Name: generation of marked and markerless mutants in model cyanobacterial species
Uploaded: 2016-05-29T15:00:00.000+00:00
Duration: 11 min 45 s
Description: Watch this Scientific Journal Video about Generation of Marked and Markerless Mutants in Model Cyanobacterial Species at JoVE.com

Siamo grati alla Environmental Services Association Education Trust, la biologia sintetica a Cambridge fondo Synbio e il Ministero della giustizia sociale e responsabilizzazione, Governo dell&#39;India, per il sostegno finanziario.

<ol>
	<li>Zwirglmaier, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Global+phylogeography+of+marine+Synechococcus+and+Prochlorococcus+reveals+a+distinct+partitioning+of+lineages+among+oceanic+biomes.">Global phylogeography of marine Synechococcus and Prochlorococcus reveals a distinct partitioning of lineages among oceanic biomes.</a> Environ Microbiol. 10, 147-161 (2008).</li><li>Galloway, J. N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nitrogen+cycles:+past,+present,+and+future.">Nitrogen cycles: past, present, and future.</a> Biogeochemistry. 70, 153-226 (2004).</li><li>Lea-Smith, D. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Contribution+of+cyanobacterial+alkane+production+to+the+ocean+hydrocarbon+cycle.">Contribution of cyanobacterial alkane production to the ocean hydrocarbon cycle.</a> Proc Natl Acad Sci U S A. , (2015).</li><li>Howe, C. J., Barbrook, A. C., Nisbet, R. E. R., Lockhart, P. J., Larkum, A. W. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+origin+of+plastids.">The origin of plastids.</a> Philos Trans R Soc Lond B Biol Sci. 363, 2675-2685 (2008).</li><li>Lea-Smith, D. J., Bombelli, P., Vasudevan, R., Howe, C. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Photosynthetic,+respiratory+and+extracellular+electron+transport+pathways+in+cyanobacteria.">Photosynthetic, respiratory and extracellular electron transport pathways in cyanobacteria.</a> Biochim Biophys Acta. , (2015).</li><li>McCormick, A. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hydrogen+production+through+oxygenic+photosynthesis+using+the+cyanobacterium+Synechocystis+sp+PCC+6803+in+a+bio-photoelectrolysis+cell+(BPE)+system.">Hydrogen production through oxygenic photosynthesis using the cyanobacterium Synechocystis sp PCC 6803 in a bio-photoelectrolysis cell (BPE) system.</a> Energy Environ. Sci. 6, 2682-2690 (2013).</li><li>Bradley, R. W., Bombelli, P., Lea-Smith, D. J., Howe, C. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Terminal+oxidase+mutants+of+the+cyanobacterium+Synechocystis+sp.+PCC+6803+show+increased+electrogenic+activity+in+biological+photo-voltaic+systems.">Terminal oxidase mutants of the cyanobacterium Synechocystis sp. PCC 6803 show increased electrogenic activity in biological photo-voltaic systems.</a> Phys Chem Chem Phys. 15, 13611-13618 (2013).</li><li>Ducat, D. C., Way, J. C., Silver, P. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Engineering+cyanobacteria+to+generate+high-value+products.">Engineering cyanobacteria to generate high-value products.</a> Trends Biotechnol. 29, 95-103 (2011).</li><li>Dismukes, G. C., Carrieri, D., Bennette, N., Ananyev, G. M., Posewitz, M. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Aquatic+phototrophs:+efficient+alternatives+to+land-based+crops+for+biofuels.">Aquatic phototrophs: efficient alternatives to land-based crops for biofuels.</a> Curr Opin Biotechnol. 19, 235-240 (2008).</li><li>Tan, L. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bioactive+natural+products+from+marine+cyanobacteria+for+drug+discovery.">Bioactive natural products from marine cyanobacteria for drug discovery.</a> Phytochemistry. 68, 954-979 (2007).</li><li>Volk, R. B., Furkert, F. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Antialgal,+antibacterial+and+antifungal+activity+of+two+metabolites+produced+and+excreted+by+cyanobacteria+during+growth.">Antialgal, antibacterial and antifungal activity of two metabolites produced and excreted by cyanobacteria during growth.</a> Microbiol Res. 161, 180-186 (2006).</li><li>Scott, S. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Biodiesel+from+algae:+challenges+and+prospects.">Biodiesel from algae: challenges and prospects.</a> Curr Opin Biotechnol. 21, 277-286 (2010).</li><li>Lea-Smith, D. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Phycobilisome-deficient+strains+of+Synechocystis+sp.+PCC+6803+have+reduced+size+and+require+carbon-limiting+conditions+to+exhibit+enhanced+productivity.">Phycobilisome-deficient strains of Synechocystis sp. PCC 6803 have reduced size and require carbon-limiting conditions to exhibit enhanced productivity.</a> Plant Physiol. 165, 705-714 (2014).</li><li>Lea-Smith, D. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Thylakoid+terminal+oxidases+are+essential+for+the+cyanobacterium+Synechocystis+sp.+PCC+6803+to+survive+rapidly+changing+light+intensities.">Thylakoid terminal oxidases are essential for the cyanobacterium Synechocystis sp. PCC 6803 to survive rapidly changing light intensities.</a> Plant Physiol. 162, 484-495 (2013).</li><li>Liu, X., Sheng, J., Curtiss, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fatty+acid+production+in+genetically+modified+cyanobacteria.">Fatty acid production in genetically modified cyanobacteria.</a> Proc Natl Acad Sci U S A. 108, 6899-6904 (2011).</li><li>Xu, H., Vavilin, D., Funk, C., Vermaas, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multiple+deletions+of+small+cab-like+proteins+in+the+cyanobacterium+Synechocystis+sp+PCC+6803+-+Consequences+for+pigment+biosynthesis+and+accumulation.">Multiple deletions of small cab-like proteins in the cyanobacterium Synechocystis sp PCC 6803 - Consequences for pigment biosynthesis and accumulation.</a> J Biol Chem. 279, 27971-27979 (2004).</li><li>Castenholz, R. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Culturing+methods+for+Cyanobacteria.">Culturing methods for Cyanobacteria.</a> Method Enzymol. 167, 68-93 (1988).</li><li>Mitschke, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+experimentally+anchored+map+of+transcriptional+start+sites+in+the+model+cyanobacterium+Synechocystis+sp+PCC6803.">An experimentally anchored map of transcriptional start sites in the model cyanobacterium Synechocystis sp PCC6803.</a> Proc Natl Acad Sci U S A. 108, 2124-2129 (2011).</li><li>Ried, J. L., Collmer, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+nptI-sacB-sacR+cartridge+for+constructing+directed,+unmarked+mutations+in+gram-negative+bacteria+by+marker+exchange-eviction+mutagenesis.">An nptI-sacB-sacR cartridge for constructing directed, unmarked mutations in gram-negative bacteria by marker exchange-eviction mutagenesis.</a> Gene. 57, 239-246 (1987).</li><li>Vieira, J., Messing, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+pUC+plasmids,+an+M13mp7-derived+system+for+insertion+mutagenesis+and+sequencing+with+synthetic+universal+primers.">The pUC plasmids, an M13mp7-derived system for insertion mutagenesis and sequencing with synthetic universal primers.</a> Gene. 19, 259-268 (1982).</li><li>Vermaas, W. F. J., Williams, J. G. K., Rutherford, A. W., Mathis, P., Arntzen, C. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetically+Engineered+Mutant+of+the+Cyanobacterium+Synechocystis+6803+Lacks+the+Photosystem-Ii+Chlorophyll-Binding+Protein+Cp-47.">Genetically Engineered Mutant of the Cyanobacterium Synechocystis 6803 Lacks the Photosystem-Ii Chlorophyll-Binding Protein Cp-47.</a> Proc Natl Acad Sci U S A. 83, 9474-9477 (1986).</li><li>Westphal, S., Heins, L., Soll, J., Vothknecht, U. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Vipp1+deletion+mutant+of+Synechocystis:+A+connection+between+bacterial+phage+shock+and+thylakoid+biogenesis?.">Vipp1 deletion mutant of Synechocystis: A connection between bacterial phage shock and thylakoid biogenesis?.</a> Proc Natl Acad Sci U S A. 98, 4243-4248 (2001).</li><li>Zhang, S. Y., Shen, G. Z., Li, Z. K., Golbeck, J. H., Bryant, D. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Vipp1+Is+Essential+for+the+Biogenesis+of+Photosystem+I+but+Not+Thylakoid+Membranes+in+Synechococcus+sp+PCC+7002.">Vipp1 Is Essential for the Biogenesis of Photosystem I but Not Thylakoid Membranes in Synechococcus sp PCC 7002.</a> J Biol Chem. 289, 15904-15914 (2014).</li><li>Taroncher-Oldenberg, G., Nishina, K., Stephanopoulos, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+and+analysis+of+the+polyhydroxyalkanoate-specific+beta-ketothiolase+and+acetoacetyl+coenzyme+A+reductase+genes+in+the+cyanobacterium+Synechocystis+sp+strain+PCC6803.">Identification and analysis of the polyhydroxyalkanoate-specific beta-ketothiolase and acetoacetyl coenzyme A reductase genes in the cyanobacterium Synechocystis sp strain PCC6803.</a> Appl Environ Microbiol. 66, 4440-4448 (2000).</li><li>Hein, S., Tran, H., Steinbuchel, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Synechocystis+sp.+PCC6803+possesses+a+two-component+polyhydroxyalkanoic+acid+synthase+similar+to+that+of+anoxygenic+purple+sulfur+bacteria.">Synechocystis sp. PCC6803 possesses a two-component polyhydroxyalkanoic acid synthase similar to that of anoxygenic purple sulfur bacteria.</a> Arch Microbiol. 170, 162-170 (1998).</li><li>Ng, A. H., Berla, B. M., Pakrasi, H. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fine+tuning+of+photoautotrophic+protein+production+by+combining+promoters+and+neutral+sites+in+Synechocystis+6803,+a+cyanobacterium.">Fine tuning of photoautotrophic protein production by combining promoters and neutral sites in Synechocystis 6803, a cyanobacterium.</a> Appl Environ Microbiol. , (2015).</li></ol>

