Name: rapid subtractive patterning of live cell layers with a microfluidic probe
Uploaded: 2016-09-15T12:30:00.000+00:00
Duration: 12 min 19 s
Description: Watch this Scientific Journal Video about Rapid Subtractive Patterning of Live Cell Layers with a Microfluidic Probe at JoVE.com

This work was supported by the European Research Council (ERC) Starting Grant, under the 7th Framework Program (Project No. 311122, BioProbe). We thank Dr. Julien Autebert and Marcel Buerge for technical assistance and discussions during the development of the protocol and the platform. Prof. Petra Dittrich (ETH Zurich), Prof. Bradley Nelson (ETH Zurich), Dr. Bruno Michel and Dr. Walter Riess are acknowledged for their continuous support.

<ol>
	<li>Th&#233;ry, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Micropatterning+as+a+tool+to+decipher+cell+morphogenesis+and+functions.">Micropatterning as a tool to decipher cell morphogenesis and functions.</a> J. Cell Sci. 123 (Pt 24), 4201-4213 (2010).</li><li>Goubko, C. A., Cao, X. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Patterning+multiple+cell+types+in+co-cultures:+A+review.">Patterning multiple cell types in co-cultures: A review.</a> Mater. Sci. Eng. C. 29 (6), 1855-1868 (2009).</li><li>Kaji, H., Camci-Unal, G., Langer, R., Khademhosseini, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Engineering+systems+for+the+generation+of+patterned+co-cultures+for+controlling+cell-cell+interactions.">Engineering systems for the generation of patterned co-cultures for controlling cell-cell interactions.</a> Biochim. Biophys. Acta. 1810 (3), 239-250 (2011).</li><li>Cho, C. H., Park, J., Tilles, A. W., Berthiaume, F., Toner, M., Yarmush, M. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Layered+patterning+of+hepatocytes+in+co-culture+systems+using+microfabricated+stencils.">Layered patterning of hepatocytes in co-culture systems using microfabricated stencils.</a> Biotechniques. 48 (1), 47-52 (2010).</li><li>Sch&#252;tze, K., Lahr, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+expressed+genes+by+laser-mediated+manipulation+of+single+cells.">Identification of expressed genes by laser-mediated manipulation of single cells.</a> Nat. Biotechnol. 16 (8), 737-742 (1998).</li><li>Salazar, G. T. A., Wang, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Micropallet+arrays+for+the+separation+of+single,+adherent+cells.">Micropallet arrays for the separation of single, adherent cells.</a> Anal. Chem. 79 (2), 682-687 (2007).</li><li>Guillaume-Gentil, O., Zambelli, T., Vorholt, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+of+single+mammalian+cells+from+adherent+cultures+by+fluidic+force+microscopy.">Isolation of single mammalian cells from adherent cultures by fluidic force microscopy.</a> Lab Chip. 14 (2), 402-414 (2014).</li><li>Iwata, F., Adachi, M., Hashimoto, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+single-cell+scraper+based+on+an+atomic+force+microscope+for+detaching+a+living+cell+from+a+substrate.">A single-cell scraper based on an atomic force microscope for detaching a living cell from a substrate.</a> J. Appl. Phys. 118 (13), (2015).</li><li>Riahi, R., Yang, Y., Zhang, D. D., Wong, P. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Advances+in+wound-healing+assays+for+probing+collective+cell+migration.">Advances in wound-healing assays for probing collective cell migration.</a> J. Lab. Autom. 17 (1), 59-65 (2012).</li><li>Juncker, D., Schmid, H., Delamarche, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multipurpose+microfluidic+probe.">Multipurpose microfluidic probe.</a> Nat. Mater. 4 (8), 622-628 (2005).</li><li>Kaigala, G. V., Lovchik, R. D., Delamarche, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microfluidics+in+the+&amp;#34;open+space&amp;#34;+for+performing+localized+chemistry+on+biological+interfaces.">Microfluidics in the &amp;#34;open space&amp;#34; for performing localized chemistry on biological interfaces.</a> Angew. Chem. Int. Ed. Engl. 51 (45), 11224-11240 (2012).</li><li>Qasaimeh, M. A., Gervais, T., Juncker, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microfluidic+quadrupole+and+floating+concentration+gradient.">Microfluidic quadrupole and floating concentration gradient.</a> Nat. Commun. 2 (May), 464 (2011).</li><li>Christ, K. V., Turner, K. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Design+of+hydrodynamically+confined+microfluidics:+controlling+flow+envelope+and+pressure.">Design of hydrodynamically confined microfluidics: controlling flow envelope and pressure.</a> Lab Chip. 11 (8), 1491-1501 (2011).</li><li>Autebert, J., Kashyap, A., Lovchik, R. D., Delamarche, E., Kaigala, G. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hierarchical+hydrodynamic+flow+confinement:+efficient+use+and+retrieval+of+chemicals+for+microscale+chemistry+on+surfaces.">Hierarchical hydrodynamic flow confinement: efficient use and retrieval of chemicals for microscale chemistry on surfaces.</a> Langmuir. 30 (12), 3640-3645 (2014).</li><li>Kaigala, G. V., Lovchik, R. D., Drechsler, U., Delamarche, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+Vertical+Microfluidic+Probe.">A Vertical Microfluidic Probe.</a> Langmuir. 27 (9), 5686-5693 (2011).</li><li>Cors, J. F., Lovchik, R. D., Delamarche, E., Kaigala, G. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+compact+and+versatile+microfluidic+probe+for+local+processing+of+tissue+sections+and+biological+specimens.">A compact and versatile microfluidic probe for local processing of tissue sections and biological specimens.</a> Rev. Sci. Instrum. 85 (3), 034301 (2014).</li><li>Pollard, J. W., Walker, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Basic Cell Culture Protocols. , (1997).</li><li>Mitry, R. R., Hughes, D. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+cell+culture+protocols.">Human cell culture protocols.</a> Methods Mol. Biol. Springer. 531 (1), (2012).</li><li>Sakai, K., Ushida, T., Nagase, T., Nakamigawa, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+analysis+of+cell+detachment+by+shear+stress.">Quantitative analysis of cell detachment by shear stress.</a> Mater. Sci. Eng. C. 17 (1-2), 55-58 (2001).</li><li>Rodriguez, N. M., Desai, R. A., Trappmann, B., Baker, B. M., Chen, C. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Micropatterned+multicolor+dynamically+adhesive+substrates+to+control+cell+adhesion+and+multicellular+organization.">Micropatterned multicolor dynamically adhesive substrates to control cell adhesion and multicellular organization.</a> Langmuir. 30 (5), 1327-1335 (2014).</li><li>Tasoglu, S., Demirci, U. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bioprinting+for+stem+cell+research.">Bioprinting for stem cell research.</a> Trends Biotechnol. 31 (1), 10-19 (2013).</li></ol>

The authors have nothing to disclose.

