Name: isolation and cultivation of neural progenitors followed by chromatin-immunoprecipitation of histone 3 lysine 79 dimethylation mark
Uploaded: 2018-01-26T13:00:00.000+00:00
Duration: 10 min 9 s
Description: Watch this Scientific Journal Video about Isolation and Cultivation of Neural Progenitors Followed by Chromatin-Immunoprecipitation of Histone 3 Lysine 79 Dimethylation Mark at JoVE.com

We thank Henriette Bertemes for helping to establish the CGN cultivation protocol within the lab. This method paper was supported by the DFG-funded CRC992 Medical Epigenetics by funding to TV. The authors acknowledge the support of the Freiburg Galaxy Team: Pavankumar Videm, Bj&#246;rn Gr&#252;ning and Prof. Rolf Backofen, Bioinformatics, University of Freiburg, Germany funded by Collaborative Research Centre 992 Medical Epigenetics (DFG grant SFB 992/1 2012) and German Federal Ministry of Education and Research (BMBF grant 031 A538A RBC (de.NBI)).

<ol>
	<li>Molyneaux, B. J., Arlotta, P., Menezes, J. R. L., Macklis, J. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Neuronal+subtype+specification+in+the+cerebral+cortex.">Neuronal subtype specification in the cerebral cortex.</a> Nat. Rev. Neurosci. 8, 427-437 (2007).</li><li>Kandel, E. R., Squire, L. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Neuroscience:+breaking+down+scientific+barriers+to+the+study+of+brain+and+mind.">Neuroscience: breaking down scientific barriers to the study of brain and mind.</a> Science. 290, 1113-1120 (2000).</li><li>G&#246;tz, M., Sommer, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cortical+development:+the+art+of+generating+cell+diversity.">Cortical development: the art of generating cell diversity.</a> Dev. Camb. Engl. 132, 3327 (2005).</li><li>Hirabayashi, Y., Gotoh, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epigenetic+control+of+neural+precursor+cell+fate+during+development.">Epigenetic control of neural precursor cell fate during development.</a> Nat. Rev. Neurosci. 11, 377-388 (2010).</li><li>Davis, A. A., Temple, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+self-renewing+multipotential+stem+cell+in+embryonic+rat+cerebral+cortex.">A self-renewing multipotential stem cell in embryonic rat cerebral cortex.</a> Nature. 372, 263-266 (1994).</li><li>Sauvageot, C. M., Stiles, C. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+mechanisms+controlling+cortical+gliogenesis.">Molecular mechanisms controlling cortical gliogenesis.</a> Curr. Opin. Neurobiol. 12, 244-249 (2002).</li><li>McConnell, S. K., Kaznowski, C. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell+cycle+dependence+of+laminar+determination+in+developing+neocortex.">Cell cycle dependence of laminar determination in developing neocortex.</a> Science. 254, 282-285 (1991).</li><li>Desai, A. R., McConnell, S. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Progressive+restriction+in+fate+potential+by+neural+progenitors+during+cerebral+cortical+development.">Progressive restriction in fate potential by neural progenitors during cerebral cortical development.</a> Dev. Camb. Engl. 127, 2863-2872 (2000).</li><li>Glickstein, M., Strata, P., Voogd, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cerebellum:+history.">Cerebellum: history.</a> Neuroscience. 162, 549-559 (2009).</li><li>Marzban, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cellular+commitment+in+the+developing+cerebellum.">Cellular commitment in the developing cerebellum.</a> Front. Cell. Neurosci. 8, (2015).</li><li>Azevedo, F. A. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Equal+numbers+of+neuronal+and+nonneuronal+cells+make+the+human+brain+an+isometrically+scaled-up+primate+brain.">Equal numbers of neuronal and nonneuronal cells make the human brain an isometrically scaled-up primate brain.</a> J. Comp. Neurol. 513, 532-541 (2009).</li><li>Machold, R., Fishell, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Math1+is+expressed+in+temporally+discrete+pools+of+cerebellar+rhombic-lip+neural+progenitors.">Math1 is expressed in temporally discrete pools of cerebellar rhombic-lip neural progenitors.</a> Neuron. 48, 17-24 (2005).</li><li>Luger, K., M&#228;der, A. W., Richmond, R. K., Sargent, D. F., Richmond, T. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Crystal+structure+of+the+nucleosome+core+particle+at+2.8+A+resolution.">Crystal structure of the nucleosome core particle at 2.8 A resolution.</a> Nature. 389, 251-260 (1997).</li><li>Kouzarides, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chromatin+modifications+and+their+function.">Chromatin modifications and their function.