The authors declare that they have no competing financial interests.

I passi più critici nella generazione di mutanti non contrassegnate sono: 1) un&#39;attenta progettazione plasmide per garantire solo la regione di destinazione è alterata; 2) garantire che i campioni rimangano axeniche, soprattutto quando coltivate su saccarosio; 3) placcatura cellule per la generazione di mutanti marcati trasformato inizialmente su piastre di agar BG11 privi antibiotici, seguita da aggiunta di agar più antibiotici 24 ore successive; 4) la coltura segnato mutanti per 4 giorni interi prima di placcatura su BG11 più di saccarosio piastre di agar: 5) garantire che i mutanti marcati sono completamente separati e 6) confermando a fondo il genotipo dei ceppi mutanti. Per questa ultima fase, primer aggiuntivi progettati per amplificare parte della regione eliminata, possono essere utilizzate per garantire che è stato rimosso. Southern blotting, mentre laboriosa, può anche essere usato. Tuttavia, la nostra esperienza è che la procedura descritta in questo articolo è sufficiente per una corretta verifica dei mutanti. Questa procedura è stata utilizzata anche per generare mutanti marcati in Synechococcus elongatus PCC7942. Tuttavia, ripetuto trasformazione di questo cianobatterio si è rivelato difficile. Se mutanti selezionati non possono essere suddivise quindi diverse condizioni ambientali di alta CO 2, di scarsa luminosità (&lt;20 mmol fotoni m-2 sec -1) o sostanze nutrienti supplementari (ad esempio glucosio) possono essere testati. Ad esempio, l&#39;aggiunta di glucosio è essenziale per generare fotosistema II mutanti 21. Se mutanti marcati non segregano completamente allora il gene è probabilmente essenziale per la vitalità. Tuttavia, ci sono esempi tratti dalla letteratura in cui alcuni gruppi di ricerca sono stati in grado di knockout di un gene (ad esempio, Vipp in Synechocystis) 22, solo per gli altri gruppi per mostrare poi che il gene non è essenziale 23. Questo potrebbe essere dovuto a differenze nei ceppi wild-type o disegno plasmide non corretta, con conseguente effetti polari adiacenti, geni essenziali. Se un mutante non lo fa completamentesegregare si consiglia che il plasmide contenente la cassetta NPT1 da pUC18K 20 tra i frammenti di sinistra e di destra essere utilizzato per la trasformazione. È facile verificare la presenza di bande corrispondenti al wild-type e mutante mediante PCR, dal momento che questo frammento è di circa 1,2 kb, rispetto al 3,8 kb NPT1 / cassette SACB. Questo risultato è un pezzo importante di prove che dimostrano che il gene è essenziale. Generazione di mutanti non contrassegnati con cassette di espressione inserita è in genere più impegnativo rispetto allo sviluppo di ceppi ad eliminazione diretta. In genere esprimere geni sotto il controllo del promotore forte cpcBAC1C2D 13. In alcuni casi questo può diminuire le probabilità di successo inserimento della cassetta genica, se sovra-espressione di una proteina è deleterio per la cellula. i promotori più deboli devono poi essere testati. In generale, abbiamo osservato che maggiore è la cassetta genica, più difficile è alSert è nel genoma. Non siamo stati in grado di inserire cassette geniche più grandi di 5 kb. Si deve anche essere presa nella scelta di siti da inserire cassette di espressione nel genoma. siti neutrali che non influenzano la vitalità delle cellule o la crescita dovrebbe essere usato. Esempi in Synechocystis includono phaAB e PHACE, che codificano le proteine ​​che codificano per la biosintesi poliidrossibutirrato percorso 24,25. Più di recente un ampio elenco di siti neutri in Synechocystis è stato identificato 26. Generazione di mutanti non marcate in cianobatteri è un processo lento, prendendo circa 5-7 settimane, se tutte le misure stanno conducendo correttamente. Questo è più lento del metodo standard di generare fori marcati utilizzati dalla maggior parte dei gruppi di ricerca che studiano cianobatteri. Tuttavia, la flessibilità di poter introdurre ulteriori mutazioni in mutanti marcati parzialmente compensa questo, poiché plasmidi aggiuntivi containing una serie di cassette che conferiscono resistenza agli antibiotici diversi, non devono essere costruiti. Per scopi di ricerca la capacità di mutare più geni volte è necessario per caratterizzare completamente il ruolo funzionale delle proteine. Ad esempio, abbiamo identificato un fenotipo deleterio solo su soppressione dei due lavandini elettroni ossidasi terminali localizzati alla membrana tilacoidi, poiché la perdita di uno solo di questi complessi potrebbe essere compensata dall&#39;attività degli altri 14. Sviluppo di un ceppo per applicazioni industriali richiederà anche più modifiche a un ceppo, non solo per l&#39;introduzione di geni estranei, ma anche per aumentare l&#39;efficienza fotosintetica, ottimizzazione raccolta della luce e la cancellazione di percorsi in competizione per il substrato desiderato. Il principale fattore limitante la velocità di generazione mutante non marcato è il tempo lento divisione della specie modello di cianobatteri, tra 8-20 ore a seconda delle condizioni di luce. under intensità di luce più elevate e concentrazioni di CO 2, la crescita è più veloce. Tuttavia, vi è il rischio che i ceppi mutanti che non tollerano né alta luce o di CO 2 sono scelti contro, o che ceppi mutanti subiranno alterazioni indesiderate prima di caratterizzazione fenotipica. Quindi questo non è raccomandato. Tuttavia, sarebbe altamente vantaggioso se un più rapido protocollo per generare mutanti marcati stato sviluppato. Nel complesso, questo faciliterebbe lo sviluppo di ceppi sia per la ricerca di base e applicazioni applicate. Tali ceppi potrebbero essere utilizzati per i biocarburanti, biomasse o di produzione chimica o nella comprensione di molti aspetti della biochimica cianobatteri, la genetica e la fisiologia.