نقدم بروتوكول تنوعا للالزخرفة مطروح من الطبقات الوحيدة الخلية التي تمكن جيل السريع لأنماط الخلايا المحددة مكانيا. يتم تنفيذ تحلل الانتقائي من الطبقات الوحيدة الخلية باستخدام هيدروكسيد الصوديوم كما السائل التجهيز في hHFC. وهيدروكسيد الصوديوم يبدل طبيعة الفور البروتينات الموجودة في غشاء الخلية. نحن نوصي باستخدام 50 التركيز ملي من هيدروكسيد الصوديوم لضمان التجهيز النهائي للالمحللة. ويمكن زيادة هذا التركيز لمزيد من إزالة الخلايا السريعة، شريطة المحللة التجهيز النهائي ليس هدفا. وhHFC يضمن أن المناطق المحيطة بها غير المجهزة من أحادي الطبقة الخلية لا تزال تتأثر وتتوفر لأي توسيع نمط أو التحقيق خصائص أخرى من الخلايا. معدل إزالة الخلايا هي وظيفة كل من الكيمياء والقص التي قدمها التدفق. نختار مجموعة التشغيل من معدلات تدفق لديك الكيمياء إزالة الخلايا المهيمنة. سرعات المسح الضوئي من 10-20 &amp; #تستخدم 8 ميكرولتر / دقيقة لتسهيل &quot;السريع&quot; الزخرفة مطروح - م / ثانية باستخدام معدل تدفق الحقن هيدروكسيد الصوديوم من 6؛ 181. المعدل السريع للإزالة الخلايا يتناول بعض التحديات التي تواجه الطباعة سطح نهج الزخرفة على أساس 20،21. تتطلب هذه الأساليب آلية للحد من نمو الخلايا في مناطق محددة مكانيا، على سبيل المثال، من خلال ترسب الانتقائي للبروتينات التصاق الخلية عن طريق الطباعة الاتصال الصغرى والبذر لاحق من الخلايا للحصول على نمط. تقتصر من قبل إنتاجية منخفضة وتتطلب عدة خطوات متتابعة لتوليد نمط فضلا عن الاستنسل / ختم جديد لكل نمط. لا يتطلب الأسلوب هو موضح النمو الانتقائي للخلايا في مجالات محددة، ويتغلب على العديد من القيود عن طريق أداء الزخرفة مطروح على النقيض من الطباعة، في حين لا تتطلب أي علاج إضافي من الركيزة ثقافة الخلية. مع بروتوكول الواردة في هذه الورقة، ومرت من الطبقات الوحيدة الخلية الزخرفةوزيادة، في حين الحصول على التغذية الراجعة البصرية الفوري للنمط الذي تم إنشاؤه. هذا يسهل تعديل في الوقت الحقيقي من الأنماط. قد تكون هذه السيطرة حاسما في سيناريوهات بقاء الخلية على سطح معين ليست متجانسة. ميزة أخرى لهذا الأسلوب هو أن نفس الرأس والكيمياء يمكن استخدامها لتوليد أنماط متعددة، مما يقلل من عدد من الخطوات المتبعة في توليد أحادي الطبقة خلية المزخرفة. أبعاد القنوات في الرأس والهندسة رئيس يمكن زيادتها وفقا لمتطلبات التطبيق، مما يسمح بالسيطرة على قرار من الزخرفة. تم إجراء جميع التجارب في العمل الحالي باستخدام رأس MFP ذات أبعاد الفتحة الثابتة، وتحديدا مع فتحات داخلية في 100 × 100 ميكرون وفتحات الخارجية في 200 × 100 ميكرون. وقد تم اختيار هذا التصميم مع فتحات الخارجية أكبر لضمان التشغيل المستمر من hHFC دون انسداد فتحات من قبلحطام خلية طائشة. لقد اختبرنا رؤساء ذات أبعاد الفتحة الداخلية 50 × 50 ميكرون و 50 ميكرون تباعد بينهما، وكانت النتائج ناجحة في إزالة الخلايا. استخدام فتحات صغيرة، وصولا الى 10 × 10 ميكرون مع 10 ميكرون تباعد، من شأنه أن يسمح التحجيم إلى حجم البصمة أصغر (~ 30 × 30 ميكرون)، وبالتالي توفير دقة أعلى في الزخرفة. لاحظنا المسائل التشغيلية مع فتحة أحجام أصغر من 10 ميكرون بسبب انسداد من الجسيمات. بسبب هذه الصعوبات التشغيلية، و 100 ميكرون هو الحد الحالي من القرار، وبالتالي الحد من تقنية وصفها. ومع ذلك، يمكننا معالجة هذه باستخدام القدرة تشكيل السائلة من hHFC. لقد أثبتنا أن حل إزالة الخلايا يمكن ضبطها لمجموعة معينة من أبعاد الفتحة عن طريق التحكم س I2 / س I1 (الشكل 4B) والفجوة قمة إلى الركيزة 10،14. المراحل المستخدمة في العمل الحالي لديه الحد الأدنى من حجم خطوة من 100 نانومتر.مزيج من هذه المعلمات السيطرة عليها يمكن أن تحسن دقة مكانية إزالة الخلايا من حيث حجم البصمة وبعد المسح. وإذا رغبت نمط المشترك الثقافات لدراسة التفاعلات خلية خلية معينة بين أنواع مختلفة من الخلايا، بذر متسلسل والزخرفة يمكن القيام بها باستخدام بروتوكول صفها. وأخيرا، الحمض النووي amplifiable ذات جودة عالية يمكن الحصول عليها من المحللة، كما يتضح من ذروة فريدة في الحمض النووي تذوب منحنى (انظر الشكل 7). قمنا بتقييم كمية الحمض النووي لنحو 1.6 نانوغرام من بصمة واحدة (حوالي 300 خلية) باستخدام QPCR، التي هي قريبة من التوقع النظري (6-8 غ / الخلية). وهذا يدل على كمية من الحمض النووي المستخرج مناسبة لعدة عمليات المصب في حين تفادي استخدام أي أساليب عزل الحمض النووي. هذا يفتح آفاقا لالحمض النووي التحليل المستندة المحلية تحقق من الخلايا المستزرعة. ويمكن أيضا القدرة على hHFC لتشكيل السوائل استخدامها لإيداع الخلايا والبروتينات الحية على ميلانالسطوح tivated، والتي في تركيبة مع الزخرفة مطروح ومتتابعة شارك في زراعة الواردة في هذا البروتوكول تمكن من خلق خلية وخلية مصفوفة أنماط معقدة على ركائز الثقافة. براعة والسيطرة التي تقدمها الزخرفة مطروح على أساس hHFC من الطبقات الوحيدة الخلية وإمكانية إجراء تحليل الحمض النووي في الخلايا المستخرجة، ويوفر أداة قوية جديدة لتعيين علماء الأحياء إلى إجراء دراسات حل مكانيا التي تنطوي على تفاعلات الخلية.

