Name: generation of marked and markerless mutants in model cyanobacterial species
Uploaded: 2016-05-29T15:00:00.000+00:00
Duration: 11 min 45 s
Description: Watch this Scientific Journal Video about Generation of Marked and Markerless Mutants in Model Cyanobacterial Species at JoVE.com

אנו מודים טראסט לחינוך סביבתי שירותים האגודה, ביולוגיה סינתטית בקרן קיימברידג SynBio ומשרד צדק חברתי והעצמה, ממשלת הודו, עבור תמיכה כספית.

<ol>
	<li>Zwirglmaier, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Global+phylogeography+of+marine+Synechococcus+and+Prochlorococcus+reveals+a+distinct+partitioning+of+lineages+among+oceanic+biomes.">Global phylogeography of marine Synechococcus and Prochlorococcus reveals a distinct partitioning of lineages among oceanic biomes.</a> Environ Microbiol. 10, 147-161 (2008).</li><li>Galloway, J. N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nitrogen+cycles:+past,+present,+and+future.">Nitrogen cycles: past, present, and future.</a> Biogeochemistry. 70, 153-226 (2004).</li><li>Lea-Smith, D. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Contribution+of+cyanobacterial+alkane+production+to+the+ocean+hydrocarbon+cycle.">Contribution of cyanobacterial alkane production to the ocean hydrocarbon cycle.</a> Proc Natl Acad Sci U S A. , (2015).</li><li>Howe, C. J., Barbrook, A. C., Nisbet, R. E. R., Lockhart, P. J., Larkum, A. W. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+origin+of+plastids.">The origin of plastids.</a> Philos Trans R Soc Lond B Biol Sci. 363, 2675-2685 (2008).</li><li>Lea-Smith, D. J., Bombelli, P., Vasudevan, R., Howe, C. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Photosynthetic,+respiratory+and+extracellular+electron+transport+pathways+in+cyanobacteria.">Photosynthetic, respiratory and extracellular electron transport pathways in cyanobacteria.</a> Biochim Biophys Acta. , (2015).</li><li>McCormick, A. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hydrogen+production+through+oxygenic+photosynthesis+using+the+cyanobacterium+Synechocystis+sp+PCC+6803+in+a+bio-photoelectrolysis+cell+(BPE)+system.">Hydrogen production through oxygenic photosynthesis using the cyanobacterium Synechocystis sp PCC 6803 in a bio-photoelectrolysis cell (BPE) system.</a> Energy Environ. Sci. 6, 2682-2690 (2013).</li><li>Bradley, R. W., Bombelli, P., Lea-Smith, D. J., Howe, C. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Terminal+oxidase+mutants+of+the+cyanobacterium+Synechocystis+sp.+PCC+6803+show+increased+electrogenic+activity+in+biological+photo-voltaic+systems.">Terminal oxidase mutants of the cyanobacterium Synechocystis sp. PCC 6803 show increased electrogenic activity in biological photo-voltaic systems.</a> Phys Chem Chem Phys. 15, 13611-13618 (2013).</li><li>Ducat, D. C., Way, J. C., Silver, P. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Engineering+cyanobacteria+to+generate+high-value+products.">Engineering cyanobacteria to generate high-value products.</a> Trends Biotechnol. 29, 95-103 (2011).</li><li>Dismukes, G. C., Carrieri, D., Bennette, N., Ananyev, G. M., Posewitz, M. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Aquatic+phototrophs:+efficient+alternatives+to+land-based+crops+for+biofuels.">Aquatic phototrophs: efficient alternatives to land-based crops for biofuels.</a> Curr Opin Biotechnol. 19, 235-240 (2008).</li><li>Tan, L. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bioactive+natural+products+from+marine+cyanobacteria+for+drug+discovery.">Bioactive natural products from marine cyanobacteria for drug discovery.</a> Phytochemistry. 68, 954-979 (2007).</li><li>Volk, R. B., Furkert, F. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Antialgal,+antibacterial+and+antifungal+activity+of+two+metabolites+produced+and+excreted+by+cyanobacteria+during+growth.">Antialgal, antibacterial and antifungal activity of two metabolites produced and excreted by cyanobacteria during growth.</a> Microbiol Res. 161, 180-186 (2006).</li><li>Scott, S. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Biodiesel+from+algae:+challenges+and+prospects.">Biodiesel from algae: challenges and prospects.</a> Curr Opin Biotechnol. 21, 277-286 (2010).</li><li>Lea-Smith, D. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Phycobilisome-deficient+strains+of+Synechocystis+sp.+PCC+6803+have+reduced+size+and+require+carbon-limiting+conditions+to+exhibit+enhanced+productivity.">Phycobilisome-deficient strains of Synechocystis sp. PCC 6803 have reduced size and require carbon-limiting conditions to exhibit enhanced productivity.</a> Plant Physiol. 165, 705-714 (2014).</li><li>Lea-Smith, D. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Thylakoid+terminal+oxidases+are+essential+for+the+cyanobacterium+Synechocystis+sp.+PCC+6803+to+survive+rapidly+changing+light+intensities.">Thylakoid terminal oxidases are essential for the cyanobacterium Synechocystis sp. PCC 6803 to survive rapidly changing light intensities.</a> Plant Physiol. 162, 484-495 (2013).</li><li>Liu, X., Sheng, J., Curtiss, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fatty+acid+production+in+genetically+modified+cyanobacteria.">Fatty acid production in genetically modified cyanobacteria.</a> Proc Natl Acad Sci U S A. 108, 6899-6904 (2011).</li><li>Xu, H., Vavilin, D., Funk, C., Vermaas, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multiple+deletions+of+small+cab-like+proteins+in+the+cyanobacterium+Synechocystis+sp+PCC+6803+-+Consequences+for+pigment+biosynthesis+and+accumulation.">Multiple deletions of small cab-like proteins in the cyanobacterium Synechocystis sp PCC 6803 - Consequences for pigment biosynthesis and accumulation.</a> J Biol Chem. 279, 27971-27979 (2004).</li><li>Castenholz, R. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Culturing+methods+for+Cyanobacteria.">Culturing methods for Cyanobacteria.</a> Method Enzymol. 167, 68-93 (1988).</li><li>Mitschke, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+experimentally+anchored+map+of+transcriptional+start+sites+in+the+model+cyanobacterium+Synechocystis+sp+PCC6803.">An experimentally anchored map of transcriptional start sites in the model cyanobacterium Synechocystis sp PCC6803.</a> Proc Natl Acad Sci U S A. 108, 2124-2129 (2011).</li><li>Ried, J. L., Collmer, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+nptI-sacB-sacR+cartridge+for+constructing+directed,+unmarked+mutations+in+gram-negative+bacteria+by+marker+exchange-eviction+mutagenesis.">An nptI-sacB-sacR cartridge for constructing directed, unmarked mutations in gram-negative bacteria by marker exchange-eviction mutagenesis.</a> Gene. 57, 239-246 (1987).</li><li>Vieira, J., Messing, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+pUC+plasmids,+an+M13mp7-derived+system+for+insertion+mutagenesis+and+sequencing+with+synthetic+universal+primers.">The pUC plasmids, an M13mp7-derived system for insertion mutagenesis and sequencing with synthetic universal primers.</a> Gene. 19, 259-268 (1982).</li><li>Vermaas, W. F. J., Williams, J. G. K., Rutherford, A. W., Mathis, P., Arntzen, C. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetically+Engineered+Mutant+of+the+Cyanobacterium+Synechocystis+6803+Lacks+the+Photosystem-Ii+Chlorophyll-Binding+Protein+Cp-47.">Genetically Engineered Mutant of the Cyanobacterium Synechocystis 6803 Lacks the Photosystem-Ii Chlorophyll-Binding Protein Cp-47.</a> Proc Natl Acad Sci U S A. 83, 9474-9477 (1986).</li><li>Westphal, S., Heins, L., Soll, J., Vothknecht, U. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Vipp1+deletion+mutant+of+Synechocystis:+A+connection+between+bacterial+phage+shock+and+thylakoid+biogenesis?.">Vipp1 deletion mutant of Synechocystis: A connection between bacterial phage shock and thylakoid biogenesis?.</a> Proc Natl Acad Sci U S A. 98, 4243-4248 (2001).</li><li>Zhang, S. Y., Shen, G. Z., Li, Z. K., Golbeck, J. H., Bryant, D. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Vipp1+Is+Essential+for+the+Biogenesis+of+Photosystem+I+but+Not+Thylakoid+Membranes+in+Synechococcus+sp+PCC+7002.">Vipp1 Is Essential for the Biogenesis of Photosystem I but Not Thylakoid Membranes in Synechococcus sp PCC 7002.</a> J Biol Chem. 289, 15904-15914 (2014).</li><li>Taroncher-Oldenberg, G., Nishina, K., Stephanopoulos, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+and+analysis+of+the+polyhydroxyalkanoate-specific+beta-ketothiolase+and+acetoacetyl+coenzyme+A+reductase+genes+in+the+cyanobacterium+Synechocystis+sp+strain+PCC6803.">Identification and analysis of the polyhydroxyalkanoate-specific beta-ketothiolase and acetoacetyl coenzyme A reductase genes in the cyanobacterium Synechocystis sp strain PCC6803.</a> Appl Environ Microbiol. 66, 4440-4448 (2000).</li><li>Hein, S., Tran, H., Steinbuchel, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Synechocystis+sp.+PCC6803+possesses+a+two-component+polyhydroxyalkanoic+acid+synthase+similar+to+that+of+anoxygenic+purple+sulfur+bacteria.">Synechocystis sp. PCC6803 possesses a two-component polyhydroxyalkanoic acid synthase similar to that of anoxygenic purple sulfur bacteria.</a> Arch Microbiol. 170, 162-170 (1998).</li><li>Ng, A. H., Berla, B. M., Pakrasi, H. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fine+tuning+of+photoautotrophic+protein+production+by+combining+promoters+and+neutral+sites+in+Synechocystis+6803,+a+cyanobacterium.">Fine tuning of photoautotrophic protein production by combining promoters and neutral sites in Synechocystis 6803, a cyanobacterium.</a> Appl Environ Microbiol. , (2015).</li></ol>