</a> Cell. 128, 693-705 (2007).</li><li>Zhang, Q., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Histone+modification+mapping+in+human+brain+reveals+aberrant+expression+of+histone+H3+lysine+79+dimethylation+in+neural+tube+defects.">Histone modification mapping in human brain reveals aberrant expression of histone H3 lysine 79 dimethylation in neural tube defects.</a> Neurobiol. Dis. 54, 404-413 (2013).</li><li>Zhang, Y., Reinberg, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcription+regulation+by+histone+methylation:+interplay+between+different+covalent+modifications+of+the+core+histone+tails.">Transcription regulation by histone methylation: interplay between different covalent modifications of the core histone tails.</a> Genes Dev. 15, 2343-2360 (2001).</li><li>Sanders, S. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Methylation+of+histone+H4+lysine+20+controls+recruitment+of+Crb2+to+sites+of+DNA+damage.">Methylation of histone H4 lysine 20 controls recruitment of Crb2 to sites of DNA damage.</a> Cell. 119, 603-614 (2004).</li><li>Martin, C., Zhang, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+diverse+functions+of+histone+lysine+methylation.">The diverse functions of histone lysine methylation.</a> Nat. Rev. Mol. Cell Biol. 6, 838-849 (2005).</li><li>Greer, E. L., Shi, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Histone+methylation:+a+dynamic+mark+in+health,+disease+and+inheritance.">Histone methylation: a dynamic mark in health, disease and inheritance.</a> Nat. Rev. Genet. 13, 343-357 (2012).</li><li>Ng, H. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lysine+methylation+within+the+globular+domain+of+histone+H3+by+Dot1+is+important+for+telomeric+silencing+and+Sir+protein+association.">Lysine methylation within the globular domain of histone H3 by Dot1 is important for telomeric silencing and Sir protein association.</a> Genes Dev. 16, 1518-1527 (2002).</li><li>Kebede, A. F., Schneider, R., Daujat, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Novel+types+and+sites+of+histone+modifications+emerge+as+players+in+the+transcriptional+regulation+contest.">Novel types and sites of histone modifications emerge as players in the transcriptional regulation contest.</a> FEBS J. 282, 1658-1674 (2015).</li><li>Roidl, D., Hacker, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Histone+methylation+during+neural+development.">Histone methylation during neural development.</a> Cell Tissue Res. 356, 539-552 (2014).</li><li>Mersfelder, E. L., Parthun, M. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+tale+beyond+the+tail:+histone+core+domain+modifications+and+the+regulation+of+chromatin+structure.">The tale beyond the tail: histone core domain modifications and the regulation of chromatin structure.</a> Nucleic Acids Res. 34, 2653-2662 (2006).</li><li>van Leeuwen, F., Gafken, P. R., Gottschling, D. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dot1p+Modulates+Silencing+in+Yeast+by+Methylation+of+the+Nucleosome+Core.">Dot1p Modulates Silencing in Yeast by Methylation of the Nucleosome Core.</a> Cell. 109, 745-756 (2002).</li><li>Jones, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+histone+H3K79+methyltransferase+Dot1L+is+essential+for+mammalian+development+and+heterochromatin+structure.">The histone H3K79 methyltransferase Dot1L is essential for mammalian development and heterochromatin structure.</a> PLoS Genet. 4, e1000190 (2008).</li><li>Woo Park, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RE-IIBP+Methylates+H3K79+and+Induces+MEIS1-mediated+Apoptosis+via+H2BK120+Ubiquitination+by+RNF20.">RE-IIBP Methylates H3K79 and Induces MEIS1-mediated Apoptosis via H2BK120 Ubiquitination by RNF20.</a> Sci. Rep. 5, 12485 (2015).</li><li>Vlaming, H., van Leeuwen, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+upstreams+and+downstreams+of+H3K79+methylation+by+DOT1L.">The upstreams and downstreams of H3K79 methylation by DOT1L.</a> Chromosoma. , (2016).</li><li>Jones, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+histone+H3K79+methyltransferase+Dot1L+is+essential+for+mammalian+development+and+heterochromatin+structure.">The histone H3K79 methyltransferase Dot1L is essential for mammalian development and heterochromatin structure.</a> PLoS Genet. 4, e1000190 (2008).</li><li>Feng, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Early+mammalian+erythropoiesis+requires+the+Dot1L+methyltransferase.">Early mammalian erythropoiesis requires the Dot1L methyltransferase.