I cianobatteri sono un phylum evolutivamente antica e diversificata di batteri che si trovano in quasi tutti gli ambienti naturali della Terra. Negli ecosistemi marini sono particolarmente abbondanti e svolgono un ruolo chiave in molti cicli degli elementi nutritivi, che rappresentano circa la metà di fissazione del carbonio 1, la maggior parte dell&#39;azoto fissazione 2 e centinaia di milioni di tonnellate di produzione di idrocarburi 3 negli oceani ogni anno. Cloroplasti, l&#39;organello responsabile per la fotosintesi delle alghe e delle piante eucariotiche, è probabile che si sono evoluti da un cianobatterio che è stato inghiottito da un organismo ospite 4. Cianobatteri sono dimostrati utili organismi modello per lo studio della fotosintesi, trasporto di elettroni 5 e percorsi biochimici, molti dei quali sono conservati nelle piante. Inoltre cianobatteri sono sempre più utilizzati per la produzione di alimenti, biocarburanti 6, elettricità 7 e industriali composti 8, a causa della loro altaghly efficiente conversione di acqua e CO 2 alla biomassa utilizzando l&#39;energia solare 9. Molte specie possono essere coltivate su terreni non coltivabili con sostanze nutritive minime e acqua di mare, il che suggerisce che i cianobatteri potenzialmente potrebbero essere coltivate su larga scala senza compromettere la produzione agricola. Alcune specie sono anche fonti di prodotti naturali, tra cui antifungini, antibatteriche e anti-cancro composti 10,11. La capacità di generare mutanti è la chiave per comprendere la fotosintesi cianobatteri, biochimica e fisiologia, ed essenziale per lo sviluppo di ceppi per uso industriale. La maggior parte degli studi pubblicati generi geneticamente ceppi modificati mediante inserimento di una cassetta di resistenza antibiotica nel sito di interesse. Ciò limita il numero di mutazioni che possono essere introdotte in un ceppo, come solo alcune cassette di resistenza agli antibiotici sono disponibili per l&#39;uso in cianobatteri. I ceppi che contengono geni che conferiscono re antibioticoresistenza non può essere utilizzato per la produzione industriale in vasche aperte, che rischia di essere l&#39;unico mezzo di costo-efficacia per la produzione di biocarburanti e di altri prodotti a basso valore 12. La generazione di mutanti non marcate supera queste limitazioni. mutanti non marcate non contengono DNA estraneo, se non intenzionalmente incluso, e può essere manipolato più volte. Pertanto è possibile generare come molte modifiche in un ceppo lo desideri. Inoltre, gli effetti polari geni a valle del sito di modifica possono essere minimizzati, consentendo la modifica più precisa dell&#39;organismo 13. Per generare ceppi mutanti, plasmidi suicidi contenenti due frammenti di DNA identiche alle regioni nel cromosoma cianobatteri che fiancheggiano il gene da cancellare (definito il 5 &#39;e 3&#39; regioni fiancheggianti) sono prima costruiti. Due geni sono poi inseriti tra le regioni fiancheggianti. Uno di questi codifica una proteina resistenza agli antibiotici; il secondo codifica SACB, che produces levansucrasi, un composto che conferisce sensibilità al saccarosio. Nella prima fase del processo, mutanti marcati, cioè ceppi contenenti alcune DNA estraneo, vengono generati. Il costrutto plasmidico è mescolato con le cellule di cianobatteri e il DNA è occupato naturalmente dall&#39;organismo. I trasformanti sono selezionati dalla crescita su piastre di agar contenenti l&#39;antibiotico appropriato e il genotipo mutante verificata mediante PCR. plasmidi suicidio non può replicare entro il ceppo di interesse. Pertanto eventuali colonie resistenti agli antibiotici risulteranno da un evento di ricombinazione per cui il gene di interesse inserito nel cromosoma. Per generare mutanti non marcati, il mutante contrassegnata viene poi mescolato con un secondo plasmide suicida contenente solo i 5 &#39;e 3&#39; regioni fiancheggianti. Tuttavia, se è necessario l&#39;inserimento di DNA estraneo, un plasmide costituito dal 5 &#39;e 3&#39; delle regioni fiancheggianti con cassette contenenti i geni di interesse inserito tra questi frammenti di DNA, può essere utilizzato. Selection è attraverso la crescita su piastre di agar contenenti saccarosio. Come saccarosio è letale per le cellule quando il prodotto genico SACB è espresso, le uniche cellule che sopravvivono sono quelli in cui si è verificato un secondo evento di ricombinazione, per cui il gene sensibilità saccarosio, oltre al gene di resistenza agli antibiotici, è stato ricombinato fuori cromosoma e sul plasmide. Come conseguenza dello scambio ricombinazione, le regioni fiancheggianti e tutte DNA tra loro sono inseriti nel cromosoma. Abbiamo usato con successo questi metodi per generare mutazioni multiple cromosomiche nello stesso ceppo di Synechocystis sp. PCC6803 (di seguito denominato Synechocystis) 13,14, di introdurre mutazioni puntiformi singoli in un gene di interesse e 13 per l&#39;espressione di cassette geniche. Mentre la generazione di fori non marcati è stata dimostrata prima del nostro lavoro in Synechocystis 15,16, un metodo dettagliato, aiutato dauna presentazione visiva delle fasi critiche, non è a disposizione del pubblico. Abbiamo inoltre applicato lo stesso metodo per la generazione di fori evidenziati in un altro modello cianobatterio, Synechococcus sp. PCC7002 (di seguito denominato Synechococcus). Questo protocollo fornisce una chiara, semplice metodo per la generazione di mutanti e un rapido protocollo per la validazione e la memorizzazione di questi ceppi.