The authors declare that they have no competing financial interests.

השלבים הקריטיים ביותר בדור של מוטציות לא מסומנות הם: 1) עיצוב פלסמיד זהיר כדי להבטיח את אזור המיקוד רק משתנה; 2) להבטיח כי דגימות להישאר axenic, במיוחד כאשר בתרבית על סוכרוז; 3) ציפוי טרנספורמציה תאים עבור דור מוטציה מסומן בתחילה על צלחות אגרו BG11 חסרי אנטיביוטיקה, ואחריו תוספת של אגר בתוספת אנטיביוטיקה 24 שעות מאוחר יותר; 4) culturing מסומן מוטנטים עבור 4 ימים מלאים לפני ציפוי על צלחות אגרו BG11 בתוספת סוכרוז: 5) להבטיח כי מוטציות מסומנות הם מלאי הפרדה ו -6) ביסודיות המאשר את הגנוטיפ של זנים מוטנטים. עבור השלב אחרון זה, תחל נוסף שנועד להגביר חלק מהאזור נמחק, ניתן להשתמש כדי לוודא שהוא הוסר. סופג הדרום, תוך מייגע, יכול לשמש גם. עם זאת, הניסיון שלנו הוא כי ההליך המתואר במאמר זה מספיק עבור אימות תקינה של מוטציות. הליך זה גם נעשה שימוש כדי ליצור מוטציות ניכרות Synechococcus elongatus PCC7942. עם זאת, שינוי חוזר ונשנה של cyanobacterium זה הוכיח מאתגר. אם מוטציות מסומנות לא ניתן להפריד ואז תנאים סביבתיים שונים הגבוהה CO 2, אור נמוך (&lt;20 μmol פוטונים מ -2 שניות -1) או חומרים מזינים נוספים (גלוקוז כלומר) ניתן לבדוק. לדוגמה, תוספת של גלוקוז חיוני על מנת לייצר מוטציות photosystem השנייה 21. אם מוטציות מסומנות לעולם מלא להפריד ואז הגן הוא כנראה חיוני כדאי. עם זאת, ישנן דוגמאות מהספרות שם כמה קבוצות מחקר לא הצליחו המפסיד יוצא גן (לדוגמה, VIPP ב Synechocystis) 22, רק לקבוצות אחרות בהמשך להראות כי הגן אינו חיוני 23. זה יכול להיות בגלל הבדלי זני wild-type או עיצוב פלסמיד שגוי, וכתוצאה מכך תופעות קוטב על גנים סמוכים, חיוניים. אם מוטציה לא לגמרילהפריד היינו ממליצים פלסמיד המכיל את הקלטת npt1 מ pUC18K 20 שבין הקרעים שמאל וימין לשמש טרנספורמציה. קל לאמת את נוכחותם של הלהקות המתאימות wild-type ו המוטציה ידי PCR, מאז שבר זה הוא כ 1.2 קילו, לעומת קלטת 3.8 kb npt1 / sacB. תוצאה זו היא חלק חשוב של ראיות הוכחת כי הגן חיוני. דור של מוטציות לא מסומנות עם קלטות ביטוי מוכנסות הוא בדרך כלל יותר מאתגר מאשר פיתוח של זנים בנוקאאוט. בדרך כלל אנחנו מבטאים גנים תחת השליטה של אמרגן cpcBAC1C2D החזק 13. במקרים מסוימים זה יכול להפחית את הסיכויים של הכנסה המוצלחת של קלטת הגן, אם ביטוי יתר של חלבון מזיקת התא. חלשות יזמים צריכים להיבדק אז. באופן כללי ראינו כי הקלטת הגן הגדולה היא, כך קשה יותר היא בבהלבשה אותו לתוך הגנום. אנחנו לא הצלחנו להכניס קלטות גן גדולות מ 5 kb. טיפול צריך גם לקחת בבחירת אתרים להכניס קלטות ביטוי לתוך הגנום. אתרי Neutral שאינם משפיעים על כדאיות התא או צמיחה אמור לשמש. דוגמאות Synechocystis כוללים phaAB ו phaCE המקודדים חלבונים המקודדים מסלול biosynthetic polyhydroxybutyrate 24,25. לאחרונה רשימה מקיפה של אתרים ניטראליים Synechocystis זוהתה 26. דור של מוטציות לבדו כחוליות הוא תהליך איטי, לוקח כ 5-7 שבועות אם כל הצעדים מנהלים כראוי. זה איטי יותר מאשר השיטה המקובלת כיום להפקת knockouts נכרתה מנוצלת על ידי רוב קבוצות מחקר חוקרות כחוליות. עם זאת, את הגמישות של להיות מסוגל להציג מוטציות נוספות לתוך מוטציות מסומנות מפצה חלקית לכך, מאז פלסמידים נוספים המשךaining מגוון של קלטות המקנה עמידה לאנטיביוטיקה שונה, לא צריך להיות בנוי. למטרות מחקר היכולת להשתנות מספר רב של גנים היא לפעמים הכרחית על מנת לאפיין את התפקיד מתפקד במלואה של חלבונים. לדוגמא, זיהינו פנוטיפ מזיקה רק על מחיקה של שני כיורי אלקטרוני מונואמין המסוף המקומיים על קרום תילקואיד, מאז הפסד של רק אחד מהמתחמים אלה יכולים להיות מתוגמל על ידי פעילות של 14 אחרים. פיתוח של זן עבור יישומים תעשייתיים גם ידרוש שינויים מרובים זן, לא רק על דברי הקדמה של גנים זרים, אלא גם כדי להגביר את יעילות פוטוסינתטיים, אופטימיזציה קציר אור מחיקה של מסלולים מתחרים על המצע הרצוי. הגורם העיקרי המגביל את המהירות של דור מוטציה מסומן הפעם החלוקה האיטית של מינים כחוליות מודל, בין 8-20 שעות בהתאם לתנאי אור. בִּלתִידער עוצמות אור גבוהות ו -2 ריכוזי CO, צמיחה מהירה. עם זאת, קיים סיכון כי זנים מוטנטים אשר אינו יכול לסבול גם אור גבוה או CO 2 ייבחרו נגד, או כי זנים מוטנטים יעברו שינויים רצויים לפני אפיון פנוטיפי. לכן זה לא מומלץ. עם זאת, זה יהיה יתרון מאוד אם פרוטוקול מהיר יותר כדי ליצור מוטציות מסומנות פותחה. בסך הכל, זה יקל על הפיתוח של זנים הוא מחקר בסיסי ויישומי מיושם. זנים אלו יכולים לשמש עבור דלק ביולוגי, ביומסה או ייצור כימיקלים או בהבנת היבטים רבים של הביוכימיה כחוליות, גנטיקה ופיזיולוגיה.