</a> Blood. 116, 4483-4491 (2010).</li><li>Cattaneo, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DOT1L-mediated+H3K79me2+modification+critically+regulates+gene+expression+during+cardiomyocyte+differentiation.">DOT1L-mediated H3K79me2 modification critically regulates gene expression during cardiomyocyte differentiation.</a> Cell Death Differ. 23, 555-564 (2016).</li><li>Zhang, Q., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Histone+modification+mapping+in+human+brain+reveals+aberrant+expression+of+histone+H3+lysine+79+dimethylation+in+neural+tube+defects.">Histone modification mapping in human brain reveals aberrant expression of histone H3 lysine 79 dimethylation in neural tube defects.</a> Neurobiol. Dis. 54, 404-413 (2013).</li><li>B&#252;ttner, N., Johnsen, S. A., K&#252;gler, S., Vogel, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Af9/Mllt3+interferes+with+Tbr1+expression+through+epigenetic+modification+of+histone+H3K79+during+development+of+the+cerebral+cortex.">Af9/Mllt3 interferes with Tbr1 expression through epigenetic modification of histone H3K79 during development of the cerebral cortex.</a> Proc. Natl. Acad. Sci. U. S. A. 107, 7042-7047 (2010).</li><li>Roidl, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DOT1L+Activity+Promotes+Proliferation+and+Protects+Cortical+Neural+Stem+Cells+from+Activation+of+ATF4-DDIT3-Mediated+ER+Stress+In+Vitro.">DOT1L Activity Promotes Proliferation and Protects Cortical Neural Stem Cells from Activation of ATF4-DDIT3-Mediated ER Stress In Vitro.</a> Stem Cells Dayt. Ohio. 34, 233-245 (2016).</li><li>Robinson, J. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integrative+genomics+viewer.">Integrative genomics viewer.</a> Nat. Biotechnol. 29, 24-26 (2011).</li><li>Langmead, B., Salzberg, S. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fast+gapped-read+alignment+with+Bowtie+2.">Fast gapped-read alignment with Bowtie 2.</a> Nat. Methods. 9, 357-359 (2012).</li><li>Zhang, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Model-based+Analysis+of+ChIP-Seq+(MACS).">Model-based Analysis of ChIP-Seq (MACS).</a> Genome Biol. 9, R137 (2008).</li><li>Ram&#237;rez, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=deepTools2:+a+next+generation+web+server+for+deep-sequencing+data+analysis.">deepTools2: a next generation web server for deep-sequencing data analysis.</a> Nucleic Acids Res. 44, W160-W165 (2016).</li><li>Roidl, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Histone modifications during cerebral cortex development. , (2015).</li><li>Turner, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ChIP+with+Native+Chromatin:+Advantages+and+Problems+Relative+to+Methods+Using+Cross-Linked+Material.">ChIP with Native Chromatin: Advantages and Problems Relative to Methods Using Cross-Linked Material.</a> Mapping Protein/DNA Interactions by Cross-Linking. , (2001).</li><li>Dincman, T. A., Beare, J. E., Ohri, S. S., Whittemore, S. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+of+cortical+mouse+oligodendrocyte+precursor+cells.">Isolation of cortical mouse oligodendrocyte precursor cells.</a> J. Neurosci. Methods. 209, 219-226 (2012).</li></ol>

The authors declare that they have no competing financial interests

There are two major ways to perform chromatin immunoprecipitation to detect the genomic occupancy of histone modifications, transcription factors, histone code readers, writers, or erasers. One is the native ChIP method using nuclease digested, native chromatin for immunoprecipitation, and the other is the presented method using PFA-fixed, sheared chromatin, in which the nucleosomes and other DNA-attached proteins are covalently bound to the DNA39. Native ChIP with its high antibody detection rate should be applicable for histone methylation since the chromatin and histone methylations are relatively stable throughout the ChIP. But since a large amount of starting material is needed, it is not applicable for studying cortical or cerebellar development, where the number of cells from mouse brains is usually limited. Although antibodies are generally raised against non-fixed material, we could prove that the antibody specifically detects H3K79me2 since specific inhibition of DOT1L leads to a decreased H3K79me2 signal in ChIP-qPCR analysis and in immunoblots (Figure 2A and Figure 3A). ChIP using cross-linked material might be inefficient, but the presented protocol ensures enough specifically enriched material for qPCR and sequencing analysis.