في بيئتهم المحلية، والخلايا في الأنسجة البيولوجية تنظر مجموعة من الإشارات البيوكيميائية والفيزيائية توجيه نموها، والتنظيم، والتنمية. فهم هذه العظة يتطلب التحقيق الانتقائي للخلية خلية وخلية مصفوفة التفاعلات. وهذا يتطلب تطوير أساليب الطبقات الوحيدة الخلية الزخرفة. الأساليب لمنفصلة هندسيا أنواع مختلفة من الخلايا في الثقافة (الزخرفة) تمكين دراسات واسعة من الإشارات الفيزيائية والكيميائية في بيولوجيا الخلية. معظم النهج الحالية لطبقات الخلايا الزخرفة 1-4 تعتمد على إيداع بروتينات الخلية الالتصاق على السطوح أو استخدام الإستنسل microfabricated للنمو الانتقائي على ركائز. في المقابل، هنا نقدم طريقة لبسرعة الطبقات الوحيدة الخلية نمط في الموقع، أي خلايا في الثقافة، عن طريق إزالة الخلايا في مناطق مختارة من أحادي الطبقة. الأساليب التي تؤدي هذا مطروح الزخرفة 5-9 usuaتتطلب LLY ركائز المتخصصة، والمعالجة السطحية، عملية معقدة، الاتصال الجسدي أو الاجتثاث باستخدام الليزر، مما يؤثر عن غير قصد الخلايا الحية. نحن هنا استخدام مسبار ميكروفلويديك (MFP) 10،11، عدم الاتصال مسح تكنولوجيا ميكروفلويديك أن تحصر hydrodynamically السائل على ركيزة. عنصر واحد مهم من MFP هو رئيس microfabricated تحتوي على microchannels (الشكل 1). تتكون منصة المرتبطة مضخات حقنة من أجل السيطرة السائلة، مراحل لمسح السيطرة ومجهر مقلوب لتصور وردود الفعل (الشكل 2). ، يضم رئيس MFP في التكوين الأساسي وهما microchannels مع فتحات في ذروة، واحدة لحقن السائل تجهيز والآخر لالشفط السائل معالجة حقن جنبا إلى جنب مع بعض السائل الغمر (الشكل 3A). خلال عملية MFP، قمة هي على مسافة ثابتة من الركيزة. عندما يكون معدل تدفق الطموح (QA) هو sufficieأعلى ntly من معدل تدفق الحقن (س ط)، أي سؤال من: س ط ≥ 2.5، يقتصر السائل المعالجة على الركيزة. وهذا يؤدي إلى حبس تدفق الهيدروديناميكية (HFC). ويطلق على المنطقة التي السائل المعالجة في اتصال مباشر مع الركيزة البصمة. لظروف التشغيل العادية، وتدفق السائل المعالجة في إطار HFC يتميز عدد رينولدز منخفضة (إعادة ≈ 10 -2) وعدد كبير Péclet (بي ≈ 10 2). وهذا يعني تدفق السائل في نظام الصفحي مع الحمل يكون هو الوسيلة الأساسية للنقل الجماعي من الأنواع الكيميائية. يتم وصف النماذج العددية والتحليلية للحبس تدفق أماكن أخرى 12-14. في هذه الورقة، ونحن نستخدم هذا النهج من حصر في وقت واحد السوائل معالجة متعددة، وهو ما يسمى HFC الهرمي (hHFC) 14. لتنفيذ hHFC مع MFP، وهما additionaوهناك حاجة إلى فتحات لتر إلى توفير مصدر ثانوي للحقن والطموح. وهذا يتيح لنا أن نحصر السائل واحدة داخل السائل الثاني. والداخلية فوائد (معالجة) السائل من أن محمية من الحطام طائشة على الركيزة التي (التدريع) السائل الخارجي. وبالإضافة إلى ذلك، hHFC يسمح العملية في وضعين: (ط) وضع المتداخلة، التي السائل المعالجة في الاتصالات HFC الداخلية السطح (الشكل 3B)، و (ب) وضع مقروص، والذي يفقد السائل الداخلي الاتصال و فقط السائل الخارجي في اتصال مع الركيزة (الشكل 3C). التبديل بين وضعي يسمح للمستخدمين لإحداث أو إيقاف معالجة الركيزة ويتحقق عن طريق التحكم في الفجوة الرأس إلى السطح أو عن طريق تغيير النسبة بين التدفقات حقن (Q شركة i2 / س I1). للهندسة قناة معينة، البصمة للسائل المعالجة على ركيزة يمكن السيطرة عليها عن طريق تحوير ظروف تدفق (الشكل 3D). HYDR الصوديومأكسيد (هيدروكسيد الصوديوم) يتم استخدام السائل تجهيز الداخلي لليز الخلايا، ويستنشق المحللة باستمرار من السطح. لأنه يتم ترجمة الآثار الكيميائية للسائل المعالجة إلى بصمة HFC الداخلية، تبقى الخلايا المجاورة رابط الجأش، والذي يسمح الدراسات الزمانية المكانية من التفاعلات خلية خلية. وظيفة المسح الضوئي للطابعة متعددة الوظائف تسمح للإنشاء وهندستها المعرفة من أنماط الخلية (الشكل 4). وعلاوة على ذلك، واختيار من هيدروكسيد الصوديوم مثل تجهيز السائل يستوعب تحليل الحمض النووي المصب (الشكل 7).

