Name: isolation and characterization of primary rat valve interstitial cells: a new model to study aortic valve calcification
Uploaded: 2017-11-20T12:30:00.000+00:00
Duration: 8 min 55 s
Description: Watch this Scientific Journal Video about Isolation and Characterization of Primary Rat Valve Interstitial Cells: A New Model to Study Aortic Valve Calcification at JoVE.com

CD31 antibody used was a generous gift from Dr. Karen Tan, University of Edinburgh. This study was supported by funding from the Biotechnology and Biological Sciences Research Council (BBSRC) in the form of an Institute Strategic Programme Grant (BB/J004316/1;BBS/E/D/20221657) (VEM and CF), an Institute Career Path Fellowship BB/F023928/1 (VEM), and studentship funding via a BBSRC CASE Studentship BB/K011618/1 (LC).

All animal experiments were approved by The Roslin Institute&#39;s Animal Users Committee, and the animals were maintained in accordance with Home Office (UK) guidelines for the care and use of animals. For the protocol described below, 5-week old, male Sprague Dawley rats were used.
1. Reagent Recipes
<ol>
	<li>Prepare the culture medium using Dulbecco&#39;s Modified Eagle Medium (DMEM) and nutrient mixture F-12 (DMEM/F12). Add 10% sterilized heat-inactivated fetal bovine serum (FBS) and 1% gentamicin.</li>
	<li>Prepare the calcification medium using culture medium and 2.7 mM Ca/2.5 mM Pi.
	<ol>
		<li>Prepare 1 M calcium chloride (CaCl2) by weighing out 555 mg of CaCl2 and dissolving it in 5 mL distilled water to make 5 mL of 1 M CaCl2. Filter the solution through a 0.22 &#181;m syringe filter to sterilize the solution.</li>
		<li>Prepare 1 M sodium phosphate by weighing out 710 mg anhydrous dibasic sodium phosphate (Na2HPO4) and 600 mg of anhydrous monobasic sodium phosphate (NaH2PO4), dissolving each separately in 5 mL distilled water. Combine 3,870 &#181;L of Na2HPO4 and 1,130 &#181;L of NaH2PO4, and filter through a 0.22 &#181;m syringe filter to sterilize solution.</li>
	</ol>
	</li>
	<li>Prepare the wash buffer containing Hank&#39;s Balanced Salt Solution (HBSS) and 1% gentamicin.</li>
</ol>
2. Preparation of the Dissection Hood
<ol>
	<li>Carry out all dissections in a ventilated hood, previously disinfected with 70% ethanol to ensure sterility of samples and reagents.</li>
	<li>Sterilize dissection tools by autoclaving them followed by immersing the tips of the tools in a beaker containing 70% ethanol prior to use.</li>
	<li>Prepare beakers containing wash buffer, and soak the dissection tools in wash buffer before coming into contact with the animal or tissues. Keep the wash buffer on ice at all times.</li>
</ol>
3. Extraction of Primary Rat VICs
NOTE: For the protocol described below, 5-week old, male Sprague Dawley rats were used.
<ol>
	<li>Cull the rats (~ 100 g) by cervical dislocation in accordance with UK Home Office guidelines.</li>
	<li>To dissect out the heart of each rat, place the animal supine on a glass dissection board, and disinfect the skin by spraying with 70% ethanol.</li>
	<li>Make a 4 cm incision in the midline of the rat with the aid of dissection scissors, to expose the abdominal cavity, and carefully remove the rib cage and lungs, to expose the heart.</li>
	<li>Remove the heart with a pair of sharp, spring curved scissors, and store the dissected heart in ice cold wash buffer until all gross dissections of the rats are complete.</li>
	<li>To micro-dissect each heart, transfer the latter into a Petri dish covered in wash buffer. Trim the cardiac muscle with a pair of spring straight scissors (6 mm blade) to be left with a small area surrounding the ascending aorta and the aortic root.</li>
	<li>Using the same spring straight scissors (6 mm blade), carefully cut open the ascending aorta towards the left ventricle and expose the aortic valve leaflets.</li>
	<li>Transfer the opened aorta into a fresh, sterile Petri dish filled with HBSS. Dissect out the aortic valve leaflets, marked by their unique &#39;U&#39; shape at the base of the aorta, with a pair of Vannas-type capsulotomy micro-scissors (3 mm blade).</li>
	<li>Store all leaflets in 1 mL of ice cold wash buffer, in a 1.5 mL microcentrifuge tube until all dissections are complete.</li>
	<li>Once all leaflets have been harvested, centrifuge them at 100 x g for 1 min at 4 &#176;C to remove the wash buffer.</li>
	<li>Perform subsequent steps in a cell culture hood to ensure sterilization. To remove the VECs, digest the leaflets in 100 &#181;L 425 U/mL collagenase II for 5 min at 37 &#176;C. Disrupt the digestion by gently pipetting up and down using a 200 &#181;L pipette tip.</li>
	<li>Centrifuge at 100 x g for 30 s to pellet the leaflets, and discard the supernatant carefully. Wash twice with 500 &#181;L wash buffer and re-pellet the cells by centrifugation at 100 x g for 30 s.</li>
	<li>To harvest the VICs from the leaflets, digest with 100 &#181;L of 425 U/mL collagenase II for 2 h, and then release the VICs by gently pipetting up and down using a 200 &#181;L pipette tip.</li>
	<li>Dilute the collagenase II in 19 mL of culture medium and centrifuge at 670 x g for 5 min to pellet the VICs and remaining valve leaflet debris. Discard supernatant, and transfer leaflets and VICs to culture plates/flasks accordingly (Table 1).</li>
	<li>Culture the VICs for 5-7 days in culture medium, until confluency is reached at 37 &#176;C, in the presence of 5% (carbon dioxide) CO2, changing the medium after 72 h. For subsequent use in in vitro experiments, passage up to 5 times once confluency reaches 100%.</li>
</ol>
4. Induction of Calcification of Rat VICs
NOTE: For all experiments, count cells with a hemocytometer.
<ol>
	<li>Perform all primary cell seeding and passaging in sterilized hoods to prevent contamination. To prepare primary rat VICs for in vitro calcification experiments, seed the cells at a density of 150,000 cells/well in 6-well plates. Maintain in culture medium until &#8805; 90% confluency (typically 72 h).</li>
	<li>Treat the VICs with calcification versus control medium and incubate at 37 &#176;C, in the presence of 5% CO2, for an additional 72 h.</li>
	<li>To study the calcified primary rat VICs for subsequent downstream analyses, remove the calcification/control medium and wash the monolayers with wash buffer to remove non-bound Ca and Pi ions.</li>
</ol>
5. Rat VIC Characterization
<ol>
	<li>For immunostaining to monitor for phenotypic markers such as vimentin and &#945;-SMA, seed the rat VICs at a density of 150,000 cells/well in 6 well-plates containing cover slips (cells will grow on the surface of the cover slips), and leave to grow until 50% confluency.</li>
	<li>Aspirate the culture medium and fix the cell monolayers with 4% paraformaldehyde (PFA) for 10 min before washing them 3 times with phosphate buffered saline (PBS), for 5 min each time. 
	Caution: PFA is toxic and must be handled carefully.</li>
	<li>Incubate the cell monolayer with blocking and permeabilization buffer (1x PBS, 5% of normal serum from the same species as the secondary antibody, 0.3% Triton X-100) for 1 h at room temperature.</li>
	<li>Incubate the cell monolayers with mouse anti-vimentin and rabbit anti-&#945;-SMA antibodies diluted in antibody dilution buffer (1% bovine serum albumin + 0.3% Triton X-100 in PBS) overnight at 4 &#176;C, gently shaking on a rocker. 
	NOTE: Negative controls consisted of non-conjugated mouse IgG and rabbit IgG, using the same dilutions as the test samples.</li>
	<li>On the next day, wash off the primary antibodies 3 times with PBS, for 5 min each time.</li>
	<li>Incubate the cell monolayers with fluorophore-conjugated secondary antibodies for 1 h at room temperature, gently shaking on a rocker.</li>
	<li>Wash 3 times with PBS, and gently tweeze out the coverslips (which contain rat VICs) with a pair of forceps and place on a coverslip containing 4&#39;,6-diamidino-2-phenylindole (DAPI). Leave the slides to cure for at least 24 h at 4 &#176;C before visualizing with a fluorescence microscope.</li>
	<li>For Western blot analysis, seed the rat VICs at a density of 150,000 cells/well in 6 well-plates and leave to grow in culture medium until 100% confluent.</li>
	<li>Use 8 &#181;g of protein to run a Western blot to measure the expression of CD31 and rule out any VEC contamination. 
	NOTE: A standard Western blot protocol was followed as described previously9.</li>
	<li>For gene studies, extract ribonucleic acid (RNA) using a commercial kit following the manufacturer&#39;s guidelines.</li>
	<li>Obtain cDNA using reverse transcription to measure target genes&#39; expression using polymerase chain reaction (PCR) and real-time PCR (RT-PCR; also known as qPCR) with green fluorophore detection, using Gapdh as the reference gene, as previously described10.
	<ol>
		<li>Use the following program for PCR analysis: 1 cycle of 94 &#176;C for 3 min, 30 cycles of 94 &#176;C for 30 s, 63 &#176;C for 30 s, 72 &#176;C for 35 s, and finally 1 cycle of 72 &#176;C for 5 min.</li>
		<li>Use the following program for qPCR analysis: 1 cycle of 95 &#176;C for 10 min, 40 cycles of 95 &#176;C for 15 s, 60 &#176;C for 1 min and an additional cycle of 95 &#176;C for 1 min, 55 &#176;C for 30 s, and 95 &#176;C for 30 s.</li>
	</ol>
	</li>
	<li>Run a gel electrophoresis to analyze PCR products using a 2% agarose gel in Tris/Borate/EDTA (TBE) buffer.</li>
</ol>
6. Rat VIC Calcification Studies
<ol>
	<li>For Alizarin Red S and biochemical calcification studies, please follow seeding and calcification guidelines described in section 4.</li>
	<li>Stain the cell monolayers with 5% Alizarin red S solution, gently rocking on a shaker, for 20 min. Subsequently wash 3 times with distilled water, for 5 min each time. Acquire images of each well.</li>
	<li>To quantify Ca deposition, use a biochemical Ca assay kit. Leach Ca2+ ions using 0.6 M hydrochloric acid (HCl) for 24 h at 4 &#176;C, with gentle agitation.</li>
	<li>Harvest the supernatant and measure the Ca concentration using a Ca assay kit (see Table of Materials) following the manufacturer&#39;s guidelines.</li>
	<li>Calculate the calcium concentration as a fraction of total cellular protein. Denature cellular proteins from the cell monolayers with 0.1 M sodium hydroxide (NaOH) + 0.1% sodium dodecyl sulphate (SDS). Determine the total protein concentration using a detergent compatible (DC) protein assay following the manufacturer&#39;s guidelines.</li>
</ol>

