Name: combining x-ray crystallography with small angle x-ray scattering to model unstructured regions of nsa1 from s. cerevisiae
Uploaded: 2018-01-10T15:00:00.000+00:00
Duration: 9 min 15 s
Description: Watch this Scientific Journal Video about Combining X-Ray Crystallography with Small Angle X-Ray Scattering to Model Unstructured Regions of Nsa1 from S. Cerevisiae at JoVE.com

Beugung im Südosten regionale kooperative Zugriffsteam (SER-CAT) 22-ID und 22-BM Beamlines an der Advanced Photon Source (APS), Argonne National Laboratory Daten. Die SAXS Daten wurden auf die SIBYLLEN Strahlrohr im Voraus Licht Quelle (ALS), Lawrence Berkeley National Laboratory. Wir möchten den Mitarbeitern bei der SIBYLLEN Strahlrohr für ihre Hilfe bei remote-Datenerfassung und-Verarbeitung danken. Wir sind dankbar für die National Institute of Environmental Health Sciences (NIEHS) Mass Spectrometry Forschung und Selbsthilfegruppe für Hilfe bei der Bestimmung der Protein-Domänengrenzen. Diese Arbeit wurde durch das uns nationale Institute der Gesundheit intramuralen Forschungsprogramm unterstützt; US National Institute of Environmental Health Sciences (NIEHS) (ZIA ES103247, R. E. S.) und den kanadischen Institutes of Health Research (CIHR, 146626, M.C.P). Verwendung der APS wurde unterstützt durch das US Department of Energy, Office of Science, Büro der grundlegenden Energiewissenschaften unter Vertragsnr. W-31-109-DEU-38. Verwendung von Advanced Light Source (ALS) wurde unterstützt durch die Direktor des Office of Science, Büro von Energie Grundlagenwissenschaften, des US-Department of Energy unter Vertragsnr. DE-AC02-05CH11231. Zusätzlicher Unterstützung für die SIBYLLEN SAXS Strahlrohr kommt aus dem National Institute of Health Projekt MINOS (R01GM105404) und eine High-End-Instrumentierung Grant S10OD018483. Wir möchten auch Danke Andrea Moon und Dr. Sara Andres für ihre kritischen Lektüre des Manuskripts.

Die Autoren haben nichts preisgeben.

Unter Verwendung dieses Protokolls, wurde rekombinante Nsa1 aus S. Cerevisiae für strukturelle Studien durch Röntgen-Kristallographie und SAXS generiert. Nsa1 war brav in Lösung und in mehreren Kristallformen kristallisiert. Bei der Optimierung dieser Kristalle entdeckte man, dass der C-Terminus des Nsa1 empfindlich auf Protease-Abbau war. Die hohe Auflösung, orthorhombic Kristallform konnte nur mit C-terminale abschneiden Varianten der Nsa1, wahrscheinlich dupliziert werden, weil der flexible C-Terminus des...