כחוליות מהוות מערכה עתיקה ומגוונת אבולוציונית של חיידקים נמצאים כמעט בכל סביבה טבעית על פני כדור הארץ. בשנת מערכות אקולוגיות ימיות הם במיוחד שופע לשחק תפקיד מפתח במחזורים מזין רבים, והיוו כמחצית קיבוע פחמן 1, רוב קיבוע חנקן 2 ומאות מיליוני טונות של ייצור פחמימנים 3 באוקיינוסים בשנה. כלורופלסטים, אברון האחראי על הפוטוסינתזה אצות איקריוטיים וצמחים, צפויים התפתחו מתוך cyanobacterium כי נבלע על ידי הפונדקאי 4. כחוליות הוכיחו אורגניזמים מודל שימושי לחקר הפוטוסינתזה, אלקטרון התחבורה 5 ו הביוכימיים, שרבים מהם שמורים בצמחים. בשנת כחוליות בנוסף יותר ויותר בשימוש לייצור מזון, דלק ביולוגי 6, חשמל 7 ותעשייתיים תרכובות 8, בשל היי שלהםהמרה יעילה ghly מים ו- CO 2 עד ביומסה באמצעות אנרגיה סולארית 9. מינים רבים יכולים להיות מעובד על קרקע שאינה חקלאית עם חומרים מזינים מינימאליים ומי ים, דבר המצביע על כך כחוליות עלולים להיות מבוגרים בקנה מידה גדולה מבלי להשפיע ייצור חקלאי. מינים מסוימים הם גם מקורות של מוצרים טבעיים, כולל תרכובות נגד פטריות, אנטיבקטריאלי ואנטי סרטן 10,11. היכולת ליצור מוטציות היא מפתח להבנת פוטוסינתזה כחוליות, ביוכימיה ופיזיולוגיה, וחיוני להתפתחות של זנים למטרות תעשייתיות. רוב המחקרים שפורסמו גנרטור מהונדס גנטי זנים ידי החדרת קלטת עמידות לאנטיביוטיקה לתוך האתר של עניין. זה מגביל את מספר מוטציות יכולות להיות מוחדר זן, כמו שרק כמה קלטות עמידות לאנטיביוטיקה זמינות לשימוש כחוליות. זנים המכילים גנים המקנות מחדש אנטיביוטיsistance לא יכול לשמש לייצור תעשייתי בבריכות פתוחות, אשר צפוי להיות אמצעי היחיד החסכוני לייצר דלק ביולוגי ומוצרים בעלי ערך נמוך אחרים 12. הדור של מוטציות לא מסומנות מתגבר על מגבלות אלה. מוטציות לא מסומנות אינם מכילים דנ&quot;א זר, אלא אם כן נכלל בכוונה, וניתן לטפל מספר פעמים. לכן אפשר ליצור שינויים רבים ב זן כפי רצויות. בנוסף, תופעות קוטב על גנים במורד הזרם של אתר שינוי ניתן למזער, המאפשר שינוי מדויק יותר של האורגניזם 13. כדי ליצור זנים מוטנטים, פלסמידים התאבדות המכיל שני קטעי דנ&quot;א זהה אזורים בכרומוזום כחוליות איגוף הגן למחיקה (שמכונה 5 &#39;ו 3&#39; אזורי איגוף) בנויים ראשון. שני גנים ואז מוכנס בין אזורי איגוף אלה. אחד מהם מקודד חלבון עמידות לאנטיביוטיקה; השני מקודד SacB, אשר לדרבןuces levansucrase, תרכובת מקנה רגישה סוכרוז. בשלב הראשון של התהליך, מוטציות מסומנות, זנים כלומר המכילים כמה דנ&quot;א זר, נוצרות. הבונה פלסמיד הוא מעורבב עם התאים כחוליות והדנ&quot;א נלקח באופן טבעי על ידי האורגניזם. Transformants נבחר על ידי צמיחה על צלחות אגרו המכילות את אנטיביוטי המתאים ואת הגנוטיפ המוטציה מאומת על ידי PCR. פלסמידים התאבדות לא יכולים לשכפל בתוך הזן של עניין. לכן כל מושבות עמידות לאנטיביוטיקה תגרומנה מאירוע רקומבינציה לפיה הגן של עניין מוכנס לתוך הכרומוזום. כדי ליצור מוטציות לא מסומנות, המוטציה הניכרת הוא מעורב אז עם פלסמיד התאבדות נוסף שהכיל רק 5 &#39;ו 3&#39; אזורי האיגוף. עם זאת, אם החדרת דנ&quot;א זר נדרשה, פלסמיד המורכב של 5 &#39;ו 3&#39; איגוף אזורים עם קסטה המכילה את הגנים של העניין המוכנס בין קטעי דנ&quot;א אלה, ניתן להשתמש. Sele גודלction היא באמצעות צמיחה על צלחות אגר המכיל סוכרוז. כמו סוכרוז הוא קטלני לתאים כאשר מוצר גן sacB מתבטא, התאים היחידים ששורדים הם אלה שבם אירוע רקומבינציה שני התרחש, לפיה גן רגישות סוכרוז, בנוסף גן העמידות לאנטיביוטיקה, כבר recombined מתוך כרומוזום על פלסמיד. כתוצאה מכך של חילופי recombinational, אזורי האיגוף וכל DNA ביניהם מוכנסים לתוך כרומוזום. השתמשנו בהצלחה בשיטות אלה כדי ליצור מוטציות כרומוזומליות מרובות באותו הזן של Synechocystis sp. PCC6803 (להלן המכונה Synechocystis) 13,14, להציג מוטציות נקודה אחת לתוך גן של עניין 13 ו לביטוי של קלטות גן. בעוד הדור של knockouts המסומנת הודגם לפני עבודתנו Synechocystis 15,16, שיטה מפורטת, שנעזרמצגת ויזואלית של השלבים הקריטיים, הוא לא זמין לציבור. גם יש לנו ליישם אותה השיטה לייצור של knockouts ניכרה cyanobacterium מודל אחר, sp Synechococcus. PCC7002 (להלן המכונה Synechococcus). פרוטוקול זה מספק שיטה ברורה, פשוטה ליצירת מוטציות ובפרוטוקול מהיר על תיקוף ואחסון זנים אלה.