For an effective ChIP, the SDS concentration of the lysis buffer can be crucial, since SDS denatures proteins and makes them accessible for antibody binding. This feature is especially important for H3K79me2, which is a histone modification located within the globular domain of histone 3 and within the nucleosome core of chromatin&#39;s smallest unit22. Thus, for H3K79me2, a higher SDS concentration (approximately 0.3% w/v) during the assay is needed to ensure optimal antigene accessibility. With this SDS concentration, we could highly enrich H3K79me2 over IgG controls (Figure 3) and over input (Figure 4). Thus, the quality of the ChIP-material for sequencing was appropriate and the enrichment over input comparable to that of H3K4me3 (Figure 4). We expect that the same SDS concentration would be needed for ChIP of H3K79 mono or trimethylation mark. In general, the more stringent the ChIP buffer is, the less false-positive chromatin fragments are immunoprecipitated, if the quality of the antibody is not affected by the detergent used. For the future, it might be feasible to apply the presented protocol to other histone modifications within the globular domain of histones.
If the antibodies are suitable for ChIP and are stable at higher detergent concentrations, the protocol mainly contains two critical steps. First, the fixation of the cells and the subsequent shearing of the chromatin should be optimized for each cell type and each ultrasonicator. Prolonged cross-linking leads to fixation artifacts and may reduce the antibody detection rate since antigens may be masked. The chromatin shearing needed to lead a size distribution of the DNA between 200 and 500 bp (Figure 1B). Nucleosomes contain 147 bp of DNA. Chromatin fragments that are too lengthy will lead to false positive results in qPCRs. During genome-wide sequencing, an incorrect size distribution will lead to false negative results, since often only small fragments are considered. The second critical step is the library preparation for genome-wide sequencing. A DNA amplification step needs to be performed using 6-9 PCR-cycles. Avoiding numerous PCR cycles is essential since they may lead to a high GC bias and many PCR duplicates. With the presented protocol, enough DNA can be retrieved to keep the number of necessary PCR cycles low.
Brain tissue consists of a very diverse amount of cell types such as neurons, oligodendrocytes, and glia cells4. During development these cells derive from neural stem cells and build specific areas in the brain in a time- and location-dependent manner3. Neurogenesis of the cerebral cortex, for instance, takes place between E11.5 and E18.5 in mice. At earlier stages such as E11.5 and E12.5 almost all cells have progenitor identity1, but later on cellular diversity needs to be taken into account. Therefore, a ChIP of cortical tissue at E14.5 can reveal H3K79me2 or any other histone modification at that specific time point but cannot display cell-type specific chromatin features. This issue can be solved by enrichment of specific cells with Fluorescence-activated cell sorting (FACS) or Magnetic-activated cell sorting (MaCS-sorting)40, which is feasible after brain homogenization. With MaCS-sorting neural progenitor cells carrying specific cell surface markers can be labeled with magnetic beads and then isolated using a magnetic stand40. Afterwards the cells can be cultured or directly used for ChIP. The presented protocol may be used not only for neural progenitor cells but also for other homogeneous cell populations. With addition of FACS or MaCS, the protocol can be applied for all isolatable cells within an organism.