Ribosomen sind große Ribonucleoprotein Maschinen, die die wesentliche Rolle der Übersetzung von mRNA in Proteine in allen lebenden Zellen durchführen. Ribosomen bestehen aus zwei Untereinheiten, die in einem aufwändigen Verfahren bezeichnet Ribosom Biogenese1,2,3,4hergestellt werden. Eukaryotische Ribosom Versammlung stützt sich auf die Hilfe von Hunderten von wesentlichen ribosomale Montage Faktoren2,3,5. Nsa1 (Nop7 verbunden 1) ist ein eukaryotische Ribosom Versammlung-Faktor, der speziell für die Produktion der großen ribosomalen Untereinheit6erforderlich ist, und ist bekannt als WD-Wiederholung, 74 (WDR74) in höheren Organismen7enthält. WDR74 hat gezeigt, dass für die Blastozyste Bildung in Mäusen8erforderlich und der WDR74-Promoter ist häufig in Krebs Zellen9mutiert. Die Funktion und die genauen Mechanismen der Nsa1/WDR74 im Ribosom Versammlung sind jedoch noch weitgehend unbekannt. Um zu beginnen, die Rolle der Nsa1/WDR74 während der Reifung eukaryotische Ribosom aufzudecken, wurden mehrere strukturelle Analysen durchgeführt, einschließlich Röntgen-Kristallographie und kleinen Winkel x-ray Scattering (SAXS)10.
Röntgen-Kristallographie, Kernresonanzspektroskopie (NMR), Elektronenmikroskopie und SAXS sind alle wichtigen Techniken für makromolekulare Struktur zu studieren. Größe, Form, Verfügbarkeit und Stabilität der Makromoleküle Einflüsse der Strukturbiologie Methode, für die ein bestimmtes Makromolekül wird am besten sein, geeignet, jedoch kombiniert mehrere Techniken durch einen sogenannten "Hybrid"-Ansatz ist immer ein immer vorteilhaft Werkzeug11. Insbesondere sind Röntgen-Kristallographie und SAXS kraftvoll und ergänzende Methoden zur Strukturaufklärung von Makromolekülen12.
Kristallographie bietet hochauflösende atomare Strukturen von kleinen Molekülen bis hin zu großen zellulären Maschinerie wie das Ribosom und führte zu zahlreichen Durchbrüchen in das Verständnis der biologischen Funktionen von Proteinen und anderen Makromoleküle13. Darüber hinaus nutzt Struktur basierende Wirkstoff-Design die Kraft der Kristallstrukturen zum molekularen Andocken von Berechnungsmethoden, Droge-Entdeckung und Entwicklung14eine kritische Dimension hinzuzufügen. Trotz seiner breiten Anwendbarkeit sind flexibel und ungeordneten Systeme schwer zu beurteilen von Kristallographie da Kristall Verpackung behindert kann oder Elektron Dichte Karten möglicherweise unvollständig oder von schlechter Qualität. Umgekehrt ist SAXS ein lösungsorientierter und mit niedriger Auflösung struktureller Ansatz in der Lage, flexible Systeme, die ungeordneten Schlingen und Termini bis hin zu intrinsisch ungeordneten Proteine12,15,16, zu beschreiben. Wenn man bedenkt, dass es kompatibel mit einer breiten Palette von Teilchen Größen12, kann SAXS synergistisch arbeiten mit Kristallographie, biologische Fragestellungen erweitert, die durch strukturelle Studien behandelt werden können.
Nsa1 eignet sich für ein Hybrid-strukturellen Ansatz, denn es enthält eine gut strukturierte WD40 Domäne gefolgt von einer funktionalen, aber flexible C-Terminus nicht Röntgen-Kristallographie Methoden zugänglich ist. Es folgt ein Protokoll für das Klonen, Ausdruck und Reinigung von S. Cerevisiae Nsa1 für Hybrid Strukturaufklärung durch Röntgen-Kristallographie und SAXS. Dieses Protokoll kann angepasst werden, um die Strukturen von anderen Proteinen zu studieren, die aus einer Kombination von geordneten und ungeordneten Regionen bestehen.