<table><tbody><tr><td>NaNO&lt;sub&gt;3&lt;/sub&gt;</td><td>Sigma</td><td>S5506</td><td></td></tr><tr><td>MgSO&lt;sub&gt;4&lt;/sub&gt;.7H&lt;sub&gt;2&lt;/sub&gt;O</td><td>Sigma</td><td>230391</td><td></td></tr><tr><td>CaCl&lt;sub&gt;2&lt;/sub&gt;</td><td>Sigma</td><td>C1016</td><td></td></tr><tr><td>citric acid</td><td>Sigma</td><td>C0759</td><td></td></tr><tr><td>Na&lt;sub&gt;2&lt;/sub&gt;EDTA</td><td>Fisher</td><td>EDT002</td><td></td></tr><tr><td>H&lt;sub&gt;3&lt;/sub&gt;BO&lt;sub&gt;3&lt;/sub&gt;</td><td>Sigma</td><td>339067</td><td></td></tr><tr><td>MnCl&lt;sub&gt;2&lt;/sub&gt;.4H&lt;sub&gt;2&lt;/sub&gt;O</td><td>Sigma</td><td>M3634</td><td></td></tr><tr><td>ZnSO&lt;sub&gt;4&lt;/sub&gt;.7H&lt;sub&gt;2&lt;/sub&gt;O</td><td>Sigma</td><td>Z4750</td><td></td></tr><tr><td>Na&lt;sub&gt;2&lt;/sub&gt;MoO&lt;sub&gt;4&lt;/sub&gt;.2H&lt;sub&gt;2&lt;/sub&gt;O</td><td>Sigma</td><td>331058</td><td></td></tr><tr><td>CuSO&lt;sub&gt;4&lt;/sub&gt;.5H&lt;sub&gt;2&lt;/sub&gt;O</td><td>Sigma</td><td>209198</td><td></td></tr><tr><td>Co(NO&lt;sub&gt;3&lt;/sub&gt;)&lt;sub&gt;2&lt;/sub&gt;.6H&lt;sub&gt;2&lt;/sub&gt;O</td><td>Sigma</td><td>239267</td><td></td></tr><tr><td>Ferric ammonium citrate</td><td>Sigma</td><td>F5879</td><td></td></tr><tr><td>K&lt;sub&gt;2&lt;/sub&gt;HPO&lt;sub&gt;4&lt;/sub&gt;</td><td>Sigma</td><td>P3786</td><td></td></tr><tr><td>Na&lt;sub&gt;2&lt;/sub&gt;CO&lt;sub&gt;3&lt;/sub&gt;</td><td>Fisher</td><td>SODC001</td><td></td></tr><tr><td>TES</td><td>Sigma</td><td>T1375</td><td></td></tr><tr><td>NaHCO&lt;sub&gt;3&lt;/sub&gt;</td><td>Fisher</td><td>SODH001</td><td></td></tr><tr><td>HEPES</td><td>Sigma</td><td>H3375</td><td></td></tr><tr><td>cyanocobalamin</td><td>Sigma</td><td>47869</td><td></td></tr><tr><td>Na&lt;sub&gt;2&lt;/sub&gt;S&lt;sub&gt;2&lt;/sub&gt;O&lt;sub&gt;3&lt;/sub&gt;</td><td>Sigma</td><td>72049</td><td></td></tr><tr><td>Bacto agar</td><td>BD</td><td>214010</td><td></td></tr><tr><td>Sucrose</td><td>Fisher</td><td>SUC001</td><td></td></tr><tr><td>Petri dish 90 mm triple vented</td><td>Greiner</td><td>633185</td><td></td></tr><tr><td>0.2 &amp;micro;m filters</td><td>Sartorius</td><td>16534</td><td></td></tr><tr><td>100 ml conical flasks</td><td>Pyrex</td><td>CON004</td><td></td></tr><tr><td>Parafilm M 100 mm x 38&amp;nbsp;m</td><td>Bemis</td><td>FIL003</td><td></td></tr><tr><td>Phusion high fidelity DNA polymerase&amp;nbsp;</td><td>Phusion</td><td>F-530</td><td></td></tr><tr><td>Agarose</td><td>Melford</td><td>MB1200</td><td></td></tr><tr><td>DNA purification kit&amp;nbsp;</td><td>MoBio</td><td>12100-300</td><td></td></tr><tr><td>Restriction endonucleases</td><td>NEB</td><td></td><td></td></tr><tr><td>T4 ligase</td><td>Thermo Scientific</td><td>EL0011</td><td></td></tr><tr><td>Luria Bertani broth</td><td>Invitrogen</td><td>12795-027</td><td></td></tr><tr><td>MES</td><td>Sigma</td><td>M8250</td><td></td></tr><tr><td>Kanamycin sulfate</td><td>Sigma</td><td>60615</td><td></td></tr><tr><td>Ampicillin</td><td>Sigma</td><td>A9518</td><td></td></tr><tr><td>GeneJET plasmid miniprep kit</td><td>Thermo Scientific</td><td>K0503</td><td></td></tr><tr><td>14 ml round-bottom tube</td><td>BD falcon</td><td>352059</td><td></td></tr><tr><td>GoTaq G2 Flexi DNA polymerase</td><td>Promega</td><td>M7805</td><td></td></tr><tr><td>425-600 &amp;micro;m glass beads</td><td>Sigma</td><td>G8772</td><td></td></tr><tr><td>Glycerol</td><td>Sigma</td><td>G5516</td><td></td></tr><tr><td>DMSO</td><td>Sigma</td><td>D8418</td><td></td></tr><tr><td>Fluorescent bulbs</td><td>Gro-Lux</td><td>69</td><td></td></tr><tr><td>HT multitron photobioreactor</td><td>Infors</td><td></td><td></td></tr></tbody></table>

generation of marked and markerless mutants in model cyanobacterial species

Cyanobacteria are ecologically important organisms and potential platforms for production of biofuels and useful industrial products. Genetic manipulation of cyanobacteria, especially model organisms such as Synechocystis sp. PCC6803 and Synechococcus sp. PCC7002, is a key tool for both basic and applied research. Generation of unmarked mutants, whereby chromosomal alterations are introduced into a strain via insertion of an antibiotic resistance cassette (a manipulatable fragment of DNA containing one or more genes), followed by subsequent removal of this cassette using a negative selectable marker, is a particularly powerful technique. Unmarked mutants can be repeatedly genetically manipulated, allowing as many alterations to be introduced into a strain as desired. In addition, the absence of genes encoding antibiotic resistance proteins in the mutated strain is desirable, as it avoids the possibility of 'escape' of antibiotic resistant organisms into the environment. However, detailed methods for repeated rounds of genetic manipulation of cyanobacteria are not well described in the scientific literature. Here we provide a comprehensive description of this technique, which we have successfully used to generate mutants with multiple deletions, single point mutations within a gene of interest and insertion of novel gene cassettes.