<table><tbody><tr><td colspan="4">&lt;strong&gt;Materials&lt;/strong&gt;</td></tr><tr><td>Microfluidic Probe (MFP)</td><td></td><td></td><td>Silicon/glass hybrid probe head with channels patterned in silicon. Fabrication done in-house at IBM Research - Z&amp;uuml;rich</td></tr><tr><td>Lab Tek II Chamber slides with 2 chambers</td><td>ThermoFisher scientific, USA</td><td>154461</td><td>2 Chamber chamber slides for cell culture with each chamber providing an area of 4 cm&lt;sup&gt;2&lt;/sup&gt; and capable of holding up to 3 ml of media volume</td></tr><tr><td colspan="4">&lt;strong&gt;Chemicals and cell lines&lt;/strong&gt;</td></tr><tr><td>Sodium Hydroxide, Tris-Cl, Ethylenediaminetetraaceticacid, Rhodamine B</td><td>SigmaAldrich chemicals, USA</td><td>S5881, 252859,&amp;nbsp; E9884, R6626</td><td>Chemicals used for processing and shielding liquids</td></tr><tr><td>Proteinase K</td><td>Qiagen, Germany</td><td>19131</td><td>protease to digest denatuired proteins</td></tr><tr><td>Deconex 16 Plus</td><td>Bohrer Chemie, Switzerland</td><td></td><td>Universal cleaning agent for labaratory consumables. Used for non stringent cleaning.</td></tr><tr><td>DNA away&amp;nbsp;</td><td>ThermoFisher scientific, USA</td><td>7010</td><td>Surface decontaminant that denatures DNA and DNAases.</td></tr><tr><td>DMEM, high glucose, GLUTAMAX supplement</td><td>ThermoFisher scientific, USA</td><td>10566-016</td><td>Culturing medium for epithelial cells.</td></tr><tr><td>CellTracker Green CMFDA dye</td><td>ThermoFisher scientific, USA</td><td>C7025</td><td>Membrane permeant live cell labeling dye. Dye active for 72 hours.</td></tr><tr><td>CellTracker Orange CMRA dye</td><td>ThermoFisher scientific, USA</td><td>C34551</td><td></td></tr><tr><td>&amp;beta;-actin genomic primers for qPCR</td><td>Integrated DNA technologies, USA</td><td></td><td>Custom oligos used for DNA quality validation and qPCR.</td></tr><tr><td>MCF7 breast carcinoma cells</td><td>ATCC, USA</td><td>ATCC HTB-22</td><td>Cell lines used to produce co-cultures.</td></tr><tr><td>MDA-MB-231 breast carcinoma cells</td><td>ATCC, USA</td><td>ATCC HTB-26</td><td></td></tr><tr><td colspan="4">&lt;strong&gt;Equipment and fluidic connections&lt;/strong&gt;</td></tr><tr><td>Motorized high precision stages</td><td>Custom machined components.&amp;nbsp; Linear axis motors from LANG GmBH, Germany</td><td>Customized linear axis stages from LT series</td><td>3 &amp;times; LT for 3 axes. LSTEP controller used for interfacing stages and PC through RS 232 port.</td></tr><tr><td>Syringes</td><td>Hamilton, Switzerland</td><td>1700 TLLX series</td><td>Interchangeable with syringes provided by other manufacturers with a 250-500 &amp;micro;l range.</td></tr><tr><td>Nemesys low pressure syringe pumps</td><td>cetoni GmbH, Germany</td><td></td><td>Component of pumping station.</td></tr><tr><td>Circular M1-connector</td><td>Dolomite microfluidics, United Kingdom&amp;nbsp;</td><td>3000051</td><td>Interface between vias in MFP head and tubing</td></tr><tr><td>Tilt/rotation stage Goniometer</td><td>OptoSigma, USA</td><td>KKD-25C</td><td>Goniometer to adjust coplanarity of MFP apex</td></tr><tr><td>DS Fi2 HD color camera (CCD)&amp;nbsp;</td><td>Nikon, Switzerland</td><td></td><td>Controlled using DS-U3 controller unit</td></tr><tr><td colspan="4">&lt;strong&gt;Software&lt;/strong&gt;</td></tr><tr><td>Win - Commander</td><td>LANG GmBH, Germany</td><td></td><td>Stage control software.</td></tr><tr><td>Qmix Elements</td><td>cetoni GmbH, Germany</td><td></td><td>Pump control software.</td></tr><tr><td>NIS Elements</td><td>Nikon, Switzerland</td><td></td><td>Basic research module for image acquisition and analysis.</td></tr></tbody></table>

rapid subtractive patterning of live cell layers with a microfluidic probe

التحقيق ميكروفلويديك (MFP) يسهل أداء الكيمياء المحلي على ركائز البيولوجية عن طريق حصر كميات نانولتر من السوائل. باستخدام تطبيق واحد معين من MFP، وهرمي الهيدروديناميكية الحبس تدفق (hHFC)، يتم جلب السوائل متعددة في وقت واحد في اتصال مع الركيزة. مفعولها الكيميائي المحلي وتشكيل السائل باستخدام hHFC، واستغلالها لخلق أنماط الخلية عن طريق الناشر محليا وإزالة الخلايا. من خلال الاستفادة من القدرة المسح الضوئي من خلال الجهاز نفسه، يتم إنشاء أنماط المعرفة من الطبقات الوحيدة الخلية. هذا البروتوكول يتيح السريع، في الوقت الحقيقي وتسيطر مكانيا الزخرفة الخلية، والتي يمكن أن تسمح انتقائية خلية خلية وخلية مصفوفة دراسات التفاعل.