<table><tbody><tr><td>NaNO&lt;sub&gt;3&lt;/sub&gt;</td><td>Sigma</td><td>S5506</td><td></td></tr><tr><td>MgSO&lt;sub&gt;4&lt;/sub&gt;.7H&lt;sub&gt;2&lt;/sub&gt;O</td><td>Sigma</td><td>230391</td><td></td></tr><tr><td>CaCl&lt;sub&gt;2&lt;/sub&gt;</td><td>Sigma</td><td>C1016</td><td></td></tr><tr><td>citric acid</td><td>Sigma</td><td>C0759</td><td></td></tr><tr><td>Na&lt;sub&gt;2&lt;/sub&gt;EDTA</td><td>Fisher</td><td>EDT002</td><td></td></tr><tr><td>H&lt;sub&gt;3&lt;/sub&gt;BO&lt;sub&gt;3&lt;/sub&gt;</td><td>Sigma</td><td>339067</td><td></td></tr><tr><td>MnCl&lt;sub&gt;2&lt;/sub&gt;.4H&lt;sub&gt;2&lt;/sub&gt;O</td><td>Sigma</td><td>M3634</td><td></td></tr><tr><td>ZnSO&lt;sub&gt;4&lt;/sub&gt;.7H&lt;sub&gt;2&lt;/sub&gt;O</td><td>Sigma</td><td>Z4750</td><td></td></tr><tr><td>Na&lt;sub&gt;2&lt;/sub&gt;MoO&lt;sub&gt;4&lt;/sub&gt;.2H&lt;sub&gt;2&lt;/sub&gt;O</td><td>Sigma</td><td>331058</td><td></td></tr><tr><td>CuSO&lt;sub&gt;4&lt;/sub&gt;.5H&lt;sub&gt;2&lt;/sub&gt;O</td><td>Sigma</td><td>209198</td><td></td></tr><tr><td>Co(NO&lt;sub&gt;3&lt;/sub&gt;)&lt;sub&gt;2&lt;/sub&gt;.6H&lt;sub&gt;2&lt;/sub&gt;O</td><td>Sigma</td><td>239267</td><td></td></tr><tr><td>Ferric ammonium citrate</td><td>Sigma</td><td>F5879</td><td></td></tr><tr><td>K&lt;sub&gt;2&lt;/sub&gt;HPO&lt;sub&gt;4&lt;/sub&gt;</td><td>Sigma</td><td>P3786</td><td></td></tr><tr><td>Na&lt;sub&gt;2&lt;/sub&gt;CO&lt;sub&gt;3&lt;/sub&gt;</td><td>Fisher</td><td>SODC001</td><td></td></tr><tr><td>TES</td><td>Sigma</td><td>T1375</td><td></td></tr><tr><td>NaHCO&lt;sub&gt;3&lt;/sub&gt;</td><td>Fisher</td><td>SODH001</td><td></td></tr><tr><td>HEPES</td><td>Sigma</td><td>H3375</td><td></td></tr><tr><td>cyanocobalamin</td><td>Sigma</td><td>47869</td><td></td></tr><tr><td>Na&lt;sub&gt;2&lt;/sub&gt;S&lt;sub&gt;2&lt;/sub&gt;O&lt;sub&gt;3&lt;/sub&gt;</td><td>Sigma</td><td>72049</td><td></td></tr><tr><td>Bacto agar</td><td>BD</td><td>214010</td><td></td></tr><tr><td>Sucrose</td><td>Fisher</td><td>SUC001</td><td></td></tr><tr><td>Petri dish 90 mm triple vented</td><td>Greiner</td><td>633185</td><td></td></tr><tr><td>0.2 &amp;micro;m filters</td><td>Sartorius</td><td>16534</td><td></td></tr><tr><td>100 ml conical flasks</td><td>Pyrex</td><td>CON004</td><td></td></tr><tr><td>Parafilm M 100 mm x 38&amp;nbsp;m</td><td>Bemis</td><td>FIL003</td><td></td></tr><tr><td>Phusion high fidelity DNA polymerase&amp;nbsp;</td><td>Phusion</td><td>F-530</td><td></td></tr><tr><td>Agarose</td><td>Melford</td><td>MB1200</td><td></td></tr><tr><td>DNA purification kit&amp;nbsp;</td><td>MoBio</td><td>12100-300</td><td></td></tr><tr><td>Restriction endonucleases</td><td>NEB</td><td></td><td></td></tr><tr><td>T4 ligase</td><td>Thermo Scientific</td><td>EL0011</td><td></td></tr><tr><td>Luria Bertani broth</td><td>Invitrogen</td><td>12795-027</td><td></td></tr><tr><td>MES</td><td>Sigma</td><td>M8250</td><td></td></tr><tr><td>Kanamycin sulfate</td><td>Sigma</td><td>60615</td><td></td></tr><tr><td>Ampicillin</td><td>Sigma</td><td>A9518</td><td></td></tr><tr><td>GeneJET plasmid miniprep kit</td><td>Thermo Scientific</td><td>K0503</td><td></td></tr><tr><td>14 ml round-bottom tube</td><td>BD falcon</td><td>352059</td><td></td></tr><tr><td>GoTaq G2 Flexi DNA polymerase</td><td>Promega</td><td>M7805</td><td></td></tr><tr><td>425-600 &amp;micro;m glass beads</td><td>Sigma</td><td>G8772</td><td></td></tr><tr><td>Glycerol</td><td>Sigma</td><td>G5516</td><td></td></tr><tr><td>DMSO</td><td>Sigma</td><td>D8418</td><td></td></tr><tr><td>Fluorescent bulbs</td><td>Gro-Lux</td><td>69</td><td></td></tr><tr><td>HT multitron photobioreactor</td><td>Infors</td><td></td><td></td></tr></tbody></table>

generation of marked and markerless mutants in model cyanobacterial species

Cyanobacteria are ecologically important organisms and potential platforms for production of biofuels and useful industrial products. Genetic manipulation of cyanobacteria, especially model organisms such as Synechocystis sp. PCC6803 and Synechococcus sp. PCC7002, is a key tool for both basic and applied research. Generation of unmarked mutants, whereby chromosomal alterations are introduced into a strain via insertion of an antibiotic resistance cassette (a manipulatable fragment of DNA containing one or more genes), followed by subsequent removal of this cassette using a negative selectable marker, is a particularly powerful technique. Unmarked mutants can be repeatedly genetically manipulated, allowing as many alterations to be introduced into a strain as desired. In addition, the absence of genes encoding antibiotic resistance proteins in the mutated strain is desirable, as it avoids the possibility of 'escape' of antibiotic resistant organisms into the environment. However, detailed methods for repeated rounds of genetic manipulation of cyanobacteria are not well described in the scientific literature. Here we provide a comprehensive description of this technique, which we have successfully used to generate mutants with multiple deletions, single point mutations within a gene of interest and insertion of novel gene cassettes.