<table><tbody><tr><td>&lt;strong&gt;Molecular Cloning of Nsa1&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>pMBP2 parallel vector</td><td>Sheffield et al, Protein Expression and Purification 15, 34-39 (1999)</td><td></td><td>We used a modified version of pMBP2 which included an N-terminal His-tag (pHMBP)</td></tr><tr><td>S. cerevisiae genomic DNA</td><td>ATCC</td><td>204508D-5</td><td></td></tr><tr><td>&lt;strong&gt;Primers for cloning Nsa1&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>SC_Nsa1_FLFw</td><td>IDT</td><td></td><td>CGC CAA AGG CCT&lt;br/&gt; ATGAGGTTACTAGTCAGCTGTGT&lt;br/&gt; GGATAG</td></tr><tr><td>SC_Nsa1_FLRv</td><td>IDT</td><td></td><td>AATGCAGCGGCCGCTCAAATTTT&lt;br/&gt; GCTTTTCTTACTGGCTTTAGAAGC&lt;br/&gt; AGC</td></tr><tr><td>SC_Nsa1_DeltaCFw</td><td>IDT</td><td></td><td>GGGCGCCATGGGATCCATGAGG&lt;br/&gt; TTACTAGTCAGCTGTGTGG</td></tr><tr><td>SC_Nsa1_DeltaCRv</td><td>IDT</td><td></td><td>GATTCGAAAGCGGCCGCTTAAAC&lt;br/&gt; CTTCCTTTTTTGCTTCCC</td></tr><tr><td>&lt;strong&gt;Recombinant Protein Production and Purification of Nsa1&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>Escherichia coli BL21 (DE3) Star Cells</td><td>Invitrogen</td><td>C601003</td><td></td></tr><tr><td>pMBP- NSA1 and various truncations</td><td>Lo et al., 2017</td><td></td><td></td></tr><tr><td>Selenomethionine</td><td>Molecular Dimensions</td><td>MD12-503B</td><td></td></tr><tr><td>IPTG, Dioxane-Free</td><td>Promega</td><td>V3953</td><td></td></tr><tr><td>EDTA Free Protease Inhibitor Cocktail</td><td>Sigma-Aldrich</td><td>4693159001</td><td></td></tr><tr><td>Sodium Chloride</td><td>Caledon Laboratory Chemicals</td><td>7560-1-80</td><td></td></tr><tr><td>Magnesium Chloride hexahydrate</td><td>Sigma-Aldrich</td><td>M2670</td><td></td></tr><tr><td>Tris Buffer, 1 M pH7.5</td><td>KD Medical</td><td>RGF-3340</td><td></td></tr><tr><td>Glycerol</td><td>Invitrogen</td><td>15514-029</td><td></td></tr><tr><td>beta-mercaptoethanol</td><td>Sigma</td><td>M6250</td><td></td></tr><tr><td>1M Imidazole, pH 8.0</td><td>Teknova</td><td>I6980-06</td><td></td></tr><tr><td>Talon Affinity Resin</td><td>Clonetech</td><td>635503</td><td></td></tr><tr><td>Amicon Ultra 15 mL Centrifugal Filter (MWCO 10K)</td><td>Millipore</td><td>UFC901024</td><td></td></tr><tr><td>HiLoad 16/600 Superdex 200 Prep Grade Gel Filtration Column</td><td>GE-Healthcare</td><td>28989335</td><td></td></tr><tr><td>TEV Protease</td><td>Prepared by NIEHS Protein Expression Core</td><td>Expression plasmid provided by NCI (Tropea et al. Methods Mol Biology, 2009)</td><td></td></tr><tr><td>4-15% Mini-PROTEAN TGX Precast Protein Gels</td><td>BioRad</td><td>456-8056</td><td></td></tr><tr><td>&lt;strong&gt;Crystallization, Proteolytic Screening&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>Crystal Screen</td><td>Hampton Research</td><td>HR2-110</td><td></td></tr><tr><td>Crystal Screen 2</td><td>Hampton Research</td><td>HR2-112</td><td></td></tr><tr><td>Salt Rx</td><td>Hampton Research</td><td>HR2-136</td><td></td></tr><tr><td>Index Screen</td><td>Hampton Research</td><td>HR2-144</td><td></td></tr><tr><td>PEG/Ion Screen</td><td>Hampton Research</td><td>HR2-139</td><td></td></tr><tr><td>JCSG+</td><td>Molecular Dimensions</td><td>MD1-37</td><td></td></tr><tr><td>Wizard Precipitant Synergy</td><td>Molecular Dimensions</td><td>MD15-PS-T</td><td></td></tr><tr><td>Swissci 96-well 3-drop UVP sitting drop plates</td><td>TTP Labtech</td><td>4150-05823</td><td></td></tr><tr><td>3inch Wide Crystal Clear Sealing Tape</td><td>Hampton Research</td><td>HR4-506</td><td></td></tr><tr><td>Proti-Ace Kit</td><td>Hampton Research</td><td>HR2-429</td><td></td></tr><tr><td>PEG 1500</td><td>Molecular Dimensions</td><td>MD2-100-6</td><td></td></tr><tr><td>PEG 400</td><td>Molecular Dimensions</td><td>MD2-100-3</td><td></td></tr><tr><td>HEPES/sodium hydroxide pH 7.5</td><td>Molecular Dimensions</td><td>MD2-011-</td><td></td></tr><tr><td>Sodium Citrate tribasic</td><td>Molecular Dimensions</td><td>MD2-100-127</td><td></td></tr><tr><td>22 mm x 0.22 mm Siliconized Coverslides</td><td>Hampton Research</td><td>HR3-231</td><td></td></tr><tr><td>24 Well Plates with sealant (VDX Plate with Sealant)</td><td>Hampton Research</td><td>HR3-172</td><td></td></tr><tr><td>18 mM Mounted Nylon Loops (0.05 mm to 0.5 mM)</td><td>Hampton Research</td><td>HR4-945, HR4-947, HR4-970, HR4-971</td><td></td></tr><tr><td>Seed Bead Kit</td><td>Hampton Research</td><td>HR2-320</td><td></td></tr><tr><td>Magnetic Crystal Caps</td><td>Hampton Research</td><td>HR4-779</td><td></td></tr><tr><td>Magnetic Cryo Wand</td><td>Hampton Research</td><td>HR4-729</td><td></td></tr><tr><td>Cryogenic Foam Dewar</td><td>Hampton Research</td><td>HR4-673</td><td></td></tr><tr><td>Crystal Puck System</td><td>MiTeGen</td><td>M-CP-111-021</td><td></td></tr><tr><td>Full Skirt 96 well Clear Plate</td><td>VWR</td><td>10011-228</td><td></td></tr><tr><td>AxyMat Sealing Mat</td><td>VWR</td><td>10011-130</td><td></td></tr><tr><td>&lt;strong&gt;Equipment&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>UVEX-m</td><td>JAN Scientific, Inc.</td><td></td><td></td></tr><tr><td>Nanodrop Lite Spectrophotometer</td><td>Thermo-Fisher</td><td></td><td></td></tr><tr><td>Mosquito Robot</td><td>TTP Labtech</td><td></td><td></td></tr><tr><td>&lt;strong&gt;Software/Websites&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>HKL2000</td><td>Otwinoski and Minor, 1997</td><td></td><td></td></tr><tr><td>Phenix</td><td>Adams et al., 2010</td><td></td><td></td></tr><tr><td>Coot</td><td>Emsley et al., 2010</td><td></td><td></td></tr><tr><td>ATSAS</td><td>Petoukhov et al., 2012</td><td></td><td>https://www.embl-hamburg.de/biosaxs/atsas-online/</td></tr><tr><td>Scatter</td><td>Rambo and Tainer, 2013</td><td></td><td></td></tr><tr><td>Pymol</td><td>The PyMOL Molecular Graphics System, Version 1.8 Schr&amp;ouml;dinger, LLC.</td><td></td><td></td></tr><tr><td>BUNCH</td><td>Petoukhov and Svergun, 2005</td><td></td><td></td></tr><tr><td>CRYSOL</td><td>Svergun et al, 1995</td><td></td><td></td></tr><tr><td>PRIMUS</td><td>Konarev et al, 2003</td><td></td><td></td></tr><tr><td>EOM</td><td>Tria et al, 2015</td><td></td><td></td></tr></tbody></table>

