies on A/B toxin transport have been performed in the yeast model organism Saccharomyces cerevisiae. Despite being less complex, fundamental cellular processes in yeast and higher eukaryotic cells are similar and very often results obtained in yeast can be transferred to the mammalian situation.
Here, we describe a fast and easy to use reporter assay to analyze the intracellular trafficking of RTA in yeast. An essential advantage of the new assay is the opportunity to investigate not only RTA retro-translocation from the endoplasmic reticulum (ER) into the cytosol, but rather endocytosis and retrograde toxin transport from the plasma membrane into the ER. The assay makes use of a reporter plasmid that allows indirect measurement of RTA toxicity through fluorescence emission of the green fluorescent protein (GFP) after in vivo translation. Since RTA efficiently prevents the initiation of protein biosynthesis by 28S rRNA depurination, this assay allows the identification of host cell proteins involved in intracellular RTA transport through the detection of changes in fluorescence emission.

A Simple Fluorescence-based Reporter Assay to Identify Cellular Components Required for Ricin Toxin A Chain RTA Trafficking in Yeast

In the manuscript, we describe the use of a yeast-based fluorescence reporter assay to identify cellular components involved in the trafficking and killing processes of the cytotoxic A subunit of the plant toxin ricin (RTA).

세포질 구성 요소를 식별 하는 간단한 형광 기반 기자 분석 결과 리 독 소에 필요한 체인 (RTA) 효 모에 인신 매매

Bacterial and plant A/B toxins exploit the natural trafficking pathways in eukaryotic cells to reach their intracellular target(s) in the cytosol and to ...

Studying Ribonucleotide Incorporation: Strand-specific Detection of Ribonucleotides in the Yeast Genome and Measuring Ribonucleotide-induced Mutagenesis

The presence of ribonucleotides in nuclear DNA has been shown to be a source of genomic instability. The extent of ribonucleotide incorporation can be assessed by alkaline hydrolysis and gel electrophoresis as RNA is highly susceptible to hydrolysis in alkaline conditions. This, in combination with Southern blot analysis can be used to determine the location and strand into which the ribonucleotides have been incorporated. However, this procedure is only semi-quantitative and may not be sensitive enough to detect small changes in ribonucleotide content, although strand-specific Southern blot probing improves the sensitivity. As a measure of one of the most striking biological consequences of ribonucleotides in DNA, spontaneous mutagenesis can be analyzed using a forward mutation assay. Using appropriate reporter genes, rare mutations that results in the loss of function can be selected and overall and specific mutation rates can be measured by combining data from fluctuation experiments with DNA sequencing of the reporter gene. The fluctuation assay is applicable to examine a wide variety of mutagenic processes in specific genetic background or growth conditions.

Ribonucleotides are among the most abundant non-canonical nucleotides incorporated into the genome during eukaryotic nuclear DNA replication. If not properly removed, ribonucleotides can cause DNA damage and mutagenesis. Here, we present two experimental approaches that are used to assess the abundance of ribonucleotide incorporation into DNA and its mutagenic effects.

Ribonucleotides 효 모 게놈에 Ribonucleotide 유도 된 Mutagenesis 측정의 공부 Ribonucleotide 법인: 물가 관련 검색

The presence of ribonucleotides in nuclear DNA has been shown to be a source of genomic instability. The extent of ribonucleotide incorporation can be ...