<ol>
	<li>Dweck, M. R., Boon, N. a., Newby, D. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Calcific+aortic+stenosis:+a+disease+of+the+valve+and+the+myocardium.">Calcific aortic stenosis: a disease of the valve and the myocardium.</a> J Am Coll Cardiol. 60 (19), 1854-1863 (2012).</li><li>Freeman, R. V., Otto, C. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Spectrum+of+calcific+aortic+valve+disease:+Pathogenesis,+disease+progression,+and+treatment+strategies.">Spectrum of calcific aortic valve disease: Pathogenesis, disease progression, and treatment strategies.</a> Circulation. 111, 3316-3326 (2005).</li><li>Mohler, E. R., Gannon, F., Reynolds, C., Zimmerman, R., Keane, M. G., Kaplan, F. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bone+formation+and+inflammation+in+cardiac+valves.">Bone formation and inflammation in cardiac valves.</a> Circulation. 103 (11), 1522-1528 (2001).</li><li>Monzack, E. L., Masters, K. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Can+valvular+interstitial+cells+become+true+osteoblasts?+A+side-by-side+comparison.">Can valvular interstitial cells become true osteoblasts? A side-by-side comparison.</a> J Heart Valve Dis. 20 (4), 449-463 (2011).</li><li>Osman, L., Yacoub, M. H., Latif, N., Amrani, M., Chester, A. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Role+of+human+valve+interstitial+cells+in+valve+calcification+and+their+response+to+atorvastatin.">Role of human valve interstitial cells in valve calcification and their response to atorvastatin.</a> Circulation. 114 (Suppl 1), (2006).</li><li>Gu, X., Masters, K. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Role+of+the+Rho+pathway+in+regulating+valvular+interstitial+cell+phenotype+and+nodule+formation.">Role of the Rho pathway in regulating valvular interstitial cell phenotype and nodule formation.</a> Am J Physiol Heart Circ Physiol. 300 (2), H448-H458 (2011).</li><li>Rodriguez, K. J., Masters, K. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Regulation+of+valvular+interstitial+cell+calcification+by+components+of+the+extracellular+matrix.">Regulation of valvular interstitial cell calcification by components of the extracellular matrix.</a> J Biomed Mater Res A. 90 (4), 1043-1053 (2009).</li><li>Rattazzi, M., Iop, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Clones+of+interstitial+cells+from+bovine+aortic+valve+exhibit+different+calcifying+potential+when+exposed+to+endotoxin+and+phosphate.">Clones of interstitial cells from bovine aortic valve exhibit different calcifying potential when exposed to endotoxin and phosphate.</a> Arterioscler Thromb Vasc Biol. 28 (12), 2165-2172 (2008).</li><li>Zhu, D., Hadoke, P. W. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ablation+of+the+androgen+receptor+from+vascular+smooth+muscle+cells+demonstrates+a+role+for+testosterone+in+vascular+calcification.">Ablation of the androgen receptor from vascular smooth muscle cells demonstrates a role for testosterone in vascular calcification.</a> Sci Rep. 6 (April), 24807 (2016).</li><li>Zhu, D., Mackenzie, N. C. W., Millan, J. L., Farquharson, C., Macrae, V. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Upregulation+of+IGF2+expression+during+vascular+calcification.">Upregulation of IGF2 expression during vascular calcification.</a> J Mol Endocrinol. 52 (2), 77-85 (2014).</li><li>Latif, N., Quillon, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Modulation+of+human+valve+interstitial+cell+phenotype+and+function+using+a+fibroblast+growth+factor+2+formulation.">Modulation of human valve interstitial cell phenotype and function using a fibroblast growth factor 2 formulation.</a> PLoS ONE. 10 (6), (2015).</li><li>Liu, A. C., Joag, V. R., Gotlieb, A. I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+emerging+role+of+valve+interstitial+cell+phenotypes+in+regulating+heart+valve+pathobiology.">The emerging role of valve interstitial cell phenotypes in regulating heart valve pathobiology.</a> Am J Pathol. 171 (5), 1407-1418 (2007).</li><li>Katwa, L. C., Ratajska, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Angiotensin+converting+enzyme+and+kininase-II-like+activities+in+cultured+valvular+interstitial+cells+of+the+rat+heart.">Angiotensin converting enzyme and kininase-II-like activities in cultured valvular interstitial cells of the rat heart.</a> Cardiovasc Res. 29 (1), 57-64 (1995).</li><li>Shao, J. S., Cheng, S. L., Pingsterhaus, J. M., Charlton-Kachigian, N., Loewy, A. P., Towler, D. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Msx2+promotes+cardiovascular+calcification+by+activating+paracrine+Wnt+signals.">Msx2 promotes cardiovascular calcification by activating paracrine Wnt signals.</a> J Clin Invest. 115, 1210-1220 (2005).</li><li>Mackenzie, N. C. W., Zhu, D., Longley, L., Patterson, C. S., Kommareddy, S., MacRae, V. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MOVAS-1+cell+line:+a+new+in+vitro+model+of+vascular+calcification.">MOVAS-1 cell line: a new in vitro model of vascular calcification.</a> Int J Mol Med. 27, 663-668 (2011).</li><li>Kiffer-Moreira, T., Yadav, M. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pharmacological+inhibition+of+PHOSPHO1+suppresses+vascular+smooth+muscle+cell+calcification.">Pharmacological inhibition of PHOSPHO1 suppresses vascular smooth muscle cell calcification.</a> J Bone Miner Res. 28, 81-91 (2013).</li><li>Cui, L., Rashdan, N. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=End+stage+renal+disease-induced+hypercalcemia+may+promote+aortic+valve+calcification+via+Annexin+VI+enrichment+of+valve+interstitial+cell+derived-matrix+vesicles.">End stage renal disease-induced hypercalcemia may promote aortic valve calcification via Annexin VI enrichment of valve interstitial cell derived-matrix vesicles.</a> J Cell Physio. , (2017).</li><li>Tsang, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Exploiting+novel+valve+interstitial+cell+lines+to+study+calcific+aortic+valve+disease.">Exploiting novel valve interstitial cell lines to study calcific aortic valve disease.</a> Mol Med Rep. , (2017).</li></ol>