Taken together, the presented protocol makes it possible to investigate the histone modification H3K79me2 at different time points of cortical and cerebellar development in an efficient and reproducible way. It may be applicable to other histone modifications located within the histone core and can be applied to other homogeneous cell types within the organism. Since H3K79me2 is a conserved histone modification23, the protocol may also be suitable to analyze H3K79me2 not only in mice but across different species.

The sensory, motor, and cognitive functions of the brain are highly complex and susceptible to physical and environmental changes. The brain consists of three general parts the hind-, mid-, and forebrain, which are deeply connected. Within the forebrain, the telencephalon can be divided into a dorsal telencephalon (DT) and a ventral telencephalon (VT). The DT of mice consists of six cortical layers which are formed between E11.5 and E18.5 in an &#34;inside-out&#34; manner1. The VT includes the ganglionic eminences in development, which later form the basal ganglia2,3. Several cell types can be classified in the mammalian central nervous system such as neurons, astrocytes, or oligodendrocytes4, which develop in a temporo-spatial manner5. First, the neural progenitor cells (NPCs) give rise to different kinds of neurons, interneurons in the VT, and projection neurons in the DT, and later on to glial cells (e.g., astrocytes6). During cortical development, the most superficial layer (layer I), which contains Cajal-Retzius cells, is formed first. Then, between E12.5 and E14.5, NPCs generate deeper neuronal layers (VI, V) while between 14.5 and 16.5, progenitors give rise to upper layer (IV-II) neurons7,8. Neuronal identity is specified by different morphogen-induced temporo-spatial transcriptional programs and additionally by epigenetic programs2.
The cerebellum, which is implicated in motor coordination, is located in the hindbrain and develops between E10 and roughly P20 in mice9. It contains the cerebellar cortex and the cerebellar nuclei10. The adult cerebellar cortex consists of three layers, the outermost molecular layer, the Purkinje cell layer, and the innermost granular layer containing granular neurons10. The cerebellar granule cells are the smallest neurons and represent about 80% of all neurons in the vertebrate brain11. They develop from precursors located in the external germinal zone and migrate through the Purkinje cell layer to their destination12. Like in the telencephalon, the development of the cerebellum is regulated by several important morphogens, which have specific time- and space-dependent functions and initiate defined transcriptional programs10.
The development of cortical and cerebellar layers is controlled by transcriptional expression of specific morphogens and, thus, by the chromatin state of the DNA. In a simplified view, chromatin states can be divided into euchromatin as transcriptionally active and heterochromatin as transcriptionally silent regions. The nucleosome as the basic unit of chromatin contains two copies of each core histone H2A, H2B, H3, and H4, surrounded by 147 base pairs of DNA13. Histones are highly post-translationally modified by methylation, acetylation, phosphorylation, ubiquitination, sumoylation, ADP-ribosylation, deamination, and proline isomerization14,15. Histone lysine methylation is considered to be the most stable histone modification that controls transcription, replication, recombination16, DNA-damage response17, and genomic imprinting18. Lysines can be mono-, di-, or tri-methylated19 and appear not only on the accessible histone tails but also within the globular domain of histones20. Specific methylations at H3K4 and H3K36 are mainly associated with euchromatin, specific methylations at H3K9, H3K27, or H4K20 are mainly found in heterochromatic regions, although all residues are located within the histone tail14,19,21. H3K79 methylation is located within the histone globular domain and has been associated with transcriptional activity, but also with transcriptionally inert genomic regions22. The modification is evolutionarily conserved since it has been observed in yeast, calf thymus, chicken, and human23. H3K79 mono, di, and trimethylation (H3K79me1, me2, me3) are catalyzed by the histone methyltransferases DOT1L24,25 and the Nuclear SET Domain-Containing Protein 2 (Nsd2)26. DOT1L is implicated in proliferation, DNA repair, and cellular reprograming27. Loss of Dot1l in mice leads to a prenatal death around the developmental stage E10.528,29. During heart development and in myocardiocyte differentiation, DOT1L is essential for gene expression regulation30. In the central nervous system, DOT1L function might be implicated in neural tube development31, it is involved in suppressing Tbr1-expression during forebrain development32, and may function in the regulation of ER-stress response genes33. The context-dependent activating or repressing action of H3K79me, especially with in vivo situations like the development of the central nervous system, is to date only partially understood32. Since H3K79 methylation is located in the globular domain of histone 3, it is sterically less accessible in comparison to modifications on the flexible histone tails23. To understand the function of H3K79 methylation, reliable and reproducible analysis methods to determine its location and genomic environment are needed. In this methods paper, we present isolation methods of different neural progenitors (CPCs for the cortex and CGNPs for the cerebellum), effective DOT1L inhibitor treatment, and a ChIP method to analyze H3K79 methylation via qPCR or sequencing at different time points during cortical and cerebellar development. For an overview of the protocol and its possibilities, see Figure 1.