combining x-ray crystallography with small angle x-ray scattering to model unstructured regions of nsa1 from s. cerevisiae

Bestimmung der Struktur der Ribosom Versammlung Faktor Nsa1 von Saccharomyces Cerevisiae (S. Cerevisiae) in voller Länge ist schwierig wegen der ungeordneten und Protease labil C-Terminus des Proteins. Dieses Manuskript beschreibt die Methoden um rekombinante Nsa1 aus S. Cerevisiae für Baustatik durch Röntgen-Kristallographie und SAXS zu reinigen. Röntgen-Kristallographie wurde eingesetzt, um die Struktur der wohlgeordneten WD40 N-terminale Domäne des Nsa1 zu lösen, und dann SAXS wurde verwendet, um die Struktur des C-Terminus des Nsa1 in Lösung zu beheben. Lösung Streuung Daten wurden von in voller Länge Nsa1 in Lösung. Die theoretische Streuung Amplituden wurden von der hochauflösenden Kristallstruktur des Geschäftsfeldes WD40 berechnet, und dann offenbart eine Kombination des steifen Körpers und ab-initio -Modellierung der C-Terminus des Nsa1. Durch diesen Hybridansatz wurde die quartäre Struktur des gesamten Proteins rekonstruiert. Die hier vorgestellten Methoden sollten in der Regel für die Hybrid-Strukturaufklärung anderer Proteine, bestehend aus einer Mischung aus strukturierten und unstrukturierten Domänen gelten.

Nsa1 war PCR verstärkt aus S. Cerevisiae genomischer DNA und subcloned in einen Vektor mit einer N-terminalen 6 X-Histidin Affinität Tag gefolgt von MBP und ein TEV Protease-Website. Nsa1 verwandelte sich in E. Coli BL21(DE3) Zellen und hohe Erträge der Proteinexpression wurden nach Induktion mit IPTG und Wachstum bei 25 ° C über Nacht (Abb. 1A). Nsa1 war Affinität auf immobilisierte Kobalt Affinität Harz, gefolgt von MBP Spaltung mit...

Watch this Scientific Journal Video about Combining X-Ray Crystallography with Small Angle X-Ray Scattering to Model Unstructured Regions of Nsa1 from S. Cerevisiae at JoVE.com

Combining X-Ray Crystallography with Small Angle X-Ray Scattering to Model Unstructured Regions of Nsa1 from S. Cerevisiae

Diese Methode beschreibt die Klonen, Ausdruck und Reinigung von rekombinanten Nsa1 zur Strukturaufklärung durch Röntgen-Kristallographie und kleine Winkel Röntgenstreuung (SAXS) und gilt für die Hybrid-Strukturanalyse von anderen Proteinen mit beiden bestellt und Domänen ungeordnet.

Kombination von Röntgen-Kristallographie mit kleinen Winkel Röntgenstreuung, unstrukturierte Regionen der Nsa1 aus S. Cerevisiae zu modellieren

Determination of the full-length structure of ribosome assembly factor Nsa1 from Saccharomyces cerevisiae (S. cerevisiae) is challenging because of the ...

combining-x-ray-crystallography-with-small-angle-x-ray-scattering-to

Universidad San Sebastian

Research

JoVE Journal

Biochemistry

Combining X-Ray Crystallography with Small Angle X-Ray Scattering to Model Unstructured Regions of Nsa1 from S. Cerevisiae

9.8K Aufrufe.  National Institutes of Health. Diese Methode beschreibt die Klonen, Ausdruck und Reinigung von rekombinanten Nsa1 zur Strukturaufklärung durch Röntgen-Kristallographie und kleine Winkel Röntgenstreuung (SAXS) und gilt für die Hybrid-Strukturanalyse von anderen Proteinen mit beiden bestellt und Domänen ungeordnet.