עיצוב פלסמיד הוא קריטי עבור דור מוצלח של שני מוטנטים מסומנים ולא מסומנים. איור 1 נותן דוגמא של פלסמיד ו- B השתמשו כדי ליצור מוטציה מחיקה בגני Synechocystis cpcC1 ו cpcC2 13. בכל מקרה 5 &#39;ו 3&#39; אזורי האיגוף כ 900-1,000 נ&quot;ב. אזורי איגוף מופחתים יכולים לשמש אף הקטן ביותר בהצלחה לנו trialed כבר כ -500 נ&quot;ב. פלסמיד B יכול להכיל גם קלטת גן בין 5 &#39;ו 3&#39; ~ 1 אזורי איגוף kb או גרסה שונה של רצף גן הילידים. <img alt="איור 2" src="/files/ftp_upload/54001/54001fig2highres.jpg" width="600" /> איור 2: אימות של מוטציות מסומנים ולא מסומנים, למשל cpcC1 / cpcC2 <sטרונג&gt; ב Synechocystis ו SYNPCC7002_A1173 ב Synechococcus. (א) הגודל הצפוי של wild-type Synechocystis (למעלה), לא מסומן (באמצע) בנוקאאוט המסומן (למטה) amplicons שנוצר באמצעות פריימרים cpcC1C2for ו cpcC1C2rev, כ 200 נ&quot;ב משני הצדים באזור כרומוזומליות למחיקה. (ב) הגודל הצפוי של (למעלה) wild-type Synechococcus ו בנוקאאוט מסומן (למטה) amplicons שנוצר באמצעות פריימרים A1173for ו A1173rev, כ 200 נ&quot;ב משני צדי באזור כרומוזומליות למחיקה. Amplicons Agarose מראה ג&#39;ל המופק (C) wild-type Synechocystis (מסלול 2), לא מסומן (מסלול 3) ומסומן cpcC1 / knockouts cpcC2 (מסלול 4) ו- (ד) wild-type Synechococcus (מסלול 6) ואת SYNPCC7002_A1173 נכרתה נוקאאוט (מסלול 7). סמנים מוצגיםבמסלולים 1 ו 5. <a href="https://www-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/54001/54001fig2highres.jpg" target="_blank">אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.</a> עם הפיכתו של פלסמיד לתוך התאים, בדרך כלל כמה מאות מושבות תופענה על צלחת לאחר כ 7-10 ימים. מושבות הן &lt;1 מ&quot;מ קוטר ולא להגדיל את שטח בשבועות הקרובים. לכן זה קריטי להשתמש קיסם בקצה קהה להסיר את מושבת פס אותה על צלחת אגר BG11 + kanamycin טרי. כמחצית המושבות מפוספסים מחדש תגדלנה לאחר 4-6 ימים. אם הגנים הם שאינם חיוניים מוטציות להפגין צמיחה דומה זן פראי סוג תחת אור רציף של 20-40 μmol פוטונים מ -2 שניות -1 (מוטציות מונואמין מסוף למשל לאה-סמית et al., 2013 14) (איור 3), אז כל הכרומוזומים צריכים להכיל עותק של t<html> הוא npt1 / קלטת sacB מוכנס רצף, כפי שנקבע באמצעות PCR. אם גנים הם שאינם חיוניים מוטציות להפגין פנוטיפ צמיחה איטי תחת אור הרציף של 20-40 μmol פוטונים מ -2 שניות -1 (למשל phycobilisome מוטציות חסרות לאה-סמית et al., 2014 13) (איור 3), אז כמה סיבובים של מחדש נמרחו על צלחות אגרו BG11 עם כמויות גדלו בהדרגה של kanamycin חיוניים על מנת לקבל מוטציה מסומנת פרדה. לאחר מוטצית הפרדה מתקבלת זה צריך להיות מחדש מפוספס על צלחת אגר BG11 בתוספת kanamycin טרי על מנת להבטיח פרדה זו הושלמה. אם סבבי קווים מפוספסים חזרו לא לגרום פרדה המסומנת מוטציה אז הגן חיוני סביר להישרדות. איור 4 נותנים תיאור הכללי של הצעדים הניסיוניים המעורבים דור מוטציה לא מסומן. <html> /54001/54001fig3highres.jpg &quot;Width =&quot; 700 &quot;/&gt; איור 3:. צמיחה של מוטציות Synechocystis דוגמאות של מוטציות שיש בהם כדי להעיד (א) צמיחה דומה wild-type ו- (ב) צמיחה איטית יותר מאשר wild-type. מוטצית ΔCOX חסרת מונואמין ציטוכרום בשל מחיקה של גני CtaC1D1E1. מוטצית ΔCyd חסרת מונואמין quinol בשל מחיקה של גני CydAB. מוטצית הזית חסרת חלק phycobilisome בשל מחיקה של גני CpcABC1C2D. דוגמאות (ב &#39;) היו מבעבעות עם אוויר כדי להקל על צמיחה. לשחזרו מנתונים שפורסמו ב לאה-סמית et al, 2013 14 ו 2014 13 (www.plantphysiol.org; האגודה האמריקאית זכויות יוצרים של הצמח ביולוגים).. <a href="https://www-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/54001/54001fig3highres.jpg" target="_blank">אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.</a> EP-together.within-page = &quot;1&quot;&gt; הדור של מוטנטים מסומנים הוא יעיל ביותר. עם טרנספורמציה של פלסמיד B לתוך מוטציה ניכרת, תקופת דגירה של ארבעה ימים ציפוי שלאחר מכן על צלחות אגר BG11 בתוספת סוכרוז, מאות מושבות מתקבלים לכל 1-10 μl של ההשעיה תא טרנספורמציה. עם זאת סדרה של דילולים צריך להיות trialed, החל 0.1 ל 100 μl, כסכום מופרז גורם לריכוז מופחת של סוכרוז לכל תא, וכתוצאה מכך מבחר מועט עבור מוטציות לא מסומנות. אם דשא של תאים נתפס על הצלחת כולה אז ריכוזים נמוכים צריכים להישפט. לאחר מושבות בודדות מתקבלות על צלחות, תיקון על BG11 בתוספת סוכרוז BG11 בתוספת kanamycin צלחות אגרו היא מהווה נדבך חיוני. בדרך כלל עבור מוטציות מסומנות שם אזור של כרומוזום מתבצע מחיקה, רוב המושבות יהיה kanamycin רגיש סוכרוז עמיד. הגברת PCR של אזור היעד במושבות הללו מראה כי כמעט 100% להדגים את UNMarked פרופיל מוטציה, למשל איור 2. אם קלטת גן להיות מוכנסת לתוך כרומוזום אז בדרך כלל אחוז גבוה יותר של kanamycin עמיד מושבות עמידות סוכרוז הם נצפו. מוטציות אלה יכולים לגדול על סוכרוז עקב מוטציה בגן sacB. אם אין מושבות עמידות רגישות סוכרוז kanamycin נוצרות אז קלטת הגנים מזיקה התא. <img alt="איור 4" src="/files/ftp_upload/54001/54001fig4highres.jpg" width="700" /> איור 