The authors have nothing to disclose.

This detailed protocol describes a practical method for the acquisition of primary rat VICs, enabling the isolation of these cells from rat heart valves through enzymatic digestion. Our method further supports and extends the use of a previously reported rat in vitro model to study aortic valve calcification13. The isolation of VICs from the aortic valve introduces the potential for contamination from neighboring VECs. However, our immunofluorescence data confirm that the initial digestion step is sufficient to remove the VECs, rendering the isolated cells negative for the endothelial cell marker, CD31. Furthermore, &#945;-SMA staining confirms the activated phenotype of the VICs, which is required for calcification12.
VIC isolations have previously been reported in large animal models6,7,8. However, these species are constrained by the limited genetic and molecular tools available for downstream study, as well as their restricted accessibility in laboratories around the world. In contrast, such tools are well established in readily available rodents and therefore, the ability to isolate rat-derived VICs enables a greater experimental design capacity. The use of VICs from young rats also means that the cells are relatively more proliferative than older rats, therefore requiring less animals to yield more cells. Although mice are readily accessible, but due to mice having notably smaller hearts, the isolation of primary mouse VICs would be more time-consuming and considerably more animals would be required to isolate the same yield of cells as the rat model.
A significant advantage of this described approach is that VICs can be isolated temporally from wild type and transgenic rats, as well as rat models of cardiovascular disease and valve injury. Using the rat model would require a larger number of animals for large scale experiments, therefore to reduce animal use, primary rat VICs can be transformed to produce a cell line once it has been well characterized.
Whilst the severe clinical implications of CAVD are widely recognized, the underlying causative mechanisms have yet to be determined. In addition, effective medication therapies that may prevent and potentially cure aortic valve calcification are not available at present. The culture of VICs under calcifying conditions therefore provides a highly relevant in vitro model of CAVD. We show that elevated Ca and Pi levels induce the in vitro calcification of isolated rat VICs with a concomitant increase in the expression of osteogenic gene markers Msx2, Alpl, and Phospho1. It is widely established that these markers are associated with the pathological process of vascular calcification14,15,16. Our data therefore show that the culture of rat VICs in calcifying medium is an appropriate model with which to study aortic valve calcification in vitro. Indeed, recent studies from our laboratory have utilized this model to demonstrate that Ca promotes aortic valve calcification through Annexin VI enrichment of VIC-derived matrix vesicles17.
Despite the benefits of using rat VICs and their efficient characterization, some limitations still exist. First, the size of VIC population within rat valves is very small, and therefore many animals are needed in order to generate sufficient cell numbers for extensive in vitro studies. However, it is possible to overcome this limitation by undertaking preliminary studies in immortalized valve interstitial cell lines, as recently reported by us18, and subsequently employing primary cultures to verify and extend these findings.
In summary, the described method explains the successful isolation, culture, and calcification of primary rat VICs, which may be subsequently assessed using a variety of analyses including biochemical assays, as well as protein and RNA analyses. This model offers a reliable and convenient system in which to investigate CAVD in vitro, and provides a valuable tool for investigating the molecular mechanisms responsible for this destructive disease.