Serie: Combining X-Ray Crystallography with Small Angle X-Ray Scattering to Model Unstructured Regions of Nsa1 from S. Cerevisiae

Online Size-exclusion and Ion-exchange Chromatography on a SAXS Beamline

Biological small angle X-ray scattering (BioSAXS) is a powerful technique in molecular and structural biology used to determine solution structure, particle size and shape, and surface-to-volume ratio of macromolecules. The technique is applicable to a very wide variety of solution conditions spanning a broad range of concentrations, pH values, ionic strengths, temperatures, additives, etc., but the sample is required to be monodisperse. This caveat led to the implementation of liquid chromatography systems on SAXS beamlines. Here, we describe the upstream integration of size-exclusion (SEC) and ion-exchange chromatography (IEC) on a beamline, different methods for optimal background subtraction, and data reduction. As an example, we describe how we use SEC- and IEC-SAXS on a fragment of the essential vaccinia virus protein D5, consisting of a D5N helicase domain. We determine its overall shape and molecular weight, showing the hexameric structure of the protein.

The determination of the solution structure of a protein by small angle X-ray scattering (SAXS) requires monodisperse samples. Here, we present two possibilities to ensure minimal delays between sample preparation and data acquisition: online size-exclusion chromatography (SEC) and online ion-exchange chromatography (IEC).

Online Größenausschluss und Ionenaustausch-Chromatographie auf einem SAXS Strahlrohr

Biological small angle X-ray scattering (BioSAXS) is a powerful technique in molecular and structural biology used to determine solution structure, ...

Forschung

Biochemie

Combining Wet and Dry Lab Techniques to Guide the Crystallization of Large Coiled-coil Containing Proteins

Obtaining crystals for structure determination can be a difficult and time consuming proposition for any protein. Coiled-coil proteins and domains are found throughout nature, however, because of their physical properties and tendency to aggregate, they are traditionally viewed as being especially difficult to crystallize. Here, we utilize a variety of quick and simple techniques designed to identify a series of possible domain boundaries for a given coiled-coil protein, and then quickly characterize the behavior of these proteins in solution. With the addition of a strongly fluorescent tag (mRuby2), protein characterization is simple and straightforward. The target protein can be readily visualized under normal lighting and can be quantified with the use of an appropriate imager. The goal is to quickly identify candidates that can be removed from the crystallization pipeline because they are unlikely to succeed, affording more time for the best candidates and fewer funds expended on proteins that do not produce crystals. This process can be iterated to incorporate information gained from initial screening efforts, can be adapted for high-throughput expression and purification procedures, and is augmented by robotic screening for crystallization.

We describe a framework incorporating straightforward biochemical and computational analysis to guide the characterization and crystallization of large coiled-coil domains. This framework can be adapted for globular proteins or extended to incorporate a variety of high-throughput techniques.

Nass- und Trockenlabortechniken Die Kombination der Kristallisation von Large Coiled-Coil-Proteine ​​enthalten, zu Führer

Obtaining crystals for structure determination can be a difficult and time consuming proposition for any protein. Coiled-coil proteins and domains are ...

Atomic Scale Structural Studies of Macromolecular Assemblies by Solid-state Nuclear Magnetic Resonance Spectroscopy

Supramolecular protein assemblies play fundamental roles in biological processes ranging from host-pathogen interaction, viral infection to the propagation of neurodegenerative disorders. Such assemblies consist in multiple protein subunits organized in a non-covalent way to form large macromolecular objects that can execute a variety of cellular functions or cause detrimental consequences. Atomic insights into the assembly mechanisms and the functioning of those macromolecular assemblies remain often scarce since their inherent insolubility and non-crystallinity often drastically reduces the quality of the data obtained from most techniques used in structural biology, such as X-ray crystallography and solution Nuclear Magnetic Resonance (NMR). We here present magic-angle spinning solid-state NMR spectroscopy (SSNMR) as a powerful method to investigate structures of macromolecular assemblies at atomic resolution. SSNMR can reveal atomic details on the assembled complex without size and solubility limitations. The protocol presented here describes the essential steps from the production of 13C/15N isotope-labeled macromolecular protein assemblies to the acquisition of standard SSNMR spectra and their analysis and interpretation. As an example, we show the pipeline of a SSNMR structural analysis of a filamentous protein assembly.

Structures of supramolecular protein assemblies at atomic resolution are of high relevance because of their crucial roles in a variety of biological phenomena. Herein, we present a protocol to perform high-resolution structural studies on insoluble and non-crystalline macromolecular protein assemblies by magic-angle spinning solid-state nuclear magnetic resonance spectroscopy (MAS SSNMR).

Atomarer Skala strukturelle Studien der makromolekularen Versammlungen von Festkörper-NMR-Spektroskopie

Supramolecular protein assemblies play fundamental roles in biological processes ranging from host-pathogen interaction, viral infection to the ...