ويتجلى بروتوكول صفها لتنميط مطروح السريع من الطبقات الوحيدة الخلية باستخدام منصة متعددة عنصر MFP (الشكلان 1 و 2). بروتوكول توظف الهرمي الهيدروديناميكية تدفق الحبس (hHFC، الشكل 3) لعلاج محليا وإزالة الخلايا من الطبقات الوحيدة الخلية، وذلك باستخدام هيدروكسيد الصوديوم كما السائل المعالجة. ويتألف التكوين hHFC على HFC الداخلي والخارجي HFC. وهيدروكسيد الصوديوم محصورة في hHFC الداخلية يدخل مفعولها الكيميائي والقص على الخلايا على اتصال. ضمن هذه البصمة، تتعرض الخلايا متجانس لعمل مادة كيميائية من هيدروكسيد الصوديوم، بسبب الحمل الحراري مدفوعة نقل الجماعي داخل ومع نشر يذكر أن هذه المنطقة خارج الحبس. القص على الخلايا من ناحية أخرى، يمكن أن يتغير من خلال تغيير معدل التدفق من هيدروكسيد الصوديوم. لتبسيط المعايير التشغيلية، اخترنا لجعل العمل الكيميائي الآلية الغالبة على إزالة الخلايا بالمقارنة مع القص. إلىتقدير قوة القص المطبقة من قبل hHFC على السطح، تم بناء نموذج محدود عنصر باستخدام COMSOL Multiphysics 5.0. تم تشغيل المحاكاة باستخدام وحدة CFD للتدفقات الصفحي. تم تطبيق شرطين الحدود مدخل إلى فتحات حقن للهندسة واثنين من الشروط الحدية منفذ لفتحات الطموح (الشكل 5) لمجموعة من معدلات التدفق وأبعاد الفتحة المستخدمة في مظاهرة الحالية. في نموذج تم الحصول عليها، أملت قواعد تدفق البيانات الشخصية القص، في حين أن معدلات تدفق حددت حجم القص على السطح. عمليا، مزيج من الاثنين معا يحدد إذا كان hHFC الاتصالات السطح. حفظ هذه العوامل في الاعتبار، وشرعنا في العثور على مجموعة من معدلات تدفق للتشغيل من أجل الحصول على إزالة الخلايا المسيطرة كيميائيا. لإنشاء hHFC، ونحن نستخدم القاعدة تدفق من الطموح الكلي لحقن نسبة معدل تدفق 3.5. لقد حددت القواعد تدفق الأخرى المستخدمة للحد من انسداد في قنوات الطموح،والتي يمكن أن تسببها البروتينات التشويه والتحريف التمسك الأسطح القناة. باستخدام النموذج المطور، وجدنا معدلات تدفق 5-10 ميكرولتر / دقيقة ترجمة لإجهاد القص بين 1 و 3 N / م 2. دون التأثير الكيميائي للهيدروكسيد الصوديوم، على سبيل المثال في حالة استخراج العازلة، وإجهاد القص لن تكون مرتفعة بما يكفي لإزالة الخلايا 19. ضمن نطاق الملحوظ، نلاحظ أن العملية في معدلات التدفق العالي هي أكثر واقعية نظرا للاضطرابات في مسار التدفق في انخفاض معدلات تدفق الطموح (أي س I2 &lt;4 ميكرولتر / دقيقة) بسبب الحطام خلية في القنوات. وبالنظر إلى الملف الشخصي القص درس والاعتبارات العملية، ومعدلات تدفق هيدروكسيد الصوديوم (س I2) بين 6 و 8 ميكرولتر / دقيقة تستخدم لتجارب الزخرفة وس I1، س A1 وس A2 وفقا للقواعد تدفق هو مبين في الشكل (3). ونسبة التدفقات حقن (س I2 / س I1) يسمح شالصورة لمواصلة تعدل حجم البصمة hHFC (الشكل 3D) والشكل (4B)، مع المبدأ الأساسي الذي وضعته Autebert وآخرون. 14. باستخدام قدرة السائل تشكيل لhHFC مقرونا عالية الدقة قدرة المسح من منصة MFP، علينا أن نظهر الجيل شبكة الخلية الحية على مستويات متعددة وتظهر علاوة على ذلك تطبيق بروتوكول معين في تطوير المشترك الثقافات (الشكل 4C). كما يسمح النظام الأساسي لنا لأداء عينة استرجاع المحللة لتحليل المصب. لإظهار جودة المحللة التي تم الحصول عليها، ونحن عينات هي lysed محليا الخلايا من واحد وخمسة أقدام في تجربتين مستقلة، والتي تبين الاختلاف في كميات من الحمض النووي التي تم الحصول عليها من المحللة (الشكل 7). هنا، نحن تضخيم الحمض النووي الواردة في المحللة باستخدام بادئات بيتا الأكتين (إلى الأمام: GGATGCAGAAGGAGATCACT وعكس: CGATCCACACGGAGTACTTG<html> ) باستخدام 4 ميكرولتر من المحللة تحييد في كل رد فعل PCR. <img alt="شكل 1" src="/files/ftp_upload/54447/54447fig1.jpg" /> الشكل 1. وحدات من منصة MFP والرأس. (A) وحدات التشغيلية للمنصة تشتمل بمحركات الحقن، ومراحل الآلية وحدة تحكم. توصيل MFP إلى Z-مرحلة الآلية للسيطرة على مسافة الفجوة بين الرأس والركيزة، ويتم إرفاق حامل الركيزة إلى X- ومراحل بمحركات Y-تشكل نظام المسح الضوئي. (ب) رئيس MFP ديه فيا الموائعية لربط محطة الضخ، وتصاعد الثقوب لتركيب رأس على المرحلة Z، والقنوات التي يخرج من قمة مصقول. تم تعيين قمة متحد المستوى إلى الركيزة ثقافة الخلية. حلقات متماثل نيوتن يمكن ملاحظتها عند قمة والركيزة هي متحد المستوى وعلى اتصال.<html> p_upload / 54447 / 54447fig1large.jpg &quot;الهدف =&quot; _ فارغة &quot;&gt; الرجاء انقر هنا لعرض نسخة أكبر من هذا الرقم. <img alt="الشكل 2" src="/files/ftp_upload/54447/54447fig2.jpg" /> الشكل 2. منصة MFP. وقد تم تجهيز منصة المسح الضوئي عالية الدقة مع صاحب الرأس تشكيله التواصل مع Z-مرحلة عالية الدقة المزودة بمحركات. توصيل حامل الركيزة لمرحلة XY لأغراض الفحص. لاسترداد المحللة لتحليل المصب، يتم قص محطة أخذ العينات 3D المطبوعة مغناطيسيا إلى جانب حامل الركيزة (كما هو موضح في الشكل). وتقع مضخات الحقنة، مجهر مقلوب، وأجهزة التحكم ويعرض في جميع أنحاء منصة. <a href="https://www-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/54447/54447fig2large.jpg" target="_blank">يرجى النقر هنا لمشاهدة نسخة أكبر من هذا الرقم.</a> 3 &quot;SRC =&quot; / ملفات / ftp_upload / 54447 / 54447fig3.jpg &quot;/&gt; الشكل 3. الهرمي الحبس تدفق الهيدروديناميكية (hHFC) من أجل السيطرة المكانية والزمانية لإزالة الخلايا. (A) تخطيطي لHFC واحد. (ب) متداخل و (C) مقروص طريقة عملها hHFC. (D) صورة البصمة لمدة نسب مختلفة تدفق الحقن / الطموح. <a href="https://www-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/54447/54447fig3large.jpg" target="_blank">الرجاء انقر هنا لعرض نسخة أكبر من هذا الرقم.</a> <img alt="الشكل (4)" src="/files/ftp_upload/54447/54447fig4.jpg" /> الشكل 4. أنماط الطبقات الوحيدة الخلية باستخدام طابعة متعددة الوظائف. (A) الجيل الخلوي الشبكة عن طريق المسح الضوئي المبرمج للMFP على خلية أحادي الطبقة MDA-MB-231. كانت ملطخة الخلايا مع الأخضر خلية تعقب صبغ. (ب) بصمة لنسب حقن مختلفة (ن) على الخلية أحادي الطبقة MCF7. يظهر التخطيطي الاختلاف المتوقع في شكل HFC الداخلي مع وجود تغيير في ن. (C) منقوشة الثقافة المشتركة التي كتبها الزخرفة مطروح من MCF7 أحادي الطبقة تليها البذر MDA-MB-231 الخلايا في مناطق مطروح. <a href="https://www-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/54447/54447fig4large.jpg" target="_blank">الرجاء انقر هنا لعرض نسخة أكبر من هذا الرقم.</a> <img alt="الرقم 5" src="/files/ftp_upload/54447/54447fig5.jpg" /> الرقم 5. الإجهاد القص على السطح عند تطبيق hHFC. وإجهاد القص على ارتفاع سطح خطيا مع معدل تدفق الحقن الداخلي. وتوجد أعلى نقطة القص بين اثنين من فتحات الداخلية (أقحم الأيمن السفلي)، حيث يقتصر السائل تجهيز (خطوط تدفق الأحمر، أكبر أقحم الأيسر). أبعاد الفتحة المستخدمة في النموذج محدود عنصر هم 200 و 100 و 100 و 200 ميكرون لI1، I2، A1و A2 على التوالي. <a href="https://www-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/54447/54447fig5large.jpg" target="_blank">الرجاء انقر هنا لعرض نسخة أكبر من هذا الرقم.</a> <img alt="الشكل (6)" src="/files/ftp_upload/54447/54447fig6.jpg" /> الشكل 6. تشغيل وسائط من منصة MFP لأداء إزالة الخلايا والزخرفة. (A) تخطيطي لمسار تدفق للالزخرفة مطروح من قبل تحلل الخلية. للبساطة، وتظهر واحدة فقط من كل الحقن وتدفق طموح المسارات. تمتلئ الحقن باستخدام صمام استنزاف في المضخات. وتستخدم I1 و I2 لحقن استخراج العازلة وهيدروكسيد الصوديوم، على التوالي. (ب) رسم تخطيطي للمسار تدفق للانتعاش المحللة. يتم تنشيط هذا مسار تدفق بعد جمع الخلايا المحللة للتحليل باستخدام مسار تدفق في الفقرة (أ). <a href="https://www-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/54447/54447fig6large.jpg" target="_blank">الرجاء أنقر</a>ك هنا لمشاهدة نسخة أكبر من هذا الرقم. <img alt="الرقم 7" src="/files/ftp_upload/54447/54447fig7.jpg" /> الرقم 7. تحليل المصب من الحمض النووي من المحللة الخلية باستخدام QPCR. المؤامرات (A) التضخيم من الحمض النووي في المحللة المستخرجة من 5 أقدام (5 FP) و 1 بصمة (1 FP). تم استخراج الضوابط بعد جمع المحللة لكلتا الحالتين. (ب) تذوب منحنيات تضخيم الحمض النووي من المحللة تبين نوعية الحمض النووي المستخرج. تم تنفيذ QPCR (N = 2، ن = 3) لتضخيم الجينات β الأكتين. <a href="https://www-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/54447/54447fig7large.jpg" target="_blank">الرجاء انقر هنا لعرض نسخة أكبر من هذا الرقم.</a> <img alt="الأرقام" src="/files/ftp_upload/54447/54447figS.jpg" /> شخصية S1. صورة مصغرة من تصميم قناة لرئيس MFP 6 قنواتتستخدم للتجارب الزخرفة. القنوات أداء hHFC هي 200، 100، 100، 200 ميكرون واسع، و 100 ميكرون عميق. القنوات الأبعد اللذين تجديد الغمر السائل هي 500 ميكرون واسع و 100 ميكرون عميقة. وقد تم تقديم ملف GDS لنفس التصميم ومكملا لهذه المادة. <a href="https://www-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/54447/54447figSlarge.jpg" target="_blank">يرجى النقر هنا لمشاهدة نسخة أكبر من هذا الرقم.</a>