The healthy aortic valve is comprised of three leaflets, to which the distribution of mechanical stress during the opening and closing of the valve is equally apportioned. The valve leaflet has a defined structure of three distinct layers: the fibrosa, spongiosa, and ventricularis, which house valve interstitial cells (VICs) as the predominant cell type. These three layers are sandwiched between two beds of valve endothelial cells (VECs)1.
VICs play a critical role in the progression of Calcific Aortic Valve Calcification (CAVD), the most common heart valve disease in the Western world. CAVD is described as a progressive condition that is actively regulated by the valvular tissue and its surrounding microenvironment. Cellular changes initially cause fibrotic thickening, and eventually an extensive calcification of the aortic valve leaflets. This then leads to significant aortic valve stenosis and ultimately, left ventricular outflow obstruction2, leaving surgical valve replacement as the only viable treatment.
The pathophysiology of CAVD is complex, but shares similar mechanisms to physiological bone mineralization3. Whilst, a number of studies have demonstrated the ability of VICs to undergo osteogenic trans-differentiation and calcification4,5, the mechanisms underpinning this process have yet to be fully elucidated, highlighting the crucial requirement for a feasible and relevant in vitro model of CAVD.
Previous work by a number of laboratories has successfully isolated VICs from porcine and bovine models, and cultured these cells under calcifying conditions6,7,8. Due to the large size of the aortic valve in these models, isolation of cells through enzymatic digestion has been highly effective in generating pure populations of cells. However, these models can be restrictive due to the limited availability of molecular tools for large animal species. In contrast, rodent models remain advantageous due to relatively lower costs, potential for genetic manipulation, and the extensive array of molecular tools that are readily available. However, the isolation of VICs from small animal models is not widely employed, which is a likely consequence of the difficulties encountered when working with small tissue samples.
This detailed protocol reports a comprehensive method for the direct isolation of rat VICs. By careful dissection of the valve, followed by a series of enzymatic digestions, VICs can be isolated and employed in a wide variety of experimental techniques, including cell culture, calcification, and gene expression. This highly relevant in vitro model of CAVD will undoubtedly make an essential contribution to increasing our knowledge of this pathological process.

<table><tbody><tr><td>Dissection scissors</td><td>World Precision Instruments</td><td>14393</td><td>Autoclave before use.</td></tr><tr><td>Spring straight (8 mm blade)</td><td>World Precision Instruments</td><td>15905</td><td>Autoclave before use.</td></tr><tr><td>SuperFine Vannas scissors (5 mm blade, 8 cm)</td><td>World Precision Instruments</td><td>14003</td><td>Autoclave before use.</td></tr><tr><td>Dumont #5 tweezers (11 cm)</td><td>World Precision Instruments</td><td>500342</td><td>Autoclave before use.</td></tr><tr><td>DMEM-F12</td><td>Thermo Fisher Scientific</td><td>11320074</td><td></td></tr><tr><td>Foetal bovine serum</td><td>Thermo Fisher Scientific</td><td>10500064</td><td>Filter before adding to culture medium.</td></tr><tr><td>Gentamicin</td><td>Thermo Fisher Scientific</td><td>15710049</td><td></td></tr><tr><td>Absolute ethanol</td><td>Thermo Fisher Scientific</td><td>E/0650DF/17</td><td>Dilute to 70% v/v in distilled water.</td></tr><tr><td>Hydrochloric acid (HCl)</td><td>Thermo Fisher Scientific</td><td>H1150PB17</td><td>Dilute to 0.6M with distilled water.</td></tr><tr><td>Sodium hydroxide (NaOH)</td><td>Thermo Fisher Scientific</td><td>UN1823</td><td>Dilute to 0.1M with distilled water.</td></tr><tr><td>DAPI</td><td>Thermo Fisher Scientific</td><td>P36931</td><td></td></tr><tr><td>Alexa Fluor 594 goat anti-mouse antibody</td><td>Thermo Fisher Scientific</td><td>A11005</td><td>1/250 dilution in antibody dilution buffer.</td></tr><tr><td>Alexa Fluor 488 donkey anti-rabbit antibody</td><td>Thermo Fisher Scientific</td><td>A21206</td><td>1/250 dilution in antibody dilution buffer.</td></tr><tr><td>Superscript II kit</td><td>Thermo Fisher Scientific</td><td>18064014</td><td></td></tr><tr><td>dNTP</td><td>Thermo Fisher Scientific</td><td>18427013</td><td></td></tr><tr><td>Random primers</td><td>Thermo Fisher Scientific</td><td>P/N58875</td><td></td></tr><tr><td>Taq Polymerase kit</td><td>Thermo Fisher Scientific</td><td>18038026</td><td></td></tr><tr><td>Tris/Borate/EDTA (TBE)</td><td>Thermo Fisher Scientific</td><td>AM9863</td><td>Dilute to 1x with distlled water, before use.