Microcrystallography of Protein Crystals and In Cellulo Diffraction

The advent of high-quality microfocus beamlines at many synchrotron facilities has permitted the routine analysis of crystals smaller than 10 &#181;m in their largest dimension, which used to represent a challenge. We present two alternative workflows for the structure determination of protein microcrystals by X-ray crystallography with a particular focus on crystals grown in vivo. The microcrystals are either extracted from cells by sonication and purified by differential centrifugation, or analyzed in cellulo after cell sorting by flow cytometry of crystal-containing cells. Optionally, purified crystals or crystal-containing cells are soaked in heavy atom solutions for experimental phasing. These samples are then prepared for diffraction experiments in a similar way by application onto a micromesh support and flash cooling in liquid nitrogen. We briefly describe and compare serial diffraction experiments of isolated microcrystals and crystal-containing cells using a microfocus synchrotron beamline to produce datasets suitable for phasing, model building and refinement.
These workflows are exemplified with crystals of the Bombyx mori cypovirus 1 (BmCPV1) polyhedrin produced by infection of insect cells with a recombinant baculovirus. In this case study, in cellulo analysis is more efficient than analysis of purified crystals and yields a structure in ~8 days from expression to refinement.

Microcrystallography of Protein Crystals and In Cellulo Diffraction

A protocol is presented for X-ray crystallography using protein microcrystals. Two examples analyzing in vivo-grown microcrystals after purification or in cellulo are compared.

Mikrokristallographie von Proteinkristallen und<em&gt; In Cellulo</em&gt; Beugung

The advent of high-quality microfocus beamlines at many synchrotron facilities has permitted the routine analysis of crystals smaller than 10 &#181;m in ...

Biochemical and Structural Characterization of the Carbohydrate Transport Substrate-binding-protein SP0092

Development of new antimicrobials and vaccines for Streptococcus pneumoniae (pneumococcus) are necessary to halt the rapid rise in multiple resistant strains. Carbohydrate substrate binding proteins (SBPs) represent viable targets for the development of protein-based vaccines and new antimicrobials because of their extracellular localization and the centrality of carbohydrate import for pneumococcal metabolism, respectively. Described here is a rationalized integrated protocol to carry out a comprehensive characterization of SP0092, which can be extended to other carbohydrate SBPs from the pneumococcus and other bacteria. This procedure can aid the structure-based design of inhibitors for this class of proteins. Presented in the first part of this manuscript are protocols for biochemical analysis by thermal shift assay, multi angle light scattering (MALS), and size exclusion chromatography (SEC), which optimize the stability and homogeneity of the sample directed to crystallization trials and so enhance the probability of success. The second part of this procedure describes the characterization of the SBP crystals using a tunable wavelength anomalous diffraction synchrotron beamline, and data collection protocols for measuring data that can be used to resolve the crystallized protein structure.

A streamlined protocol for performing an extensive biochemical and structural characterization of a carbohydrate substrate binding protein from Streptococcus pneumoniae is presented.

Biochemische und strukturelle Charakterisierung von Kohlenhydrat Transport Substrat-Bindeprotein SP0092

Development of new antimicrobials and vaccines for Streptococcus pneumoniae (pneumococcus) are necessary to halt the rapid rise in multiple resistant ...

Small and Wide Angle X-Ray Scattering Studies of Biological Macromolecules in Solution

In this paper, Small and Wide Angle X-ray Scattering (SWAXS) analysis of macromolecules is demonstrated through experimentation. SWAXS is a technique where X-rays are elastically scattered by an inhomogeneous sample in the nm-range at small angles (typically 0.1 - 5&deg;) and wide angles (typically &gt; 5&deg;). This technique provides information about the shape, size, and distribution of macromolecules, characteristic distances of partially ordered materials, pore sizes, and surface-to-volume ratio. Small Angle X-ray Scattering (SAXS) is capable of delivering structural information of macromolecules between 1 and 200 nm, whereas Wide Angle X-ray Scattering (WAXS) can resolve even smaller Bragg spacing of samples between 0.33 nm and 0.49 nm based on the specific system setup and detector. The spacing is determined from Bragg's law and is dependent on the wavelength and incident angle.
In a SWAXS experiment, the materials can be solid or liquid and may contain solid, liquid or gaseous domains (so-called particles) of the same or another material in any combination. SWAXS applications are very broad and include colloids of all types: metals, composites, cement, oil, polymers, plastics, proteins, foods, and pharmaceuticals. For solid samples, the thickness is limited to approximately 5 mm.
Usage of a lab-based SWAXS instrument is detailed in this paper. With the available software (e.g., GNOM-ATSAS 2.3 package by D. Svergun EMBL-Hamburg and EasySWAXS software) for the SWAXS system, an experiment can be conducted to determine certain parameters of interest for the given sample. One example of a biological macromolecule experiment is the analysis of 2 wt% lysozyme in a water-based aqueous buffer which can be chosen and prepared through numerous methods. The preparation of the sample follows the guidelines below in the Preparation of the Sample section. Through SWAXS experimentation, important structural parameters of lysozyme, e.g. the radius of gyration, can be analyzed.