Disegno plasmide è fondamentale per la generazione di successo di entrambi i mutanti marcati e non marcati. Figura 1 è riportato un esempio di plasmide A e B utilizzato per generare una delezione mutanti nei geni Synechocystis cpcC1 e cpcC2 13. In ogni caso le 5 &#39;e 3&#39; regioni fiancheggianti sono circa 900-1.000 bp. regioni fiancheggianti ridotti possono essere utilizzati anche se la più piccola che abbiamo trialed successo è stato di circa 500 bp. Plasmid B può anche contenere una cassetta genica tra il 5 &#39;e 3&#39; ~ 1 kb regioni fiancheggianti o una versione modificata della sequenza del gene nativo. <img alt="figura 2" src="/files/ftp_upload/54001/54001fig2highres.jpg" width="600" /> Figura 2: Verifica dei mutanti marcati e non marcati, ad esempio cpcC1 / cpcC2 <sTrong&gt; in Synechocystis e SYNPCC7002_A1173 in Synechococcus. (A) La dimensione prevista del wild-type Synechocystis (in alto), non marcato (al centro) e marcata eliminazione diretta (in basso) ampliconi generati usando primer cpcC1C2for e cpcC1C2rev, circa 200 bp su entrambi i lati la regione cromosomica da eliminare. (B) La dimensione prevista del wild-type Synechococcus (in alto) e knockout segnato (in basso) ampliconi generati usando primer A1173for e A1173rev, circa 200 bp su entrambi i lati della regione cromosomica da eliminare. Gel di agarosio mostrando amplificati generati da (C) wild-type Synechocystis (corsia 2), non marcato (corsia 3) e segnato ko cpcC1 / cpcC2 (corsia 4), ​​e (D) wild-type Synechococcus (corsia 6) e la marcata SYNPCC7002_A1173 knockout (corsia 7). Marcatori sono mostratiin corsia 1 e 5. <a href="https://www-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/54001/54001fig2highres.jpg" target="_blank">Si prega di cliccare qui per vedere una versione più grande di questa figura.</a> Dopo trasformazione di plasmide A nelle cellule, tipicamente diverse centinaia di colonie appariranno su un piatto dopo circa 7-10 giorni. Le colonie sono &lt;1 mm di diametro e non aumentano di dimensione per le prossime settimane. Pertanto è fondamentale utilizzare uno stuzzicadenti punta smussata per rimuovere la colonia e strisciare su un BG11 + kanamicina piastra di agar fresco. Circa la metà delle colonie ri-striato cresceranno dopo 4-6 giorni. Se i geni sono non essenziali e mutanti mostrano una crescita simile al ceppo wild-type sotto la luce continua di 20-40 micromoli fotoni m -2 sec -1 (ad esempio terminali mutanti ossidasi a Lea-Smith et al. 2013 14) (Figura 3), allora tutti i cromosomi dovrebbero contenere una copia di t<html> egli NPT1 / cassette SACB sequenza inserita, come determinato tramite PCR. Se i geni sono non essenziale e mutanti mostrano un fenotipo lenta crescita sotto luce continua di 20-40 mmol fotoni m -2 sec -1 (es ficobilisoma mutanti carenti in Lea-Smith et al. 2014 13) (Figura 3), quindi vari cicli di ri-striature su piastre di agar BG11 con graduale aumento della quantità di kanamicina sono essenziali al fine di ottenere un mutante marcata segregazione. Una volta che un mutante segregato si ottiene questo dovrebbe essere ri-striato su un BG11 più kanamicina piastra di agar fresco per garantire che la separazione è stata completata. Se ripetuti giri di striature non diano luogo ad un segregato marcata mutante allora il gene è probabile essenziale per la sopravvivenza. La figura 4 fornisce una descrizione sommaria delle fasi sperimentali coinvolti nella generazione mutante non marcato. /54001/54001fig3highres.jpg &quot;Width =&quot; 700 &quot;/&gt; Figura 3:. La crescita di mutanti Synechocystis Esempi di mutanti che dimostrare (A) di crescita simile a wild-type e (B) una crescita più lenta rispetto wild-type. Il mutante ΔCOX manca citocromo ossidasi A causa della soppressione dei geni CtaC1D1E1. Il mutante ΔCyd manca chinolo ossidasi A causa della soppressione dei geni CydAB. Il mutante olive manca di una porzione del ficobilisoma causa della soppressione dei geni CpcABC1C2D. I campioni in (B) sono stati gorgogliare aria per facilitare la crescita. Tratto da dati pubblicati in Lea-Smith et al, 2013 14 e nel 2014 13 (www.plantphysiol.org; Copyright dell&#39;American Society of biologi).. <a href="https://www-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/54001/54001fig3highres.jpg" target="_blank">Clicca qui per vedere una versione più grande di questa figura.</a> <p class="jove_content" fo:keep-together.within-page = &quot;1&quot;&gt; Generazione di mutanti non marcato è altamente efficiente. Dopo trasformazione di plasmide B nel marcato mutante, un periodo di una incubazione giorno e successiva placcatura su BG11 più di saccarosio agar piastre, centinaia di colonie sono ottenuti per 1-10 ml di sospensione cellulare trasformata. Tuttavia una serie di diluizioni opportuno trialed, compreso tra 0,1 e 100 ul, come una quantità eccessiva porta ad una ridotta concentrazione di saccarosio per cella, con conseguente scarsa selezione per mutanti marcati. Se un prato di cellule è vista su tutta la piastra di concentrazioni più basse, allora dovrebbero essere provati. Una volta che le singole colonie sono ottenuti su piastre, l&#39;applicazione di patch su BG11 più di saccarosio e BG11 più piastre di agar kanamicina è un passo essenziale. Tipicamente per mutanti non contrassegnati cui viene cancellato una regione del cromosoma, la maggior parte delle colonie sarà kanamicina sensibili e saccarosio resistenti. PCR amplificazione della regione bersaglio in queste colonie mostrano che quasi il 100% dimostrare l&#39;unmarked profilo mutante, ad esempio la figura 2. Se una cassetta gene viene inserito nel cromosoma quindi tipicamente una maggiore proporzione di kanamicina sono osservate colonie resistenti resistenti e saccarosio. Questi mutanti possono crescere sul saccarosio a causa di una mutazione nel gene SACB. Se nessun colonie resistenti sensibili e saccarosio kanamicina sono generati allora la cassetta genica è deleterio per la cellula. <img alt="Figura 4" src="/files/ftp_upload/54001/54001fig4highres.jpg" width="700" /> Figura 4: Generazione di mutanti marcati e non marcati in Synechocystis schematica dettagli ricombinazione (A) e (B) fasi sperimentali coinvolti nella generazione mutante.. Plasmide A viene prima mescolato con le cellule. Dopo incubazione su piastre di agar contenenti kanamicina, colonie in cui si verifica un evento di ricombinazione tra il 5 &#39;und 3 &#39;regioni fiancheggianti (indicate in blu e rosso, rispettivamente) e la sequenza omologa nel cromosoma, sono isolati. Inoltre, la NPT1 / cassetta SACB tra il 5 &#39;e 3&#39; regioni fiancheggianti viene inserito nel cromosoma. A seguito di segregazione viene generato un mutante marcata. Cellule mutanti marcate vengono poi mescolati con plasmide B che può contenere sia (C) 1: 5 &#39;e 3&#39; regioni fiancheggianti; 2: 5 &#39;e 3&#39; fiancheggianti regioni con una cassetta di espressione contenente geni di interesse inserito tra queste sequenze; 3: il 5 &#39;e 3&#39; delle regioni fiancheggianti la sequenza wild-type con alterazioni nucleotidiche desiderate inseriti tra queste sequenze. Un secondo evento di ricombinazione omologa si verifica tra il 5 &#39;e 3&#39; regioni fiancheggianti e le regioni omologhe cromosoma, con conseguente rimozione del NPT1 / cassetta SACB e sia il knockout marcato o un mutante con una inserzione o alterata wild-tipe regione introdotto nel cromosoma. <a href="https://www-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/54001/54001fig4highres.jpg" target="_blank">Clicca qui per vedere una versione più grande di questa figura.</a> <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> Ricette soluzione madre </td><td></td></tr><tr><td> chimico </td><td> Importo (g) </td></tr><tr><td> 100x BG11 (per L) </td><td></td></tr><tr><td> Nano 3 </td><td> 149.6 </td></tr><tr><td> MgSO 4 .7H 2 O </td><td> 7.49 </td></tr><tr><td> CaCl 2 .2H 2 O </td><td> 3.6 </td></tr><tr><td> Acido citrico </td><td> 0.6 </td></tr><tr><td> Aggiungere 1,12 ml 0,25 M Na 2 EDTA, pH 8,0 </td><td></td></tr><tr><td> 0,25 M Na 2 EDTA, pH 8,0 (per 100 ml) </td><td></td></tr><tr><td> na 2 </sub&gt; EDTA </td><td> 9.3 </td></tr><tr><td> Oligoelementi (per 100 ml) </td><td></td></tr><tr><td> H 3 BO 3 </td><td> 0,286 </td></tr><tr><td> MnCl 2 .4H 2 O </td><td> 0.181 </td></tr><tr><td> ZnSO4 7H 2 O </td><td> 0,022 </td></tr><tr><td> Na 2 Moo 4 .2H 2 O </td><td> 0,039 </td></tr><tr><td> CuSO 4 .5H 2 O </td><td> 0,008 </td></tr><tr><td> Co (NO 3) 2 6H 2 O </td><td> 0.005 </td></tr><tr><td> Ferro magazzino (per 100 ml) </td><td></td></tr><tr><td> citrato ammonico ferrico </td><td> 1.11 </td></tr><tr><td> Fosfato magazzino (per 100 ml) </td><td></td></tr><tr><td> K 2 HPO 4 </td><td> 3.05 </td></tr><tr><td> Na 2 CO 3 stock (per 100 ml) </td&gt; <td></td></tr><tr><td> Na 2 CO 3 </td><td> 2 </td></tr><tr><td> Tampone TES, pH 8,2 (per 100 ml) </td><td></td></tr><tr><td> TES </td><td> 22.9 </td></tr><tr><td> NaHCO 3 stock (per 100 ml) </td><td></td></tr><tr><td> NaHCO 3 </td><td> 8.4 </td></tr><tr><td> HEPES, pH 8,2 (per 500 ml) </td><td></td></tr><tr><td> HEPES </td><td> 119.15 </td></tr><tr><td> La vitamina B 12 (per 50 ml) </td><td></td></tr><tr><td> cianocobalamina </td><td> 0.02 </td></tr><tr><td> Mezzi Luria Bertani (per 500 ml) </td><td></td></tr><tr><td> brodo Luria Bertani </td><td> 12.5 </td></tr><tr><td> 1 M MgCl 2 (Per 100 ml) </td><td></td></tr><tr><td> MgCl 2 .6H 2 O </td><td> 20.33 </td></tr><tr&gt; <td> Soluzione A (per 200 ml) </td><td></td></tr><tr><td> MnCl 2 .4H 2 O </td><td> 0,395 </td></tr><tr><td> CaCl 2 .2H 2 O </td><td> 1.47 </td></tr><tr><td> 2- (N -Morpholino) idrato Acido etansolfonico, acido 4-Morpholineethanesulfonic (MES) </td><td> 0,4265 </td></tr><tr><td> Soluzione A + glicerolo </td><td></td></tr><tr><td> 10 ml di soluzione A </td><td></td></tr><tr><td> 1,5 ml di glicerolo </td><td></td></tr></tbody></table> Tabella 1: Le soluzioni utilizzate in questo studio. <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> Primer </td><td> Sequenza </td></tr><tr><td> cpcC1C2leftfor </td><td> GTAC TCTAGA GCGGCTAAATGCTACGAC </td></tr><tr><td> CPCC1C2leftrev </td><td> GATC GGATCC GCGGTAATTGTTCCCTTTGA </td></tr><tr><td> cpcC1C2rightfor </td><td> GATC GAGCTC TGCACTGGTCAGTCGTTC </td></tr><tr><td> cpcC1C2rightrev </td><td> GACT GAATTC ATCGTTGCTTGAACGGTCTC </td></tr><tr><td> M13 in avanti </td><td> TGTAAAACGACGGCCAGT </td></tr><tr><td> M13 inversa </td><td> CAGGAAACAGCTATGAC </td></tr><tr><td> cpcC1C2for </td><td> GTTTTCATTGGCATCGGTCT </td></tr><tr><td> cpcC1C2rev </td><td> ATGTCCCAGGAACGACTGAC </td></tr><tr><td> A1173for </td><td> AGCAAACCGTTTTTGTGACC </td></tr><tr><td> A1173rev </td><td> TGCAAGGTGGCGAACTGTAT </td></tr></tbody></table> Tabella 2:. Primers utilizzati nei siti di endonucleasi di restrizione questo studio sono sottolineate.