</td></tr><tr><td>Agarose</td><td>Thermo Fisher Scientific</td><td>16500</td><td>2% in 1x Tris/Borate/EDTA(TBE).</td></tr><tr><td>Lysis buffer (RIPA)</td><td>Thermo Fisher Scientific</td><td>89900</td><td></td></tr><tr><td>T75 flask</td><td>Thermo Fisher Scientific</td><td>156472</td><td></td></tr><tr><td>T175 flask</td><td>Thermo Fisher Scientific</td><td>159920</td><td></td></tr><tr><td>qPCR plates</td><td>Thermo Fisher Scientific</td><td>AB0990</td><td></td></tr><tr><td>Rat Msx2 primer</td><td>Qiagen</td><td>QT01084090</td><td></td></tr><tr><td>Rat Alpl primer</td><td>Qiagen</td><td>QT00190680</td><td></td></tr><tr><td>Rat Enpp1 primer</td><td>Qiagen</td><td>QT00181426</td><td></td></tr><tr><td>RNeasy minikit</td><td>Qiagen</td><td>74104</td><td></td></tr><tr><td>6-well plates</td><td>Sigma</td><td>CLS3516</td><td></td></tr><tr><td>T25 flask</td><td>Sigma</td><td>CLS430639</td><td></td></tr><tr><td>Monobasic phosphate</td><td>Sigma</td><td>S5011</td><td></td></tr><tr><td>Dibasic phosphate</td><td>Sigma</td><td>S5136</td><td></td></tr><tr><td>Calcium chloride</td><td>Sigma</td><td>C1016</td><td></td></tr><tr><td>Sodium dodecyl sulphate (SDS)</td><td>Sigma</td><td>5030</td><td>Dilute to 0.1% with 0.1M NaOH.</td></tr><tr><td>Paraformaldehyde</td><td>Sigma</td><td>P6148</td><td>Dilute to 4% with PBS.</td></tr><tr><td>Triton X100</td><td>Sigma</td><td>X100</td><td></td></tr><tr><td>Bovine serum albumin (BSA)</td><td>Sigma</td><td>A3059</td><td></td></tr><tr><td>Alizarin red S</td><td>Sigma</td><td>A5533</td><td>Make up to 2% with distilled water, and adjust to pH 4.2.</td></tr><tr><td>TGF&amp;beta;-1 primer pair: f: GCTACCATGCCAACTTCTGT r: TGTGTTGGTTGTAGAGGGCA</td><td>Sigma</td><td></td><td>Concentration used: 10 &amp;mu;M</td></tr><tr><td>TGF&amp;beta;-2 primer pair: f: GAAGGCAGAGTTCAGGGTCT r: CGCTGGGTTGGAGATGTTAG</td><td>Sigma</td><td></td><td>Concentration used: 10 &amp;mu;M</td></tr><tr><td>Monoclonal Anti-&amp;beta;-Actin&amp;minus;Peroxidase antibody produced in mouse</td><td>Sigma</td><td>A3854</td><td>1/50000 dilution in 5% BSA in tris-buffered saline + 0.1% Tween (TBS/T).</td></tr><tr><td>Mouse anti-vimentin antibody</td><td>Sigma</td><td>v6389</td><td>1/900 dilution in &lt;strong&gt;antibody dilution buffer&lt;/strong&gt; (1x phosphate buffered saline (PBS), 1% bovine serum albumin (BSA), 0.3% Triton X-100).</td></tr><tr><td>Mouse IgG</td><td>Sigma</td><td>I5381</td><td>Diluted to the same stock concentration as mouse anti-vimentin antibody prior to dilution in antibody dilution buffer.</td></tr><tr><td>Rabbit IgG</td><td>GeneTex</td><td>GTX35035</td><td>Diluted to the same stock concentration as rabbit anti-&amp;alpha;-smooth muscle actin antibody prior to dilution in antibody dilution buffer.</td></tr><tr><td>Rabbit anti-&amp;alpha;-smooth muscle actin antibody</td><td>Abcam</td><td>ab5694</td><td>1/200 dilution in antibody dilution buffer.</td></tr><tr><td>Rabbit anti-CD31</td><td>Abcam</td><td>ab28364</td><td>1/50 dilution in 5% BSA inTBS/T.</td></tr><tr><td>HRP-conjugated goat anti-rabbit antibody</td><td>Dako</td><td>P0448</td><td>1/3000 dilution in in 5% BSA in TBS/T.</td></tr><tr><td>Collagenase II</td><td>Worthington</td><td>41512862</td><td>Adjust to 425 U/mL with distilled water, and then filter.</td></tr><tr><td>SYBR green mastermix</td><td>Primerdesign</td><td>PrecisionPLUS-MX-SY</td><td></td></tr><tr><td>Calcium assay kit</td><td>Randox</td><td>CA590</td><td></td></tr><tr><td>DC protein assay kit</td><td>Bio-Rad</td><td>5000111</td><td></td></tr><tr><td>ECL reagent</td><td>GE Healthcare</td><td>RPN2109</td><td></td></tr><tr><td>Hyperfilm ECL</td><td>GE Healthcare</td><td>28906837</td><td></td></tr><tr><td>Nitrocellulose membrane</td><td>GE Healthcare</td><td>10600007</td><td></td></tr><tr><td>PCR ladder</td><td>Bioline</td><td>BIO-33057</td><td></td></tr><tr><td>Loading dye for gel electrophoresis</td><td>New England Biolabs</td><td>B7025S</td><td></td></tr><tr><td>Syringe filters (0.22 &amp;mu;m)</td><td>Merck Millipore</td><td>SLGP033RS</td><td></td></tr><tr><td>Coverslips</td><td>Scientific Laboratory Supplies LTD</td><td>MIC3100</td><td></td></tr><tr><td>Hematocytometer</td><td>Marienfeld Superior</td><td>640030</td><td></td></tr><tr><td>&lt;strong&gt;Name&lt;/strong&gt;</td><td>&lt;strong&gt;Company&lt;/strong&gt;</td><td>&lt;strong&gt;Catalog Number&lt;/strong&gt;</td><td>&lt;strong&gt;Comments&lt;/strong&gt;</td></tr><tr><td>&lt;strong&gt;Camera set up for Alizarin red images:&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>Camera</td><td>Nikon D800</td><td></td><td></td></tr><tr><td>Lens</td><td>Nikon AF_s Micro, Nikko 105 mm, 1:2.8 GED</td><td></td><td></td></tr><tr><td>Dissection forceps 10 cm, curved ends</td><td>World Precision Instruments</td><td>15915</td><td>Autoclave before use.</td></tr></tbody></table>