Watch this Scientific Journal Video about Rapid Subtractive Patterning of Live Cell Layers with a Microfluidic Probe at JoVE.com

Rapid Subtractive Patterning of Live Cell Layers with a Microfluidic Probe

We present a protocol to perform subtractive patterning of live cell monolayers on a surface. This is achieved by local and selective lysis of adherent cells using a microfluidic probe (MFP). The cell lysate retrieved from local regions can be used for downstream analysis, enabling molecular profiling studies.

الزخرفة مطروح السريع لطبقات الخلايا الحية مع التحقيق ميكروفلويديك

The microfluidic probe (MFP) facilitates performing local chemistry on biological substrates by confining nanoliter volumes of liquids. Using one ...

rapid-subtractive-patterning-live-cell-layers-with-microfluidic

Universidad San Sebastian

Research

JoVE Journal

Bioengineering

7.0K Views.  IBM Research - Zurich. We present a protocol to perform subtractive patterning of live cell monolayers on a surface. This is achieved by local and selective lysis of adherent cells using a microfluidic probe (MFP). The cell lysate retrieved from local regions can be used for downstream analysis, enabling molecular profiling studies.

Video: Rapid Subtractive Patterning of Live Cell Layers with a Microfluidic Probe

A Microfluidic Device with Groove Patterns for Studying Cellular Behavior

We describe a microfluidic device with microgrooved patterns for studying cellular behavior. This microfluidic platform consists of a top fluidic channel and a bottom microgrooved substrate. To fabricate the microgrooved channels, a top poly(dimethylsiloxane) (PDMS) mold containing the impression of the microfluidic channels was aligned and bonded to a microgrooved substrate. Using this device, mouse fibroblast cells were immobilized and patterned within microgrooved substrates (25, 50, 75, and 100 &mu;m wide). To study apoptosis in a microfluidic device, media containing hydrogen peroxide, Annexin V, and propidium iodide was perfused into the fluidic channel for 2 hours. We found that cells exposed to the oxidative stress became apoptotic. These apoptotic cells were confirmed by Annexin V that bound to phosphatidylserine at the outer leaflet of the plasma membrane during the apoptosis process. Using this microfluidic device with microgrooved patterns, the apoptosis process was observed in real-time and analyzed by using an inverted microscope containing an incubation chamber (37&deg;C, 5% CO2). Therefore, this microfluidic device incorporated with microgrooved substrates could be useful for studying the cellular behavior and performing high-throughput drug screening.

We describe a protocol for the fabrication of microfluidic devices that can enable cell capture and culture. In this approach patterned microstructures such as grooves within microfluidic channels are used to create low shear stress regions within which cell can dock.

جهاز ميكروفلويديك مع أنماط Groove لدراسة السلوك الخليوي

We describe a microfluidic device with microgrooved patterns for studying cellular behavior.  This microfluidic platform consists of a top fluidic channel ...

Biology

Patterning of Embryonic Stem Cells Using the Bio Flip Chip

Cell-cell interactions consisting of diffusible signaling and cell-cell contact (juxtacrine signaling) are important in numerous biological processes such as tumor growth, stem cell differentiation, and stem cell self-renewal. A number of methods currently exist to modulate cell signaling in vitro. One method of modulating the total amount of diffusible signaling is to vary the cell seeding density during culture. Due to the random nature of cell seeding, this results in considerable variation in the actual cell-cell spacing and amount of cell-cell contact, and cannot prescribe the local environment. A more specific approach for modulating cell signaling is to use molecular inhibitors or genetic approaches to knock down specific signaling proteins, but both of these methods are best suited to manipulating small numbers of molecules. Here, we demonstrate a new approach to modulating cell-cell signaling that modulates the local environment of a cluster of cells by placing different numbers of cells at desired locations on a substrate. This method provides a complementary way to control the local diffusible and juxtacrine signaling between cells. Our method makes use of the Bio Flip Chip (BFC), a microfabricated silicone chip containing hundreds-to-thousands of microwells, each sized to hold either a single cell or small numbers of cells. We load the chip with cells simply by pipetting them onto the array of wells and washing unloaded cells off the array. The chip is then flipped onto a substrate, whereby the cells fall out of the wells and onto the substrate, maintaining their patterning. After the cells have attached, the chip can be removed (or left on). This approach to cell patterning is unique in that it: 1) doesn't alter the chemistry of the substrate, thus allowing cells to proliferate and migrate; 2) allows patterning onto any substrate, including tissue-culture polystyrene, glass, matrigel, and even feeder cell layers; and 3) is compatible with traditional microcontact printing, allowing the creation of extracellular matrix islands with cells placed inside those islands. In this video, we demonstrate the patterning of mouse embryonic stem cells onto tissue-culture polystyrene using the BFC.