Watch this Scientific Journal Video about Generation of Marked and Markerless Mutants in Model Cyanobacterial Species at JoVE.com

Generation of Marked and Markerless Mutants in Model Cyanobacterial Species

Introducing multiple genomic alterations into cyanobacteria is an essential tool in the development of strains for industrial and basic research purposes. We describe a system for generating unmarked mutants in the model cyanobacterial species Synechocystis sp. PCC6803 and marked mutants in Synechococcus sp. PCC7002.

Generazione di marcato e markerless Mutanti nel modello di cianobatteri Specie

Cyanobacteria are ecologically important organisms and potential platforms for production of biofuels and useful industrial products. Genetic manipulation ...

generation-marked-markerless-mutants-model-cyanobacterial

Universidad San Sebastian

Research

JoVE Journal

Biology

11.9K Views.  University of Cambridge. Introducing multiple genomic alterations into cyanobacteria is an essential tool in the development of strains for industrial and basic research purposes. We describe a system for generating unmarked mutants in the model cyanobacterial species Synechocystis sp. PCC6803 and marked mutants in Synechococcus sp. PCC7002.

Video: Generation of Marked and Markerless Mutants in Model Cyanobacterial Species

Optogenetic Random Mutagenesis Using Histone-miniSOG in C. elegans

Forward genetic screening in model organisms is the workhorse to discover functionally important genes and pathways in many biological processes. In most mutagenesis-based screens, researchers have relied on the use of toxic chemicals, carcinogens, or irradiation, which requires designated equipment, safety setup, and/or disposal of hazardous materials. We have developed a simple approach to induce heritable mutations in C. elegans using germline-expressed histone-miniSOG, a light-inducible potent generator of reactive oxygen species. This mutagenesis method is free of toxic chemicals and requires minimal laboratory safety and waste management. The induced DNA modifications include single-nucleotide changes and small deletions, and complement those caused by classical chemical mutagenesis. This methodology can also be used to induce integration of extrachromosomal transgenes. Here, we provide the details of the LED setup and protocols for standard mutagenesis and transgene integration.