isolation and characterization of primary rat valve interstitial cells: a new model to study aortic valve calcification

Calcific aortic valve disease (CAVD) is characterized by the progressive thickening of the aortic valve leaflets. It is a condition frequently found in the elderly and end-stage renal disease (ESRD) patients, who commonly suffer from hyperphosphatemia and hypercalcemia. At present, there are no medication therapies that can stop its progression. The mechanisms that underlie this pathological process remain unclear. The aortic valve leaflet is composed of a thin layer of valve endothelial cells (VECs) on the outer surfaces of the aortic cusps, with valve interstitial cells (VICs) sandwiched between the VECs. The use of a rat model enables the in vitro study of ectopic calcification based on the in vivo physiopathological serum phosphate (Pi) and calcium (Ca) levels of patients who suffer from hyperphosphatemia and hypercalcemia. The described protocol details the isolation of a pure rat VIC population as shown by the expression of VIC markers: alpha-smooth muscle actin (&#945;-SMA) vimentin and tissue growth factor beta (TGF&#946;) 1 and 2, and the absence of cluster of differentiation (CD) 31, a VEC marker. By expanding these VICs, biochemical, genetic, and imaging studies can be performed to study and unravel the key mediators underpinning CAVD.

The aim of this protocol was to describe the isolation of primary rat VICs and culture them for in vitro calcification experiments. By employing the method described above, rat VICs can be successfully isolated and expanded for the study of the mechanisms responsible for CAVD.
Rat Primary VICs Co-localize with Established VIC Markers:
The VIC phenotype of isolated cells was confirmed through immunofluorescence by probing for the VIC markers: vimentin and &#945;-SMA (red and green, respectively, Figure 1A), and is in agreement with previous reports11,12. The representative negative controls using non-conjugated mouse and rabbit IgG are shown in Figure 1B. Additionally, the expression of the VIC-growth regulator TGF&#946;-1 and TGF&#946;-2 was confirmed using PCR analysis (Figure 1C). In order to confirm that the isolated rat primary VICs were free from endothelial contamination, Western blot analysis was performed to verify that rat VICs were negative for the endothelial cell marker, CD31, using canine mitral VECs as a positive control (Figure 1D).
Ca and Pi Induce Rat VIC Calcification:
Elevated systemic Ca and/or Pi concentrations typically drive the calcification of VICs in vitro. To appreciate the calcification potential of the isolated rat VICs, the cells were exposed to elevated levels of Ca and Pi, which mimic pathological hypercalcemia and hyperphosphatemia conditions in ESRD patients. Treatment of VICs with 2.7 mM Ca/2.5 mM Pi induced calcification, as determined by Alizarin Red S staining for Ca deposition (Figure 2A) and colorimetric determination of Ca levels following HCl leaching (81 fold; p &#60; 0.05 using Student&#39;s t-Test; Figure 2B).
Gene Expression Changes Associated with VIC Calcification:
The calcification of vascular cells in vitro is associated with a distinct molecular profile. In the present study, the treatment of VICs with 2.7 mM Ca/2.5 mM Pi induced a significant increase in the mRNA expression of the osteogenic markers: Msh homeobox 2, Msx2 (2.04 fold change; p &#60; 0.01; Figure 3A), alkaline phosphatase, Alpl (1.49 fold change; p &#60; 0.001; Figure 3B), and phosphoethanolamine/phosphocholine phosphatase, Phospho1 (4.7 fold change; p &#60; 0.01 using one-way ANOVA; Figure 3C). However, the expression of the osteogenic marker, Runx2, and calcification inhibitor ectonucleotide pyrophasphatase, Enpp1, remained unchanged (Figure 3D-E).
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/56126/56126fig1.jpg" /> 
Figure 1. Expression of VIC markers. (A) Immunofluorescence showing double staining and colocalization of alpha-smooth muscle actin (&#945;-SMA; green) and vimentin in valve interstitial cells (VICs). (B) Representative image of negative controls using mouse and rabbit IgG. Nuclei are stained in blue using 4&#39;,6-diamidino-2-phenylindole (DAPI). Scale bar = 50 &#181;m. (C) The presence of transforming growth factor beta 1 (TGF&#946;-1) and TGF&#946;-2 in VICs (Lanes 1-3) as shown by PCR analysis. Lane 4 is the water control. Reference gene used was Gapdh. (D) Western blot analysis showing the abundant expression of CD31 in canine mitral valve endothelial cells (VECs) in comparison to no expression in VICs. <a href="https://cloudflare-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/56126/56126fig1large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/56126/56126fig2.jpg" /> 
Figure 2. In vitro calcification of rat VICs. Ca deposition in VICs treated with 2.7 mM Ca/2.5 mM Pi as determined by: (A) Photograph showing Alizarin Red S staining of whole cell monolayers in the well, and (B) colorimetric determination of Ca levels following HCl leaching. Student&#39;s t-test was performed to analyze the significance between the two data groups. Results are presented as mean &#177; S.E.M. *p &#60; 0.5 compared with control; (n = 4).
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/56126/56126fig3.jpg" /> 
Figure 3. Gene expression changes associated with VIC calcification. Fold change in the mRNA expression of osteogenic markers (A) Msx2, (B) Alpl, (C) Phospho1, (D) Runx2, and (E) Enpp1 in VICs treated with 2.7 mM Ca/2.5 mM Pi for 48 h. mRNA expression is shown as a fold change compared to the endogenous reference gene Gadph. One-way ANOVA using general linear model incorporating pair-wise comparisons was performed to analyze the significance between multiple groups. Results are presented as mean &#177; S.E.M. **p &#60; 0.01; ***p &#60; 0.001 compared to control; (n = 6). <a href="https://cloudflare-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/56126/56126fig3large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Number of valve leaflets</td>
			<td>Culture plate/flask</td>
		</tr>
		<tr>
			<td>9 to 15</td>
			<td>1 well in 12-well plate</td>
		</tr>
		<tr>
			<td>15 to 30</td>
			<td>1 well in 6-well plate</td>
		</tr>
		<tr>
			<td>30+</td>
			<td>T25</td>
		</tr>
	</tbody>
</table>
Table 1. General guidelines for the number of leaflets required for initial seeding.

Watch this Scientific Journal Video about Isolation and Characterization of Primary Rat Valve Interstitial Cells: A New Model to Study Aortic Valve Calcification at JoVE.com

Isolation and Characterization of Primary Rat Valve Interstitial Cells: A New Model to Study Aortic Valve Calcification

This protocol describes the isolation, culture, and calcification of rat-derived valve interstitial cells, a highly physiological in vitro model of calcific aortic valve disease (CAVD). Exploitation of this rat model facilitates CAVD research in exploring the cell and molecular mechanisms that underlie this complex pathological process.

Calcific aortic valve disease (CAVD) is characterized by the progressive thickening of the aortic valve leaflets. It is a condition frequently found in ...

isolation-characterization-primary-rat-valve-interstitial-cells-new

Universidad San Sebastian

Research

JoVE Journal

Developmental Biology

9.7K Views.  University of Edinburgh. This protocol describes the isolation, culture, and calcification of rat-derived valve interstitial cells, a highly physiological in vitro model of calcific aortic valve disease (CAVD). Exploitation of this rat model facilitates CAVD research in exploring the cell and molecular mechanisms that underlie this complex pathological process.

Video: Isolation and Characterization of Primary Rat Valve Interstitial Cells: A New Model to Study Aortic Valve Calcification

Isolation and Quantitative Immunocytochemical Characterization of Primary Myogenic Cells and Fibroblasts from Human Skeletal Muscle

The repair and regeneration of skeletal muscle requires the action of satellite cells, which are the resident muscle stem cells. These can be isolated from human muscle biopsy samples using enzymatic digestion and their myogenic properties studied in culture. Quantitatively, the two main adherent cell types obtained from enzymatic digestion are: (i) the satellite cells (termed myogenic cells or muscle precursor cells), identified initially as CD56+ and later as CD56+/desmin+ cells and (ii) muscle-derived fibroblasts, identified as CD56&#8211; and TE-7+. Fibroblasts proliferate very efficiently in culture and in mixed cell populations these cells may overrun myogenic cells to dominate the culture. The isolation and purification of different cell types from human muscle is thus an important methodological consideration when trying to investigate the innate behavior of either cell type in culture. Here we describe a system of sorting based on the gentle enzymatic digestion of cells using collagenase and dispase followed by magnetic activated cell sorting (MACS) which gives both a high purity (&#62;95% myogenic cells) and good yield (~2.8 x 106 &#177; 8.87 x 105 cells/g tissue after 7 days in vitro) for experiments in culture. This approach is based on incubating the mixed muscle-derived cell population with magnetic microbeads beads conjugated to an antibody against CD56 and then passing cells though a magnetic field. CD56+ cells bound to microbeads are retained by the field whereas CD56&#8211; cells pass unimpeded through the column. Cell suspensions from any stage of the sorting process can be plated and cultured. Following a given intervention, cell morphology, and the expression and localization of proteins including nuclear transcription factors can be quantified using immunofluorescent labeling with specific antibodies and an image processing and analysis package.

The main adherent cell types derived from human muscle are myogenic cells and fibroblasts. Here, cell populations are enriched using magnetic-activated cell sorting based on the CD56 antigen. Subsequent immunolabelling with specific antibodies and use of image analysis techniques allows quantification of cytoplasmic and nuclear characteristics in individual cells.

The repair and regeneration of skeletal muscle requires the action of satellite cells, which are the resident muscle stem cells. These can be isolated ...

Isolation and Characterization of Satellite Cells from Rat Head Branchiomeric Muscles

Fibrosis and defective muscle regeneration can hamper the functional recovery of the soft palate muscles after cleft palate repair. This causes persistent problems in speech, swallowing, and sucking. In vitro culture systems that allow the study of satellite cells (myogenic stem cells) from head muscles are crucial to develop new therapies based on tissue engineering to promote muscle regeneration after surgery. These systems will offer new perspectives for the treatment of cleft palate patients. A protocol for the isolation, culture and differentiation of satellite cells from head muscles is presented. The isolation is based on enzymatic digestion and trituration to release the satellite cells. In addition, this protocol comprises an innovative method using extracellular matrix gel coatings of millimeter size, which requires only low numbers of satellite cells for differentiation assays.