We demonstrate a simple method for placing cells at desired locations on a substrate. This method patterns cells by flipping a silicone chip containing microwells filled with cells onto the substrate. This method provides a new way to modulate diffusible and juxtacrine signaling between cells.

الزخرفة من الخلايا الجذعية الجنينية باستخدام رقاقة بيو فليب

Cell-cell interactions consisting of diffusible signaling and cell-cell contact (juxtacrine signaling) are important in numerous biological processes such ...

A Microfluidic Device for Studying Multiple Distinct Strains

The study of cell responses to environmental changes poses many experimental challenges: cells need to be imaged under changing conditions, often in a comparative manner. Multiwell plates are routinely used to compare many different strains or cell lines, but allow limited control over the environment dynamics. Microfluidic devices, on the other hand, allow exquisite dynamic control over the surrounding conditions, but it is challenging to image and distinguish more than a few strains in them. Here we describe a method to easily and rapidly manufacture a microfluidic device capable of applying dynamically changing conditions to multiple distinct yeast strains in one channel. The device is designed and manufactured by simple means without the need for soft lithography. It is composed of a Y-shaped flow channel attached to a second layer harboring microwells. The strains are placed in separate microwells, and imaged under the exact same dynamic conditions. We demonstrate the use of the device for measuring protein localization responses to pulses of nutrient changes in different yeast strains.

We present a simple method to produce microfluidic devices capable of applying similar dynamic conditions to multiple distinct strains, without the need for a clean room or soft lithography.

جهاز ميكروفلويديك لدراسة سلالات متميزة متعددة

The study of cell responses to environmental changes poses many experimental challenges: cells need to be imaged under changing conditions, often in a ...

A Microfluidic Technique to Probe Cell Deformability

Here we detail the design, fabrication, and use of a microfluidic device to evaluate the deformability of a large number of individual cells in an efficient manner. Typically, data for ~102 cells can be acquired within a 1 hr experiment. An automated image analysis program enables efficient post-experiment analysis of image data, enabling processing to be complete within a few hours. Our device geometry is unique in that cells must deform through a series of micron-scale constrictions, thereby enabling the initial deformation and time-dependent relaxation of individual cells to be assayed. The applicability of this method to human promyelocytic leukemia (HL-60) cells is demonstrated. Driving cells to deform through micron-scale constrictions using pressure-driven flow, we observe that human promyelocytic (HL-60) cells momentarily occlude the first constriction for a median time of 9.3 msec before passaging more quickly through the subsequent constrictions with a median transit time of 4.0 msec per constriction. By contrast, all-trans retinoic acid-treated (neutrophil-type) HL-60 cells occlude the first constriction for only 4.3 msec before passaging through the subsequent constrictions with a median transit time of 3.3 msec. This method can provide insight into the viscoelastic nature of cells, and ultimately reveal the molecular origins of this behavior.

We demonstrate a microfluidics-based assay to measure the timescale for cells to transit through a sequence of micron-scale constrictions.

تقنية ميكروفلويديك للتحقيق التشوه خلية

Here we detail the design, fabrication, and use of a microfluidic device to evaluate the deformability of a large number of individual cells in an ...

The Microfluidic Probe: Operation and Use for Localized Surface Processing

Microfluidic devices allow assays to be performed using minute amounts of sample and have recently been used to control the microenvironment of cells. Microfluidics is commonly associated with closed microchannels which limit their use to samples that can be introduced, and cultured in the case of cells, within a confined volume. On the other hand, micropipetting system have been used to locally perfuse cells and surfaces, notably using push-pull setups where one pipette acts as source and the other one as sink, but the confinement of the flow is difficult in three dimensions. Furthermore, pipettes are fragile and difficult to position and hence are used in static configuration only. 
The microfluidic probe (MFP) circumvents the constraints imposed by the construction of closed microfluidic channels and instead of enclosing the sample into the microfluidic system, the microfluidic flow can be directly delivered onto the sample, and scanned across the sample, using the MFP. . The injection and aspiration openings are located within a few tens of micrometers of one another so that a microjet injected into the gap is confined by the hydrodynamic forces of the surrounding liquid and entirely aspirated back into the other opening. The microjet can be flushed across the substrate surface and provides a precise tool for localized deposition/delivery of reagents which can be used over large areas by scanning the probe across the surface. 
In this video we present the microfluidic probe1 (MFP). We explain in detail how to assemble the MFP, mount it atop an inverted microscope, and align it relative to the substrate surface, and finally show how to use it to process a substrate surface immersed in a buffer.

In this video we present the microfluidic probe1 (MFP). We explain in detail how to assemble the MFP, mount it atop an inverted microscope, and align it relative to the substrate surface, and finally show how to use it to process a substrate surface immersed in a buffer solution.

ودقق ميكروفلويديك : تشغيل واستخدام لتصنيع السطحي المترجمة

Microfluidic devices allow assays to be performed using minute amounts of sample and have recently been used to control the microenvironment of cells. ...

Preparation of Neuronal Co-cultures with Single Cell Precision

Microfluidic embodiments of the Campenot chamber have attracted great interest from the neuroscience community. These interconnected co-culture platforms can be used to investigate a variety of questions, spanning developmental and functional neurobiology to infection and disease propagation. However, conventional systems require significant cellular inputs (many thousands per compartment), inadequate for studying low abundance cells, such as primary dopaminergic substantia nigra, spiral ganglia, and Drosophilia melanogaster neurons, and impractical for high throughput experimentation. The dense cultures are also highly locally entangled, with few outgrowths (&#60;10%) interconnecting the two cultures. In this paper straightforward microfluidic and patterning protocols are described which address these challenges: (i) a microfluidic single neuron arraying method, and (ii) a water masking method for plasma patterning biomaterial coatings to register neurons and promote outgrowth between compartments. Minimalistic neuronal co-cultures were prepared with high-level (&#62;85%) intercompartment connectivity and can be used for high throughput neurobiology experiments with single cell precision.

Protocols for single neuron microfluidic arraying and water masking for the in-chip plasma patterning of biomaterial coatings are described. Highly interconnected co-cultures can be prepared using minimal cell inputs.

إعداد العصبية المشارك الثقافات واحدة مع الدقة الخليوي

Microfluidic embodiments of the Campenot chamber have attracted great interest from the neuroscience community. These interconnected co-culture platforms ...