Optogenetic Random Mutagenesis Using Histone-miniSOG in C. elegans

Genetically-encoded histone-miniSOG induces genome-wide heritable mutations in a blue&#160;light-dependent manner. This mutagenesis method is simple, fast, free of toxic chemicals, and well-suited for forward genetic screening and transgene integration.

Optogenetic caso Mutagenesi Utilizzando istone-miniSOG in<em&gt; C. elegans</em

Forward genetic screening in model organisms is the workhorse to discover functionally important genes and pathways in many biological processes. In most ...

Ricerca

Genetica

High-Throughput Robotically Assisted Isolation of Temperature-sensitive Lethal Mutants in Chlamydomonas reinhardtii

Systematic identification and characterization of genetic perturbations have proven useful to decipher gene function and cellular pathways. However, the conventional approaches of permanent gene deletion cannot be applied to essential genes. We have pioneered a unique collection of ~70 temperature-sensitive (ts) lethal mutants for studying cell cycle regulation in the unicellular green algae Chlamydomonas reinhardtii1. These mutations identify essential genes, and the ts alleles can be conditionally inactivated by temperature shift, providing valuable tools to identify and analyze essential functions. Mutant collections are much more valuable if they are close to comprehensive, since scattershot collections can miss important components. However, this requires the efficient collection of a large number of mutants, especially in a wide-target screen. Here, we describe a robotics-based pipeline for generating ts lethal mutants and analyzing their phenotype in Chlamydomonas. This technique can be applied to any microorganism that grows on agar. We have collected over 3000 ts mutants, probably including mutations in most or all cell-essential pathways, including about 200 new candidate cell cycle mutations. Subsequent molecular and cellular characterization of these mutants should provide new insights in plant cell biology; a comprehensive mutant collection is an essential prerequisite to ensure coverage of a broad range of biological pathways. These methods are integrated with downstream genetics and bioinformatics procedures for efficient mapping and identification of the causative mutations that are beyond the scope of this manuscript.

High-Throughput Robotically Assisted Isolation of Temperature-sensitive Lethal Mutants in Chlamydomonas reinhardtii

Temperature-sensitive (ts) lethal mutants are valuable tools to identify and analyze essential functions. Here we describe methods to generate and classify ts lethal mutants in high throughput.

High-throughput robotizzata Assisted Isolamento di sensibile alla temperatura letale Mutants in<em&gt; Reinhardtii Chlamydomonas</em

Systematic identification and characterization of genetic perturbations have proven useful to decipher gene function and cellular pathways. However, the ...

Identifying Amino Acid Overproducers Using Rare-Codon-Rich Markers

To satisfy the ever-growing market for amino acids, high-performance production strains are needed. The amino acid overproducers are conventionally identified by harnessing the competitions between amino acids and their analogs. However, this analog-based method is of low accuracy, and proper analogs for specific amino acids are limited. Here, we present an alternative strategy that enables an accurate, sensitive, and high-throughput screening of amino acid overproducers using rare-codon-rich markers. This strategy is inspired by the phenomenon of codon usage bias in protein translation, for which codons are categorized into common or rare ones based on their frequencies of occurrence in the coding DNA. The translation of rare codons depends on their corresponding rare transfer RNAs (tRNAs), which cannot be fully charged by the cognate amino acids under starvation. Theoretically, the rare tRNAs can be charged if there is a surplus of the amino acids after charging the synonymous common isoacceptors. Therefore, retarded translations caused by rare codons could be restored by feeding or intracellular overproductions of the corresponding amino acids. Under this assumption, a selection or screening system for identifying amino acid overproducers is established by replacing the common codons of the targeted amino acids with their synonymous rare alternatives in the antibiotic resistance genes or the genes encoding fluorescent or chromogenic proteins. We show that the protein expressions can be greatly hindered by the incorporation of rare codons and that the levels of proteins correlate positively with the amino acid concentrations. Using this system, overproducers of multiple amino acids can be readily screened out from mutation libraries. This rare-codon-based strategy only requires a single modified gene, and the host is less likely to escape the selection than in other methods. It offers an alternative approach for obtaining amino acid overproducers.

This study presents an alternative strategy to the conventional toxic analog-based method in identifying amino acid overproducers by using rare-codon-rich markers to achieve accuracy, sensitivity, and high-throughput simultaneously.

Identificare gli amminoacidi sovraproduttori utilizzando marcatori rari-codoni-ricchi

To satisfy the ever-growing market for amino acids, high-performance production strains are needed. The amino acid overproducers are conventionally ...

Biochimica

Visual and Microscopic Evaluation of Streptomyces Developmental Mutants

Streptomycetes are filamentous soil bacteria belonging to the phylum Actinobacteria that are found throughout the world and produce a wide array of antibiotics and other secondary metabolites. Streptomyces coelicolor is a well-characterized, non-pathogenic species that is amenable to a variety of analyses in the lab. The phenotyping methods described here use S. coelicolor as a model streptomycete; however, the methods are applicable to all members of this large genus as well as some closely related actinomycetes. Phenotyping is necessary to characterize new species of Streptomyces identified in the environment, and it is also a vital first step in characterizing newly isolated mutant strains of Streptomyces. Proficiency in phenotyping is important for the many new researchers who are entering the field of Streptomyces research, which includes the study of bacterial development, cell division, chromosome segregation, and second messenger signaling. The recent crowdsourcing of antibiotic discovery through the isolation of new soil microbes has resulted in an increased need for training in phenotyping for instructors new to the field of Streptomyces research and their college or high school students. This manuscript describes methods for bacterial strain propagation, storage, and characterization through visual and microscopic examination. After reading this article, new researchers (microbiology education laboratories and citizen scientists) should be able to manipulate Streptomyces strains and begin visual characterization experiments.

Visual and Microscopic Evaluation of Streptomyces Developmental Mutants

Here we present protocols for novice researchers to initiate phenotyping for the pharmacologically important bacterial genus Streptomyces.

Valutazione visiva e microscopiche di Streptomyces mutanti inerente allo sviluppo

Streptomycetes are filamentous soil bacteria belonging to the phylum Actinobacteria that are found throughout the world and produce a wide array of ...

Immunologia e infezioni

Live-Cell Forward Genetic Approach to Identify and Isolate Developmental Mutants in Chlamydia trachomatis

The intracellular bacterial pathogen Chlamydia trachomatis undergoes a developmental cycle consisting of two morphologically discrete developmental forms. The non-replicative elementary body (EB) initiates infection of the host. Once inside, the EB differentiates into the reticulate body (RB). The RB then undergoes multiple rounds of replication, before differentiating back to the infectious EB form. This cycle is essential for chlamydial survival as failure to switch between cell types prevents either host invasion or replication.
Limitations in genetic techniques due to the obligate intracellular nature of Chlamydia have hampered identification of the molecular mechanisms involved in the cell-type development. We designed a novel dual promoter-reporter plasmid system that, in conjunction with live-cell microscopy, allows for the visualization of cell type switching in real time. To identify genes involved in the regulation of cell-type development, the live-cell promoter-reporter system was leveraged for the development of a forward genetic approach by combining chemical mutagenesis of the dual reporter strain, imaging and tracking of Chlamydia with altered developmental kinetics, followed by clonal isolation of mutants. This forward genetic workflow is a flexible tool that can be modified for directed interrogation into a wide range of genetic pathways.