This protocol describes the isolation of satellite cells from branchiomeric head muscles of a 9 week-old rat. The muscles originate from different branchial arches. Subsequently, the satellite cells are cultured on a spot coating of millimeter size to study their differentiation. This approach avoids the expansion and passaging of satellite cells.

Fibrosis and defective muscle regeneration can hamper the functional recovery of the soft palate muscles after cleft palate repair. This causes persistent ...

Isolation of Valvular Endothelial Cells

Heart valves are solely responsible for maintaining unidirectional blood flow through the cardiovascular system. These thin, fibrous tissues are subjected to significant mechanical stresses as they open and close several billion times over a lifespan. The incredible endurance of these tissues is due to the resident valvular endothelial (VEC) and interstitial cells (VIC) that constantly repair and remodel in response to local mechanical and biological signals. Only recently have we begun to understand the unique behaviors of these cells, for which in vitro experimentation has played a key role. Particularly challenging is the isolation and culture of VEC. Special care must be used from the moment the tissue is removed from the host through final plating. Here we present protocols for direct isolation, side specific isolation, culture, and verification of pure populations of VEC. We use enzymatic digestion followed by a gentle swab scraping technique to dislodge only surface cells. These cells are then collected into a tube and centrifuged into a pellet. The pellet is then resuspended and plated into culture flasks pre-coated with collagen I matrix. VEC phenotype is confirmed by contact inhibited growth and the expression of endothelial specific markers such as PECAM1 (CD31), Von Willebrand Factor (vWF), and negative expression of alpha-smooth muscle actin (&alpha;-SMA). The functional characteristics of VEC are associated with high levels of acetylated LDL. Unlike vascular endothelial cells, VEC have the unique capacity to transform into mesenchyme, which normally occurs during embryonic valve formation1. This can also occur during significantly prolonged post confluent in vitro culture, so care should be made to passage at or near confluence. After VEC isolation, pure populations of VIC can then be easily acquired.

We provide a method for isolating and culturing pure populations of heart valve endothelial cells (VEC). VEC can be isolated from either side of the cusp or leaflet and immediately following, underlying interstitial cell (VIC) isolation is straightforward.

Heart valves are solely responsible for maintaining unidirectional blood flow through the cardiovascular system.  These thin, fibrous tissues are ...

Biology

Calcification of Vascular Smooth Muscle Cells and Imaging of Aortic Calcification and Inflammation

Cardiovascular disease is the leading cause of morbidity and mortality in the world. Atherosclerotic plaques, consisting of lipid-laden macrophages and calcification, develop in the coronary arteries, aortic valve, aorta, and peripheral conduit arteries and are the hallmark of cardiovascular disease. In humans, imaging with computed tomography allows for the quantification of vascular calcification; the presence of vascular calcification is a strong predictor of future cardiovascular events. Development of novel therapies in cardiovascular disease relies critically on improving our understanding of the underlying molecular mechanisms of atherosclerosis. Advancing our knowledge of atherosclerotic mechanisms relies on murine and cell-based models. Here, a method for imaging aortic calcification and macrophage infiltration using two spectrally distinct near-infrared fluorescent imaging probes is detailed. Near-infrared fluorescent imaging allows for the ex vivo quantification of calcification and macrophage accumulation in the entire aorta and can be used to further our understanding of the mechanistic relationship between inflammation and calcification in atherosclerosis. Additionally, a method for isolating and culturing animal aortic vascular smooth muscle cells and a protocol for inducing calcification in cultured smooth muscle cells from either murine aortas or from human coronary arteries is described. This in vitro method of modeling vascular calcification can be used to identify and characterize the signaling pathways likely important for the development of vascular disease, in the hopes of discovering novel targets for therapy.

Vascular calcification is an important predictor of and contributor to human cardiovascular disease. This protocol describes methods for inducing calcification of cultured primary vascular smooth muscle cells and for quantifying calcification and macrophage burden in animal aortas using near-infrared fluorescence imaging.

Cardiovascular disease is the leading cause of morbidity and mortality in the world.  Atherosclerotic plaques, consisting of lipid-laden macrophages and ...

Medicine

Investigating Aortic Valve Calcification via Isolation and Culture of T Lymphocytes using Feeder Cells from Irradiated Buffy Coat

Calcific aortic valve disease (CAVD), an active disease process ranging from mild thickening of the valve to severe calcification, is associated with high mortality, despite new therapeutic options such as transcatheter aortic valve replacement (TAVR). 
The complete pathways that start with valve calcification and lead to severe aortic stenosis remain only partly understood. By providing a close representation of the aortic valve cells in vivo, the assaying of T lymphocytes from stenotic valve tissue could be an efficient way to clarify their role in the development of calcification. After surgical excision, the fresh aortic valve sample is dissected in small pieces and the T lymphocytes are cultured, cloned then analyzed using fluorescence activated cell sorting (FACS).
The staining procedure is simple and the stained tubes can also be fixed using 0.5% of paraformaldehyde and analyzed up to 15 days later. The results generated from the staining panel can be used to track changes in T cell concentrations over time in relation to intervention and could easily be further developed to assess activation states of specific T cell subtypes of interest. In this study, we show the isolation of T cells, performed on fresh calcified aortic valve samples and the steps of analyzing T cell clones using flow cytometry to further understand the role of adaptive immunity in CAVD pathophysiology.

In this study, we describe the process of T lymphocyte isolation from fresh samples of calcified aortic valves and the analytical steps of T cell-cloning for the characterization of the adaptive leukocyte subsets by using flow cytometry analysis.

Calcific aortic valve disease (CAVD), an active disease process ranging from mild thickening of the valve to severe calcification, is associated with high ...

Immunology and Infection

Isolation of Murine Valve Endothelial Cells

Normal valve structures consist of stratified layers of specialized extracellular matrix (ECM) interspersed with valve interstitial cells (VICs) and surrounded by a monolayer of valve endothelial cells (VECs). VECs play essential roles in establishing the valve structures during embryonic development, and are important for maintaining life-long valve integrity and function. In contrast to a continuous endothelium over the surface of healthy valve leaflets, VEC disruption is commonly observed in malfunctioning valves and is associated with pathological processes that promote valve disease and dysfunction. Despite the clinical relevance, focused studies determining the contribution of VECs to development and disease processes are limited. The isolation of VECs from animal models would allow for cell-specific experimentation. VECs have been isolated from large animal adult models but due to their small population size, fragileness, and lack of specific markers, no reports of VEC isolations in embryos or adult small animal models have been reported. Here we describe a novel method that allows for the direct isolation of VECs from mice at embryonic and adult stages. Utilizing the Tie2-GFP reporter model that labels all endothelial cells with Green Fluorescent Protein (GFP), we have been successful in isolating GFP-positive (and negative) cells from the semilunar and atrioventricular valve regions using fluorescence activated cell sorting (FACS). Isolated GFP-positive VECs are enriched for endothelial markers, including CD31 and von Willebrand Factor (vWF), and retain endothelial cell expression when cultured; while, GFP-negative cells exhibit molecular profiles and cell shapes consistent with VIC phenotypes. The ability to isolate embryonic and adult murine VECs allows for previously unattainable molecular and functional studies to be carried out on a specific valve cell population, which will greatly improve our understanding of valve development and disease mechanisms.