The demonstration of the small and wide angle X-ray scattering (SWAXS) procedure has become instrumental in the study of biological macromolecules. Through the use of the instrumentation and procedures of specific angle methods and preparation, the experimental data from the SWAXS displays the atomic and nano-scale characterization of macromolecules.

Kleine und Wide Angle X-Ray Scattering Studium der biologischen Makromolekülen in Lösung

In this paper, Small and Wide Angle X-ray Scattering (SWAXS) analysis of macromolecules is demonstrated through experimentation. SWAXS is a technique ...

Biotechnik

Contrast-Matching Detergent in Small-Angle Neutron Scattering Experiments for Membrane Protein Structural Analysis and Ab Initio Modeling

The biological small-angle neutron scattering instrument at the High-Flux Isotope Reactor of Oak Ridge National Laboratory is dedicated to the investigation of biological materials, biofuel processing, and bio-inspired materials covering nanometer to micrometer length scales. The methods presented here for investigating physical properties (i.e., size and shape) of membrane proteins (here, MmIAP, an intramembrane aspartyl protease from Methanoculleus marisnigri) in solutions of micelle-forming detergents are well-suited for this small-angle neutron scattering instrument, among others. Other biophysical characterization techniques are hindered by their inability to address the detergent contributions in a protein-detergent complex structure. Additionally, access to the Bio-Deuteration Lab provides unique capabilities for preparing large-scale cultivations and expressing deuterium-labeled proteins for enhanced scattering signal from the protein. While this technique does not provide structural details at high-resolution, the structural knowledge gap for membrane proteins contains many addressable areas of research without requiring near-atomic resolution. For example, these areas include determination of oligomeric states, complex formation, conformational changes during perturbation, and folding/unfolding events. These investigations can be readily accomplished through applications of this method.

Contrast-Matching Detergent in Small-Angle Neutron Scattering Experiments for Membrane Protein Structural Analysis and Ab Initio Modeling

This protocol demonstrates how to obtain a low-resolution ab initio model and structural details of a detergent-solubilized membrane protein in solution using small-angle neutron scattering with contrast-matching of the detergent.

Kontrast-passende Reinigungsmittel im Small-Angle Neutron Streuexperimente für Membrane Protein strukturelle Analyse und Modellierung von Ab Initio

The biological small-angle neutron scattering instrument at the High-Flux Isotope Reactor of Oak Ridge National Laboratory is dedicated to the ...

Structural Studies of Macromolecules in Solution using Small Angle X-Ray Scattering

Protein-protein interactions involving proteins with multiple globular domains present technical challenges for determining how such complexes form and how the domains are oriented/positioned. Here, a protocol with the potential for elucidating which specific domains mediate interactions in multicomponent system through ab initio modeling is described. A method for calculating solution structures of macromolecules and their assemblies is provided that involves integrating data from small angle X-ray scattering (SAXS), chromatography, and atomic resolution structures together in a hybrid approach. A specific example is that of the complex of full-length nidogen-1, which assembles extracellular matrix proteins and forms an extended, curved nanostructure. One of its globular domains attaches to laminin &#947;-1, which structures the basement membrane. This provides a basis for determining accurate structures of flexible multidomain protein complexes and is enabled by synchrotron sources coupled with automation robotics and size exclusion chromatography systems. This combination allows rapid analysis in which multiple oligomeric states are separated just prior to SAXS data collection. The analysis yields information on the radius of gyration, particle dimension, molecular shape and interdomain pairing. The protocol for generating 3D models of complexes by fitting high-resolution structures of the component proteins is also given.

Here, we present how Small Angle X-Ray Scattering (SAXS) can be utilized to obtain information on low-resolution envelopes representing the macromolecular structures. When used in conjunction with high-resolution structural techniques such as X-Ray Crystallography and Nuclear Magnetic Resonance, SAXS can provide detailed insights into multidomain proteins and macromolecular complexes in-solution.

Strukturelle Studien von Makromolekülen in Lösung mit kleinen Winkel Röntgenstreuung

Protein-protein interactions involving proteins with multiple globular domains present technical challenges for determining how such complexes form and ...

Structure Solution of the Fluorescent Protein Cerulean Using MeshAndCollect

X-ray crystallography is the major technique used to obtain high resolution information concerning the 3-dimensional structures of biological macromolecules. Until recently, a major requirement has been the availability of relatively large, well diffracting crystals, which are often challenging to obtain. However, the advent of serial crystallography and a renaissance in multi-crystal data collection methods has meant that the availability of large crystals need no longer be a limiting factor. Here, we illustrate the use of the automated MeshAndCollect protocol, which first identifies the positions of many small crystals mounted on the same sample holder and then directs the collection from the crystals of a series of partial diffraction data sets for subsequent merging and use in structure determination. MeshAndCollect can be applied to any type of micro-crystals, even if weakly diffracting. As an example, we present here the use of the technique to solve the crystal structure of the Cyan Fluorescent Protein (CFP) Cerulean.