4: דור של מוטציות מסומנות לבדו Synechocystis סכמטי (א) המפרט רקומבינציה ו (ב) פעולות ניסיון מעורבות דור מוטציה.. פלסמיד א &#39;מעורבת ראשונה עם תאים. לאחר דגירה על צלחות אגר המכיל kanamycin, מושבות שבהן אירוע רקומבינציה מתרחשת בין 5 &#39;ד 3 &#39;איגוף אזורים (מסומן בכחול ואדום, בהתאמה) ואת הרצף ההומולוגי כרומוזום, הם מבודדים. בנוסף, npt1 / קלטת sacB בין 5 &#39;ו 3&#39; אזורי איגוף מוכנסת לתוך הכרומוזום. בעקבות הפרדה מוטציה ניכרת נוצרת. תאי מוטנטים מסומנים הם מכן מעורבבים עם B פלסמיד אשר יכולה להכיל (C) 1: 5 &#39;ו 3&#39; אזורי האיגוף; 2: 5 &#39;ו 3&#39; איגוף אזורים עם קלטת ביטוי המכיל את הגנים של עניין מוכנס בין רצפים אלה; 3: 5 &#39;ו 3&#39; איגוף אזורים עם רצף wild-type בשינויים נוקלאוטיד הרצויים המוכנסים בין רצפים אלה. אירוע רקומבינציה הומולוגי שני מתרחש בין 5 &#39;ו 3&#39; אזורי איגוף ואת האזורים ההומולוגיים כרומוזום, וכתוצאה מכך הסרת קלטת npt1 / sacB ואו בנוקאאוט המסומנת או מוטציה עם כניסה או פרא-typ שינהדואר באזור מוחדר כרומוזום. <a href="https://www-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/54001/54001fig4highres.jpg" target="_blank">אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.</a> <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always" style=";text-align:right;direction:rtl"><tbody><tr><td> מתכוני פתרון במלאי </td><td></td></tr><tr><td> כִּימִי </td><td> הסכום (ז) </td></tr><tr><td> 100x BG11 (מחיר L) </td><td></td></tr><tr><td> ננו 3 </td><td> 149.6 </td></tr><tr><td> MgSO 4 .7H 2 O </td><td> 7.49 </td></tr><tr><td> CaCl 2 .2H 2 O </td><td> 3.6 </td></tr><tr><td> חוּמצַת לִימוֹן </td><td> 0.6 </td></tr><tr><td> להוסיף 1.12 מ&quot;ל 0.25 M Na 2 EDTA, pH 8.0 </td><td></td></tr><tr><td> 0.25 M Na 2 EDTA, pH 8.0 (ל -100 מ&quot;ל) </td><td></td></tr><tr><td> Na 2 </sub&gt; EDTA </td><td> 9.3 </td></tr><tr><td> יסודות קורט (מחיר 100 מ&quot;ל) </td><td></td></tr><tr><td> H 3 BO 3 </td><td> .286 </td></tr><tr><td> MnCl 2 .4H 2 O </td><td> .181 </td></tr><tr><td> ZnSO 4 .7H 2 O </td><td> 0.022 </td></tr><tr><td> Na 2 Moo 4 .2H 2 O </td><td> 0.039 </td></tr><tr><td> CuSO 4 .5H 2 O </td><td> 0.008 </td></tr><tr><td> Co (NO 3) 2 .6H 2 O </td><td> 0.005 </td></tr><tr><td> מגהץ המניה (מחיר 100 מ&quot;ל) </td><td></td></tr><tr><td> ציטרט אמוניום Ferric </td><td> 1.11 </td></tr><tr><td> מניית פוספט (מחיר 100 מיליליטר) </td><td></td></tr><tr><td> K 2 HPO 4 </td><td> 3.05 </td></tr><tr><td> Na 2 CO 3 מניות (מחיר 100 מ&quot;ל) </td&gt; <td></td></tr><tr><td> Na 2 CO 3 </td><td> 2 </td></tr><tr><td> חיץ TES, pH 8.2 (ל -100 מ&quot;ל) </td><td></td></tr><tr><td> TES </td><td> 22.9 </td></tr><tr><td> NaHCO 3 מניות (מחיר 100 מ&quot;ל) </td><td></td></tr><tr><td> NaHCO 3 </td><td> 8.4 </td></tr><tr><td> HEPES, pH 8.2 (מחיר 500 מ&quot;ל) </td><td></td></tr><tr><td> HEPES </td><td> 119.15 </td></tr><tr><td> ויטמין B 12 (לפי 50 מ&quot;ל) </td><td></td></tr><tr><td> cyanocobalamin </td><td> 0.02 </td></tr><tr><td> לוריא Bertani התקשורת (לפי 500 מ&quot;ל) </td><td></td></tr><tr><td> לוריא Bertani מרק </td><td> 12.5 </td></tr><tr><td> 1 M MgCl 2 (ל -100 מ&quot;ל) </td><td></td></tr><tr><td> MgCl 2 .6H 2 O </td><td> 20.33 </td></tr><tr&gt; <td> פתרון (מחיר 200 מ&quot;ל) </td><td></td></tr><tr><td> MnCl 2 .4H 2 O </td><td> .395 </td></tr><tr><td> CaCl 2 .2H 2 O </td><td> 1.47 </td></tr><tr><td> 2- (N -Morpholino) מימה חומצה ethanesulfonic, חומצה 4-Morpholineethanesulfonic (MES) </td><td> .4265 </td></tr><tr><td> גליצרול פתרון A + </td><td></td></tr><tr><td> 10 מ&quot;ל פתרון </td><td></td></tr><tr><td> 1.5 מ&quot;ל גליצרול </td><td></td></tr></tbody></table> טבלה 1: פתרונות המשמשים במחקר זה. <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always" style=";text-align:right;direction:rtl"><tbody><tr><td> תֶחֶל </td><td> סדר פעולות </td></tr><tr><td> cpcC1C2leftfor </td><td> GTAC TCTAGA GCGGCTAAATGCTACGAC </td></tr><tr><td> CPCC1C2leftrev </td><td> GATC GGATCC GCGGTAATTGTTCCCTTTGA </td></tr><tr><td> cpcC1C2rightfor </td><td> GATC GAGCTC TGCACTGGTCAGTCGTTC </td></tr><tr><td> cpcC1C2rightrev </td><td> GACT GAATTC ATCGTTGCTTGAACGGTCTC </td></tr><tr><td> קדימה M13 </td><td> TGTAAAACGACGGCCAGT </td></tr><tr><td> הפוך M13 </td><td> CAGGAAACAGCTATGAC </td></tr><tr><td> cpcC1C2for </td><td> GTTTTCATTGGCATCGGTCT </td></tr><tr><td> cpcC1C2rev </td><td> ATGTCCCAGGAACGACTGAC </td></tr><tr><td> A1173for </td><td> AGCAAACCGTTTTTGTGACC </td></tr><tr><td> A1173rev </td><td> TGCAAGGTGGCGAACTGTAT </td></tr></tbody></table> טבלה 2:. Primers השתמש במחקר זה באתרי endonuclease ההגבלה מודגשים.