Neuroscience

Patterning of Microorganisms and Microparticles through Sequential Capillarity-assisted Assembly

Controlled patterning of microorganisms into defined spatial arrangements offers unique possibilities for a broad range of biological applications, including studies of microbial physiology and interactions. At the simplest level, accurate spatial patterning of microorganisms would enable reliable, long-term imaging of large numbers of individual cells and transform the ability to quantitatively study distance-dependent microbe-microbe interactions. More uniquely, coupling accurate spatial patterning and full control over environmental conditions, as offered by microfluidic technology, would provide a powerful and versatile platform for single-cell studies in microbial ecology. 
This paper presents a microfluidic platform to produce versatile and user-defined patterns of microorganisms within a microfluidic channel, allowing complete optical access for long-term, high-throughput monitoring. This new microfluidic technology is based on capillarity-assisted particle assembly and exploits the capillary forces arising from the controlled motion of an evaporating suspension inside a microfluidic channel to deposit individual microsized objects in an array of traps microfabricated onto a polydimethylsiloxane (PDMS) substrate. Sequential depositions generate the desired spatial layout of single or multiple types of micro-sized objects, dictated solely by the geometry of the traps and the filling sequence. 
The platform has been calibrated using colloidal particles of different dimensions and materials: it has proven to be a powerful tool to generate diverse colloidal patterns and perform surface functionalization of trapped particles. Furthermore, the platform was tested on microbial cells, using Escherichia coli cells as a model bacterium. Thousands of individual cells were patterned on the surface, and their growth was monitored over time. In this platform, the coupling of single-cell deposition and microfluidic technology allows both geometric patterning of microorganisms and precise control of environmental conditions. It thus opens a window into the physiology of single microbes and the ecology of microbe-microbe interactions, as shown by preliminary experiments.

We present a technology that uses capillarity-assisted assembly in a microfluidic platform to pattern micro-sized objects suspended in a liquid, such as bacteria and colloids, into prescribed arrays on a polydimethylsiloxane substrate.

نمط الكائنات الحية الدقيقة والجسيمات الدقيقة من خلال التجميع المتسلسل بمساعدة الشعيرات الدموية

Controlled patterning of microorganisms into defined spatial arrangements offers unique possibilities for a broad range of biological applications, ...

Engineering

A Microfluidic System with Surface Patterning for Investigating Cavitation Bubble(s)&#8211;Cell Interaction and the Resultant Bioeffects at the Single-cell Level

In this manuscript, we first describe the fabrication protocol of a microfluidic chip, with gold dots and fibronectin-coated regions on the same glass substrate, that precisely controls the generation of tandem bubbles and individual cells patterned nearby with well-defined locations and shapes. We then demonstrate the generation of tandem bubbles by using two pulsed lasers illuminating a pair of gold dots with a few-microsecond time delay. We visualize the bubble-bubble interaction and jet formation by high-speed imaging and characterize the resultant flow field using particle image velocimetry (PIV). Finally, we present some applications of this technique for single cell analysis, including cell membrane poration with macromolecule uptake, localized membrane deformation determined by the displacements of attached integrin-binding beads, and intracellular calcium response from ratiometric imaging. Our results show that a fast and directional jetting flow is produced by the tandem bubble interaction, which can impose a highly localized shear stress on the surface of a cell grown in close proximity. Furthermore, different bioeffects can be induced by altering the strength of the jetting flow by adjusting the standoff distance from the cell to the tandem bubbles.

A microfluidic chip was fabricated to produce pairs of gold dots for tandem bubble generation and fibronectin-coated islands for single-cell patterning nearby. The resultant flow field was characterized by particle image velocimetry and was employed to study various bioeffects, including cell membrane poration, membrane deformation, and intracellular calcium response.

نظام ميكروفلويديك مع الزخرفة السطحية للتحقيق فقاعة التجويف (ق) التفاعل -Cell وBioeffects الناتجة على مستوى وحيدة الخلية

In this manuscript, we first describe the fabrication protocol of a microfluidic chip, with gold dots and fibronectin-coated regions on the same glass ...

A Versatile Method of Patterning Proteins and Cells

Substrate and cell patterning techniques are widely used in cell biology to study cell-to-cell and cell-to-substrate interactions. Conventional patterning techniques work well only with simple shapes, small areas and selected bio-materials. This article describes a method to distribute cell suspensions as well as substrate solutions into complex, long, closed (dead-end) polydimethylsiloxane (PDMS) microchannels using negative pressure. This method enables researchers to pattern multiple substrates including fibronectin, collagen, antibodies (Sal-1), poly-D-lysine (PDL), and laminin. Patterning of substrates allows one to indirectly pattern a variety of cells. We have tested C2C12 myoblasts, the PC12 neuronal cell line, embryonic rat cortical neurons, and amphibian retinal neurons. In addition, we demonstrate that this technique can directly pattern fibroblasts in microfluidic channels via brief application of a low vacuum on cell suspensions. The low vacuum does not significantly decrease cell viability as shown by cell viability assays. Modifications are discussed for application of the method to different cell and substrate types. This technique allows researchers to pattern cells and proteins in specific patterns without the need for exotic materials or equipment and can be done in any laboratory with a vacuum.

This report describes a simple, easy to perform technique, using low pressure vacuum, to fill microfluidic channels with cells and substrates for biological research.

منهج تنوعا من الزخرفة البروتينات والخلايا

Substrate and cell patterning techniques are widely used in cell biology to study cell-to-cell and cell-to-substrate interactions. Conventional patterning ...

Live-cell Imaging of Single-Cell Arrays (LISCA) - a Versatile Technique to Quantify Cellular Kinetics

Live-cell Imaging of Single-Cell Arrays (LISCA) is a versatile method to collect time courses of fluorescence signals from individual cells in high throughput. In general, the acquisition of single-cell time courses from cultured cells is hampered by cell motility and diversity of cell shapes. Adhesive micro-arrays standardize single-cell conditions and facilitate image analysis. LISCA combines single-cell microarrays with scanning time-lapse microscopy and automated image processing. Here, we describe the experimental steps of taking single-cell fluorescence time courses in a LISCA format. We transfect cells adherent to a micropatterned array using mRNA encoding for enhanced green fluorescent protein (eGFP) and monitor the eGFP expression kinetics of hundreds of cells in parallel via scanning time-lapse microscopy. The image data stacks are automatically processed by newly developed software that integrates fluorescence intensity over selected cell contours to generate single-cell fluorescence time courses. We demonstrate that eGFP expression time courses after mRNA transfection are well described by a simple kinetic translation model that reveals expression and degradation rates of mRNA. Further applications of LISCA for event time correlations of multiple markers in the context of signaling apoptosis are discussed.

Live-cell Imaging of Single-Cell Arrays LISCA - a Versatile Technique to Quantify Cellular Kinetics

We present a method for the acquisition of fluorescence reporter time courses from single cells using micropatterned arrays. The protocol describes the preparation of single-cell arrays, the setup and operation of live-cell scanning time-lapse microscopy and an open-source image analysis tool for automated preselection, visual control and tracking of cell-integrated fluorescence time courses per adhesion site.

تصوير الخلايا الحية للصفائف أحادية الخلية (LISCA) - تقنية متعددة الاستخدامات لقياس الحركية الخلوية

Live-cell Imaging of Single-Cell Arrays (LISCA) is a versatile method to collect time courses of fluorescence signals from individual cells in high ...