We present the use of the MeshAndCollect protocol to obtain a complete diffraction data set, for use in subsequent structure determination, composed of partial diffraction data sets collected from many small crystals of the fluorescent protein Cerulean.

Struktur-Lösung von den fluoreszierenden Proteins Himmelblau mit MeshAndCollect

X-ray crystallography is the major technique used to obtain high resolution information concerning the 3-dimensional structures of biological ...

Analysis of SEC-SAXS data via EFA deconvolution and Scatter

BioSAXS is a popular technique used in molecular and structural biology to determine the solution structure, particle size and shape, surface-to-volume ratio and conformational changes of macromolecules and macromolecular complexes. A high quality SAXS dataset for structural modeling must be from monodisperse, homogeneous samples and this is often only reached by a combination of inline chromatography and immediate SAXS measurement. Most commonly, size-exclusion chromatography is used to separate samples and exclude contaminants and aggregations from the particle of interest allowing SAXS measurements to be made from a well-resolved chromatographic peak of a single protein species. Still, in some cases, even inline purification is not a guarantee of monodisperse samples, either because multiple components are too close to each other in size or changes in shape induced through binding alter perceived elution time. In these cases, it may be possible to deconvolute the SAXS data of a mixture to obtain the idealized SAXS curves of individual components. Here, we show how this is achieved and the practical analysis of SEC-SAXS data is performed on ideal and difficult samples. Specifically, we show the SEC-SAXS analysis of the vaccinia E9 DNA polymerase exonuclease minus mutant.

SEC-BioSAXS measurements of biological macromolecules are a standard approach for determining solution structure of macromolecules and their complexes. Here, we analyze SEC-BioSAXS data from two types of commonly encountered SEC traces&#8212;chromatograms with fully resolved and partially resolved peaks. We demonstrate the analysis and deconvolution using scatter and BioXTAS RAW.

Analyse von SEC-SAXS-Daten über EFA-Dekonvolution und Streuung

BioSAXS is a popular technique used in molecular and structural biology to determine the solution structure, particle size and shape, surface-to-volume ...

Kombination von Röntgen-Kristallographie mit kleinen Winkel Röntgenstreuung, unstrukturierte Regionen der Nsa1 aus S. Cerevisiae zu modellieren

Zusammenfassung

Weitere Videos entdecken

Kapitel in diesem Video

Online Größenausschluss und Ionenaustausch-Chromatographie auf einem SAXS Strahlrohr

Nass- und Trockenlabortechniken Die Kombination der Kristallisation von Large Coiled-Coil-Proteine enthalten, zu Führer

Atomarer Skala strukturelle Studien der makromolekularen Versammlungen von Festkörper-NMR-Spektroskopie

Mikrokristallographie von Proteinkristallen und

Biochemische und strukturelle Charakterisierung von Kohlenhydrat Transport Substrat-Bindeprotein SP0092

Kleine und Wide Angle X-Ray Scattering Studium der biologischen Makromolekülen in Lösung

Kontrast-passende Reinigungsmittel im Small-Angle Neutron Streuexperimente für Membrane Protein strukturelle Analyse und Modellierung von Ab Initio

Strukturelle Studien von Makromolekülen in Lösung mit kleinen Winkel Röntgenstreuung

Struktur-Lösung von den fluoreszierenden Proteins Himmelblau mit MeshAndCollect

Analyse von SEC-SAXS-Daten über EFA-Dekonvolution und Streuung

Kombination von Röntgen-Kristallographie mit kleinen Winkel Röntgenstreuung, unstrukturierte Regionen der Nsa1 aus S. Cerevisiae zu modellieren

Zusammenfassung

Weitere Videos entdecken

Kapitel in diesem Video

Online Größenausschluss und Ionenaustausch-Chromatographie auf einem SAXS Strahlrohr

Nass- und Trockenlabortechniken Die Kombination der Kristallisation von Large Coiled-Coil-Proteine ​​enthalten, zu Führer

Atomarer Skala strukturelle Studien der makromolekularen Versammlungen von Festkörper-NMR-Spektroskopie

Mikrokristallographie von Proteinkristallen und

Biochemische und strukturelle Charakterisierung von Kohlenhydrat Transport Substrat-Bindeprotein SP0092

Kleine und Wide Angle X-Ray Scattering Studium der biologischen Makromolekülen in Lösung

Kontrast-passende Reinigungsmittel im Small-Angle Neutron Streuexperimente für Membrane Protein strukturelle Analyse und Modellierung von Ab Initio

Strukturelle Studien von Makromolekülen in Lösung mit kleinen Winkel Röntgenstreuung

Struktur-Lösung von den fluoreszierenden Proteins Himmelblau mit MeshAndCollect

Analyse von SEC-SAXS-Daten über EFA-Dekonvolution und Streuung

Nass- und Trockenlabortechniken Die Kombination der Kristallisation von Large Coiled-Coil-Proteine enthalten, zu Führer