Watch this Scientific Journal Video about Generation of Marked and Markerless Mutants in Model Cyanobacterial Species at JoVE.com

Generation of Marked and Markerless Mutants in Model Cyanobacterial Species

Introducing multiple genomic alterations into cyanobacteria is an essential tool in the development of strains for industrial and basic research purposes. We describe a system for generating unmarked mutants in the model cyanobacterial species Synechocystis sp. PCC6803 and marked mutants in Synechococcus sp. PCC7002.

הדור של מסומנים מוטאנטים Markerless במודל כחוליות המינים

Cyanobacteria are ecologically important organisms and potential platforms for production of biofuels and useful industrial products. Genetic manipulation ...

generation-marked-markerless-mutants-model-cyanobacterial

Universidad San Sebastian

Research

JoVE Journal

Biology

11.9K Views.  University of Cambridge. Introducing multiple genomic alterations into cyanobacteria is an essential tool in the development of strains for industrial and basic research purposes. We describe a system for generating unmarked mutants in the model cyanobacterial species Synechocystis sp. PCC6803 and marked mutants in Synechococcus sp. PCC7002.

Video: Generation of Marked and Markerless Mutants in Model Cyanobacterial Species

Optogenetic Random Mutagenesis Using Histone-miniSOG in C. elegans

Forward genetic screening in model organisms is the workhorse to discover functionally important genes and pathways in many biological processes. In most mutagenesis-based screens, researchers have relied on the use of toxic chemicals, carcinogens, or irradiation, which requires designated equipment, safety setup, and/or disposal of hazardous materials. We have developed a simple approach to induce heritable mutations in C. elegans using germline-expressed histone-miniSOG, a light-inducible potent generator of reactive oxygen species. This mutagenesis method is free of toxic chemicals and requires minimal laboratory safety and waste management. The induced DNA modifications include single-nucleotide changes and small deletions, and complement those caused by classical chemical mutagenesis. This methodology can also be used to induce integration of extrachromosomal transgenes. Here, we provide the details of the LED setup and protocols for standard mutagenesis and transgene integration.

Optogenetic Random Mutagenesis Using Histone-miniSOG in C. elegans

Genetically-encoded histone-miniSOG induces genome-wide heritable mutations in a blue&#160;light-dependent manner. This mutagenesis method is simple, fast, free of toxic chemicals, and well-suited for forward genetic screening and transgene integration.

Optogenetic mutagenesis אקראי באמצעות היסטון-miniSOG ב<em&gt; C. elegans</em

Forward genetic screening in model organisms is the workhorse to discover functionally important genes and pathways in many biological processes. In most ...

Genetics

High-Throughput Robotically Assisted Isolation of Temperature-sensitive Lethal Mutants in Chlamydomonas reinhardtii

Systematic identification and characterization of genetic perturbations have proven useful to decipher gene function and cellular pathways. However, the conventional approaches of permanent gene deletion cannot be applied to essential genes. We have pioneered a unique collection of ~70 temperature-sensitive (ts) lethal mutants for studying cell cycle regulation in the unicellular green algae Chlamydomonas reinhardtii1. These mutations identify essential genes, and the ts alleles can be conditionally inactivated by temperature shift, providing valuable tools to identify and analyze essential functions. Mutant collections are much more valuable if they are close to comprehensive, since scattershot collections can miss important components. However, this requires the efficient collection of a large number of mutants, especially in a wide-target screen. Here, we describe a robotics-based pipeline for generating ts lethal mutants and analyzing their phenotype in Chlamydomonas. This technique can be applied to any microorganism that grows on agar. We have collected over 3000 ts mutants, probably including mutations in most or all cell-essential pathways, including about 200 new candidate cell cycle mutations. Subsequent molecular and cellular characterization of these mutants should provide new insights in plant cell biology; a comprehensive mutant collection is an essential prerequisite to ensure coverage of a broad range of biological pathways. These methods are integrated with downstream genetics and bioinformatics procedures for efficient mapping and identification of the causative mutations that are beyond the scope of this manuscript.

High-Throughput Robotically Assisted Isolation of Temperature-sensitive Lethal Mutants in Chlamydomonas reinhardtii

Temperature-sensitive (ts) lethal mutants are valuable tools to identify and analyze essential functions. Here we describe methods to generate and classify ts lethal mutants in high throughput.

תפוקה גבוהה בידוד Assisted רובוטית של מוטאנטים קטלניים רגישים-טמפרטורה<em&gt; Chlamydomonas reinhardtii</em

Systematic identification and characterization of genetic perturbations have proven useful to decipher gene function and cellular pathways. However, the ...

Identifying Amino Acid Overproducers Using Rare-Codon-Rich Markers

To satisfy the ever-growing market for amino acids, high-performance production strains are needed. The amino acid overproducers are conventionally identified by harnessing the competitions between amino acids and their analogs. However, this analog-based method is of low accuracy, and proper analogs for specific amino acids are limited. Here, we present an alternative strategy that enables an accurate, sensitive, and high-throughput screening of amino acid overproducers using rare-codon-rich markers. This strategy is inspired by the phenomenon of codon usage bias in protein translation, for which codons are categorized into common or rare ones based on their frequencies of occurrence in the coding DNA. The translation of rare codons depends on their corresponding rare transfer RNAs (tRNAs), which cannot be fully charged by the cognate amino acids under starvation. Theoretically, the rare tRNAs can be charged if there is a surplus of the amino acids after charging the synonymous common isoacceptors. Therefore, retarded translations caused by rare codons could be restored by feeding or intracellular overproductions of the corresponding amino acids. Under this assumption, a selection or screening system for identifying amino acid overproducers is established by replacing the common codons of the targeted amino acids with their synonymous rare alternatives in the antibiotic resistance genes or the genes encoding fluorescent or chromogenic proteins. We show that the protein expressions can be greatly hindered by the incorporation of rare codons and that the levels of proteins correlate positively with the amino acid concentrations. Using this system, overproducers of multiple amino acids can be readily screened out from mutation libraries. This rare-codon-based strategy only requires a single modified gene, and the host is less likely to escape the selection than in other methods. It offers an alternative approach for obtaining amino acid overproducers.

This study presents an alternative strategy to the conventional toxic analog-based method in identifying amino acid overproducers by using rare-codon-rich markers to achieve accuracy, sensitivity, and high-throughput simultaneously.

זיהוי חומצת אמינו מפיקי יתר באמצעות נדירים-Codon-מסמנים עשירים

To satisfy the ever-growing market for amino acids, high-performance production strains are needed. The amino acid overproducers are conventionally ...

Biochemistry

Visual and Microscopic Evaluation of Streptomyces Developmental Mutants

Streptomycetes are filamentous soil bacteria belonging to the phylum Actinobacteria that are found throughout the world and produce a wide array of antibiotics and other secondary metabolites. Streptomyces coelicolor is a well-characterized, non-pathogenic species that is amenable to a variety of analyses in the lab. The phenotyping methods described here use S. coelicolor as a model streptomycete; however, the methods are applicable to all members of this large genus as well as some closely related actinomycetes. Phenotyping is necessary to characterize new species of Streptomyces identified in the environment, and it is also a vital first step in characterizing newly isolated mutant strains of Streptomyces. Proficiency in phenotyping is important for the many new researchers who are entering the field of Streptomyces research, which includes the study of bacterial development, cell division, chromosome segregation, and second messenger signaling. The recent crowdsourcing of antibiotic discovery through the isolation of new soil microbes has resulted in an increased need for training in phenotyping for instructors new to the field of Streptomyces research and their college or high school students. This manuscript describes methods for bacterial strain propagation, storage, and characterization through visual and microscopic examination. After reading this article, new researchers (microbiology education laboratories and citizen scientists) should be able to manipulate Streptomyces strains and begin visual characterization experiments.

Visual and Microscopic Evaluation of Streptomyces Developmental Mutants

Here we present protocols for novice researchers to initiate phenotyping for the pharmacologically important bacterial genus Streptomyces.

הערכות חזותי מיקרוסקופיים של מוטציות התפתחותית Streptomyces

Streptomycetes are filamentous soil bacteria belonging to the phylum Actinobacteria that are found throughout the world and produce a wide array of ...

Immunology and Infection

Live-Cell Forward Genetic Approach to Identify and Isolate Developmental Mutants in Chlamydia trachomatis

The intracellular bacterial pathogen Chlamydia trachomatis undergoes a developmental cycle consisting of two morphologically discrete developmental forms. The non-replicative elementary body (EB) initiates infection of the host. Once inside, the EB differentiates into the reticulate body (RB). The RB then undergoes multiple rounds of replication, before differentiating back to the infectious EB form. This cycle is essential for chlamydial survival as failure to switch between cell types prevents either host invasion or replication.
Limitations in genetic techniques due to the obligate intracellular nature of Chlamydia have hampered identification of the molecular mechanisms involved in the cell-type development. We designed a novel dual promoter-reporter plasmid system that, in conjunction with live-cell microscopy, allows for the visualization of cell type switching in real time. To identify genes involved in the regulation of cell-type development, the live-cell promoter-reporter system was leveraged for the development of a forward genetic approach by combining chemical mutagenesis of the dual reporter strain, imaging and tracking of Chlamydia with altered developmental kinetics, followed by clonal isolation of mutants. This forward genetic workflow is a flexible tool that can be modified for directed interrogation into a wide range of genetic pathways.