Live-Cell Forward Genetic Approach to Identify and Isolate Developmental Mutants in Chlamydia trachomatis

This protocol utilizes fluorescent promoter-reporters, live-cell microscopy, and individual inclusion extraction in a directed forward genetic approach to identify and isolate developmental mutants of Chlamydia trachomatis.

Approccio genetico in avanti a cellule vive per identificare e isolare i mutanti dello sviluppo nella chlamydia trachomatis

The intracellular bacterial pathogen Chlamydia trachomatis undergoes a developmental cycle consisting of two morphologically discrete developmental forms. ...

Integrazione genica stabile in Chlorella vulgaris utilizzando Agrobacterium tumefaciens

Agrobacterium tumefaciens-Mediated Genetic Engineering of Green Microalgae, Chlorella vulgaris

Agrobacterium tumefaciens-mediated transformation (AMT) serves as a widely employed tool for manipulating plant genomes. However, A. tumefaciens exhibit the capacity for gene transfer to a diverse array of species. Numerous microalgae species lack well-established methods for reliably integrating genes of interest into their nuclear genome. To harness the potential benefits of microalgal biotechnology, simple and efficient genome manipulation tools are crucial. Herein, an optimized AMT protocol is presented for the industrial microalgae species Chlorella vulgaris, utilizing the reporter green fluorescent protein (mGFP5) and the antibiotic resistance marker for Hygromycin B. Mutants are selected through plating on Tris-Acetate-Phosphate (TAP) media containing Hygromycin B and cefotaxime. Expression of mGFP5 is quantified via fluorescence after over ten generations of subculturing, indicating the stable transformation of the T-DNA cassette. This protocol allows for the reliable generation of multiple transgenic C. vulgaris colonies in under two weeks, employing the commercially available pCAMBIA1302 plant expression vector.

Autore in primo piano: Protocollo di trasformazione ottimizzato per la Chlorella vulgaris utilizzando l'Agrobacterium tumefaciens 

This protocol outlines the utilization of Agrobacterium tumefaciens-mediated transformation (AMT) for integrating gene(s) of interest into the nuclear genome of the green microalgae Chlorella vulgaris, leading to the production of stable transformants.

Ingegneria genetica mediata da Agrobacterium tumefaciens di microalghe verdi, Chlorella vulgaris

Agrobacterium tumefaciens-mediated transformation (AMT) serves as a widely employed tool for manipulating plant genomes. However, A. tumefaciens exhibit ...

Bioingegneria

Generation of Null Mutants to Elucidate the Role of Bacterial Glycosyltransferases in Bacterial Motility

The study of glycosylation in prokaryotes is a rapidly growing area. Bacteria harbor different glycosylated structures on their surface whose glycans constitute a strain-specific barcode. The associated glycans show higher diversity in sugar composition and structure than those of eukaryotes and are important in bacterial-host recognition processes and interaction with the environment. In pathogenic bacteria, glycoproteins have been involved in different stages of the infectious process, and glycan modifications can interfere with specific functions of glycoproteins. However, despite the advances made in the understanding of glycan composition, structure, and biosynthesis pathways, understanding of the role of glycoproteins in pathogenicity or interaction with the environment remains very limited. Furthermore, in some bacteria, the enzymes required for protein glycosylation are shared with other polysaccharide biosynthetic pathways, such as lipopolysaccharide and capsule biosynthetic pathways. The functional importance of glycosylation has been elucidated in several bacteria through mutation of specific genes thought to be involved in the glycosylation process and the study of its impact on the expression of the target glycoprotein and the modifying glycan. Mesophilic Aeromonas have a single and O-glycosylated polar flagellum. Flagellar glycans show diversity in carbohydrate composition and chain length between Aeromonas strains. However, all strains analyzed to date show a pseudaminic acid derivative as the linking sugar that modifies serine or threonine residues. The pseudaminic acid derivative is required for polar flagella assembly, and its loss has an impact on adhesion, biofilm formation, and colonization. The protocol detailed in this article describes how the construction of null mutants can be used to understand the involvement of genes or genome regions containing putative glycosyltransferases in the biosynthesis of a flagellar glycan. This includes the potential to understand the function of the glycosyltransferases involved and the role of the glycan. This will be achieved by comparing the glycan deficient mutant to the wild-type strain.

Here, we describe the construction of null mutants of Aeromonas in specific glycosyltransferases or regions containing glycosyltransferases, the motility assays, and flagella purification performed to establish the involvement and function of their encoded enzymes in the biosynthesis of a glycan, as well as the role of this glycan in bacterial pathogenesis.

Generazione di mutanti nulli per chiarire il ruolo delle glicosiltransferasi batteriche nella motilità batterica

The study of glycosylation in prokaryotes is a rapidly growing area. Bacteria harbor different glycosylated structures on their surface whose glycans ...

Monitoring Intraspecies Competition in a Bacterial Cell Population by Cocultivation of Fluorescently Labelled Strains

Many microorganisms such as bacteria proliferate extremely fast and the populations may reach high cell densities. Small fractions of cells in a population always have accumulated mutations that are either detrimental or beneficial for the cell. If the fitness effect of a mutation provides the subpopulation with a strong selective growth advantage, the individuals of this subpopulation may rapidly outcompete and even completely eliminate their immediate fellows. Thus, small genetic changes and selection-driven accumulation of cells that have acquired beneficial mutations may lead to a complete shift of the genotype of a cell population. Here we present a procedure to monitor the rapid clonal expansion and elimination of beneficial and detrimental mutations, respectively, in a bacterial cell population over time by cocultivation of fluorescently labeled individuals of the Gram-positive model bacterium Bacillus subtilis. The method is easy to perform and very illustrative to display intraspecies competition among the individuals in a bacterial cell population.

Bacteria may accumulate either detrimental or beneficial mutations during their lifetime. In a population of cells individuals that have accumulated beneficial mutations may rapidly outcompete their fellows. Here we present a simple procedure to visualize intraspecies competition in a bacterial cell population over time using fluorescently labeled individuals.&#160;

Generazione di marcato e markerless Mutanti nel modello di cianobatteri Specie

Riepilogo

Esplora Altri Video

Capitoli in questo video

Optogenetic caso Mutagenesi Utilizzando istone-miniSOG in

High-throughput robotizzata Assisted Isolamento di sensibile alla temperatura letale Mutants in

Identificare gli amminoacidi sovraproduttori utilizzando marcatori rari-codoni-ricchi

Valutazione visiva e microscopiche di Streptomyces mutanti inerente allo sviluppo

Approccio genetico in avanti a cellule vive per identificare e isolare i mutanti dello sviluppo nella chlamydia trachomatis

Ingegneria genetica mediata da Agrobacterium tumefaciens di microalghe verdi, Chlorella vulgaris

Ingegneria genetica mediata da Agrobacterium tumefaciens di microalghe verdi, Chlorella vulgaris

Ingegneria genetica mediata da Agrobacterium tumefaciens di microalghe verdi, Chlorella vulgaris

Generazione di mutanti nulli per chiarire il ruolo delle glicosiltransferasi batteriche nella motilità batterica

Monitoraggio della concorrenza intraspecie in una popolazione di cellule batteriche mediante cocultivazione di ceppi marcati fluorescentmente