The ability to isolate heart valve endothelial cells (VECs) is critical for understanding mechanisms of valve development, maintenance, and disease. Here we describe the isolation of VECs from embryonic and adult Tie2-GFP mice using FACS that will allow for studies determining the contribution of VECs in developmental and disease processes.

Normal valve structures consist of stratified layers of specialized extracellular matrix (ECM) interspersed with valve interstitial cells (VICs) and ...

Isolation of Mouse Interstitial Valve Cells to Study the Calcification of the Aortic Valve In Vitro

The calcification of aortic valve cells is the hallmark of aortic stenosis and is associated with valve cusp fibrosis. Valve interstitial cells (VICs) play an important role in the calcification process in aortic stenosis through the activation of their dedifferentiation program to osteoblast-like cells. Mouse VICs are a good in vitro tool for the elucidation of the signaling pathways driving the mineralization of the aortic valve cell. The method described herein, successfully used by these authors, explains how to obtain freshly isolated cells. A two-step collagenase procedure was performed with 1 mg/mL and 4.5 mg/mL. The first step is crucial to remove the endothelial cell layer and avoid any contamination. The second collagenase incubation is to facilitate the migration of VICs from the tissue to the plate. In addition, an immunofluorescence staining procedure for the phenotype characterization of the isolated mouse valve cells is discussed. Furthermore, the calcification assay was performed in vitro by using the calcium reagent measurement procedure and alizarin red staining. The use of mouse valve cell primary culture is essential for testing new pharmacological targets to inhibit cell mineralization in vitro.

Isolation of Mouse Interstitial Valve Cells to Study the Calcification of the Aortic Valve In Vitro

This article describes the isolation of mouse aortic valve cells by a two-step collagenase procedure. Isolated mouse valve cells are important for performing different assays, such as this in vitro calcification assay, and for investigating the molecular pathways leading to aortic valve mineralization.

The calcification of aortic valve cells is the hallmark of aortic stenosis and is associated with valve cusp fibrosis. Valve interstitial cells (VICs) ...

Isolation of Human Primary Valve Cells for In vitro Disease Modeling

Calcific aortic valve disease (CAVD) is present in nearly a third of the elderly population. Thickening, stiffening, and calcification of the aortic valve causes aortic stenosis and contributes to heart failure and stroke. Disease pathogenesis is multifactorial, and stresses such as inflammation, extracellular matrix remodeling, turbulent flow, and mechanical stress and strain contribute to the osteogenic differentiation of valve endothelial and valve interstitial cells. However, the precise initiating factors that drive the osteogenic transition of a healthy cell into a calcifying cell are not fully defined. Further, the only current therapy for CAVD-induced aortic stenosis is aortic valve replacement, whereby the native valve is removed (surgical aortic valve replacement, SAVR) or a fully collapsible replacement valve is inserted via a catheter (transcatheter aortic valve replacement, TAVR). These surgical procedures come at a high cost and with serious risks; thus, identifying novel therapeutic targets for drug discovery is imperative. To that end, the present study develops a workflow where surgically removed tissues from patients and donor cadaver tissues are used to create patient-specific primary lines of valvular cells for in vitro disease modeling. This protocol introduces the utilization of a cold storage solution, commonly utilized in organ transplant, to reduce the damage caused by the often-lengthy procurement time between tissue excision and laboratory processing with the benefit of greatly stabilizing cells of the excised tissue. The results of the present study demonstrate that isolated valve cells retain their proliferative capacity and endothelial and interstitial phenotypes in culture upwards of several days after valve removal from the donor. Using these materials allows for the collection of control and CAVD cells, from which both control and disease cell lines are established.

This protocol describes the collection of human aortic valves extracted during surgical aortic valve replacement procedures or from cadaveric tissue, and the subsequent isolation, expansion, and characterization of patient specific primary valve endothelial and interstitial cells. Included are important details regarding the processes needed to ensure cell viability and phenotype specificity.

Calcific aortic valve disease (CAVD) is present in nearly a third of the elderly population. Thickening, stiffening, and calcification of the aortic valve ...

Isolation of Mouse Valve Interstitial Cells: An Enzymatic Method to Isolate and Culture VICs from Mouse Aortic Valve

Source: Bouchareb, R. et al. <a href="https://www-jove-com.bdigitaluss.remotexs.co/video/62419" target="_blank">Isolation of Mouse Interstitial Valve Cells to Study the Calcification of the Aortic Valve&#160;In Vitro</a>.&#160;J. Vis. Exp. (2021)
In this video, we demonstrate the isolation of aortic valve interstitial cells from the heart of an adult mouse using a two-step collagenase procedure and their subsequent culture in low volume of growth media.

Source: Bouchareb, R. et al. Isolation of Mouse Interstitial Valve Cells to Study the Calcification of the Aortic Valve&#160;In Vitro.&#160;J. Vis. Exp. ...

JoVE Encyclopedia of Experiments

Rodent Models

Adult

Calcification Assay to Measure Calcium Concentration in Aortic Valve Interstitial Cells

Source: Bouchareb, R. et al., <a href="https://app-jove-com.bdigitaluss.remotexs.co/v/62419">Isolation of Mouse Interstitial Valve Cells to Study the Calcification of the Aortic Valve In Vitro.</a>&#160; J. Vis. Exp. &#160;(2021).
This video demonstrates an assay technique for assessing the calcification of the aortic valve interstitial cells in vitro. The assay helps to quantify the calcium concentration using the arsenazo III reagent, a calcium-sensitive dye that reacts with calcium ions to form a purple-colored calcium-arsenazo complex.

Source: Bouchareb, R. et al., Isolation of Mouse Interstitial Valve Cells to Study the Calcification of the Aortic Valve In Vitro.&#160; J. Vis. Exp. ...

Isolation and Characterization of Primary Rat Valve Interstitial Cells: A New Model to Study Aortic Valve Calcification

Summary

Explore More Videos

Chapters in this video

Isolation and Quantitative Immunocytochemical Characterization of Primary Myogenic Cells and Fibroblasts from Human Skeletal Muscle

Isolation and Characterization of Satellite Cells from Rat Head Branchiomeric Muscles

Isolation of Valvular Endothelial Cells

Calcification of Vascular Smooth Muscle Cells and Imaging of Aortic Calcification and Inflammation

Investigating Aortic Valve Calcification via Isolation and Culture of T Lymphocytes using Feeder Cells from Irradiated Buffy Coat

Isolation of Murine Valve Endothelial Cells

Isolation of Mouse Interstitial Valve Cells to Study the Calcification of the Aortic Valve In Vitro

Isolation of Human Primary Valve Cells for In vitro Disease Modeling

Isolation of Mouse Valve Interstitial Cells: An Enzymatic Method to Isolate and Culture VICs from Mouse Aortic Valve

Calcification Assay to Measure Calcium Concentration in Aortic Valve Interstitial Cells