Live-Cell Forward Genetic Approach to Identify and Isolate Developmental Mutants in Chlamydia trachomatis

This protocol utilizes fluorescent promoter-reporters, live-cell microscopy, and individual inclusion extraction in a directed forward genetic approach to identify and isolate developmental mutants of Chlamydia trachomatis.

גישה גנטית חיה-תא קדימה לזהות ולבודד מוטנטים התפתחותיים ב trachomatis כלמידיה

The intracellular bacterial pathogen Chlamydia trachomatis undergoes a developmental cycle consisting of two morphologically discrete developmental forms. ...

שילוב גנים יציב בכלורלה וולגריס באמצעות Agrobacterium tumefaciens

Agrobacterium tumefaciens-Mediated Genetic Engineering of Green Microalgae, Chlorella vulgaris

Agrobacterium tumefaciens-mediated transformation (AMT) serves as a widely employed tool for manipulating plant genomes. However, A. tumefaciens exhibit the capacity for gene transfer to a diverse array of species. Numerous microalgae species lack well-established methods for reliably integrating genes of interest into their nuclear genome. To harness the potential benefits of microalgal biotechnology, simple and efficient genome manipulation tools are crucial. Herein, an optimized AMT protocol is presented for the industrial microalgae species Chlorella vulgaris, utilizing the reporter green fluorescent protein (mGFP5) and the antibiotic resistance marker for Hygromycin B. Mutants are selected through plating on Tris-Acetate-Phosphate (TAP) media containing Hygromycin B and cefotaxime. Expression of mGFP5 is quantified via fluorescence after over ten generations of subculturing, indicating the stable transformation of the T-DNA cassette. This protocol allows for the reliable generation of multiple transgenic C. vulgaris colonies in under two weeks, employing the commercially available pCAMBIA1302 plant expression vector.

Author Spotlight: פרוטוקול טרנספורמציה ממוטב עבור Chlorella vulgaris באמצעות Agrobacterium tumefaciens 

This protocol outlines the utilization of Agrobacterium tumefaciens-mediated transformation (AMT) for integrating gene(s) of interest into the nuclear genome of the green microalgae Chlorella vulgaris, leading to the production of stable transformants.

Agrobacterium tumefaciens-מתווך גנטי של מיקרו-אצות ירוקות, Chlorella vulgaris

Agrobacterium tumefaciens-mediated transformation (AMT) serves as a widely employed tool for manipulating plant genomes. However, A. tumefaciens exhibit ...

Bioengineering

Generation of Null Mutants to Elucidate the Role of Bacterial Glycosyltransferases in Bacterial Motility

The study of glycosylation in prokaryotes is a rapidly growing area. Bacteria harbor different glycosylated structures on their surface whose glycans constitute a strain-specific barcode. The associated glycans show higher diversity in sugar composition and structure than those of eukaryotes and are important in bacterial-host recognition processes and interaction with the environment. In pathogenic bacteria, glycoproteins have been involved in different stages of the infectious process, and glycan modifications can interfere with specific functions of glycoproteins. However, despite the advances made in the understanding of glycan composition, structure, and biosynthesis pathways, understanding of the role of glycoproteins in pathogenicity or interaction with the environment remains very limited. Furthermore, in some bacteria, the enzymes required for protein glycosylation are shared with other polysaccharide biosynthetic pathways, such as lipopolysaccharide and capsule biosynthetic pathways. The functional importance of glycosylation has been elucidated in several bacteria through mutation of specific genes thought to be involved in the glycosylation process and the study of its impact on the expression of the target glycoprotein and the modifying glycan. Mesophilic Aeromonas have a single and O-glycosylated polar flagellum. Flagellar glycans show diversity in carbohydrate composition and chain length between Aeromonas strains. However, all strains analyzed to date show a pseudaminic acid derivative as the linking sugar that modifies serine or threonine residues. The pseudaminic acid derivative is required for polar flagella assembly, and its loss has an impact on adhesion, biofilm formation, and colonization. The protocol detailed in this article describes how the construction of null mutants can be used to understand the involvement of genes or genome regions containing putative glycosyltransferases in the biosynthesis of a flagellar glycan. This includes the potential to understand the function of the glycosyltransferases involved and the role of the glycan. This will be achieved by comparing the glycan deficient mutant to the wild-type strain.

Here, we describe the construction of null mutants of Aeromonas in specific glycosyltransferases or regions containing glycosyltransferases, the motility assays, and flagella purification performed to establish the involvement and function of their encoded enzymes in the biosynthesis of a glycan, as well as the role of this glycan in bacterial pathogenesis.

יצירת מוטציות ריקות כדי להבהיר את תפקידם של גליקוזילטרנספראזות חיידקיות בתנועתיות חיידקית

The study of glycosylation in prokaryotes is a rapidly growing area. Bacteria harbor different glycosylated structures on their surface whose glycans ...

Monitoring Intraspecies Competition in a Bacterial Cell Population by Cocultivation of Fluorescently Labelled Strains

Many microorganisms such as bacteria proliferate extremely fast and the populations may reach high cell densities. Small fractions of cells in a population always have accumulated mutations that are either detrimental or beneficial for the cell. If the fitness effect of a mutation provides the subpopulation with a strong selective growth advantage, the individuals of this subpopulation may rapidly outcompete and even completely eliminate their immediate fellows. Thus, small genetic changes and selection-driven accumulation of cells that have acquired beneficial mutations may lead to a complete shift of the genotype of a cell population. Here we present a procedure to monitor the rapid clonal expansion and elimination of beneficial and detrimental mutations, respectively, in a bacterial cell population over time by cocultivation of fluorescently labeled individuals of the Gram-positive model bacterium Bacillus subtilis. The method is easy to perform and very illustrative to display intraspecies competition among the individuals in a bacterial cell population.

Bacteria may accumulate either detrimental or beneficial mutations during their lifetime. In a population of cells individuals that have accumulated beneficial mutations may rapidly outcompete their fellows. Here we present a simple procedure to visualize intraspecies competition in a bacterial cell population over time using fluorescently labeled individuals.&#160;

הדור של מסומנים מוטאנטים Markerless במודל כחוליות המינים

Summary

Explore More Videos

Chapters in this video

Optogenetic mutagenesis אקראי באמצעות היסטון-miniSOG ב

תפוקה גבוהה בידוד Assisted רובוטית של מוטאנטים קטלניים רגישים-טמפרטורה

זיהוי חומצת אמינו מפיקי יתר באמצעות נדירים-Codon-מסמנים עשירים

הערכות חזותי מיקרוסקופיים של מוטציות התפתחותית Streptomyces

גישה גנטית חיה-תא קדימה לזהות ולבודד מוטנטים התפתחותיים ב trachomatis כלמידיה

Agrobacterium tumefaciens-מתווך גנטי של מיקרו-אצות ירוקות, Chlorella vulgaris

Agrobacterium tumefaciens-מתווך גנטי של מיקרו-אצות ירוקות, Chlorella vulgaris

Agrobacterium tumefaciens-מתווך גנטי של מיקרו-אצות ירוקות, Chlorella vulgaris

יצירת מוטציות ריקות כדי להבהיר את תפקידם של גליקוזילטרנספראזות חיידקיות בתנועתיות חיידקית

ניטור תחרות תוך-מין באוכלוסיית תאים חיידקיים על ידי Cocultivation של זנים שכותרתו פלואורסצנטית