<table><tbody><tr><td>Anti-GAPDH</td><td>Abcam</td><td>ab8245</td><td>&lt;strong&gt;Category:&lt;/strong&gt; Antibody&lt;br/&gt; &lt;strong&gt;Abbreviation/Comment:&lt;/strong&gt; Immunoblot dilution 1:5000</td></tr><tr><td>Anti-H3</td><td>Abcam</td><td>ab1791</td><td>&lt;strong&gt;Category:&lt;/strong&gt; Antibody&lt;br/&gt; &lt;strong&gt;Abbreviation/Comment:&lt;/strong&gt; Immunoblot dilution 1:3000</td></tr><tr><td>Anti-H3K79me2</td><td>Diagenode</td><td>pAb-051-050</td><td>&lt;strong&gt;Category:&lt;/strong&gt; Antibody&lt;br/&gt; &lt;strong&gt;Abbreviation/Comment:&lt;/strong&gt; ChIP antibody</td></tr><tr><td>Anti-H3K79me2</td><td>Abcam</td><td>ab-051-050</td><td>&lt;strong&gt;Category:&lt;/strong&gt; Antibody&lt;br/&gt; &lt;strong&gt;Abbreviation/Comment:&lt;/strong&gt; Immunoblot dilution 1:1000</td></tr><tr><td>Anti-rabbit-IgG</td><td>Diagenode</td><td>C15410206</td><td>&lt;strong&gt;Category:&lt;/strong&gt; Antibody&lt;br/&gt; &lt;strong&gt;Abbreviation/Comment:&lt;/strong&gt; ChIP Ctrl antibody</td></tr><tr><td>Anti-Tubulin alpha</td><td>Abcam</td><td>ab108629</td><td>&lt;strong&gt;Category:&lt;/strong&gt; Antibody&lt;br/&gt; &lt;strong&gt;Abbreviation/Comment:&lt;/strong&gt; Immunoblot dilution 1:3000</td></tr><tr><td>Apo-Transferrin (1 mg/ml)</td><td>Sigma-Aldrich</td><td>T1147</td><td>&lt;strong&gt;Category:&lt;/strong&gt; Cell culture&lt;br/&gt; &lt;strong&gt;Abbreviation/Comment:&lt;/strong&gt; For CCM</td></tr><tr><td>B27 Supplement (50x)</td><td>Life Technologies</td><td>17504044</td><td>&lt;strong&gt;Category:&lt;/strong&gt; Cell culture&lt;br/&gt; &lt;strong&gt;Abbreviation/Comment:&lt;/strong&gt; For CCM</td></tr><tr><td>Bioanalyzer</td><td>Agilent technologies</td><td>G2940CA</td><td>&lt;strong&gt;Category:&lt;/strong&gt; ChIP&lt;br/&gt; &lt;strong&gt;Abbreviation/Comment:&lt;/strong&gt; For analysis of sheared chromatin</td></tr><tr><td>Bioruptor NextGen</td><td>Diagenode</td><td>B01020001</td><td>&lt;strong&gt;Category:&lt;/strong&gt; ChIP&lt;br/&gt; &lt;strong&gt;Abbreviation/Comment:&lt;/strong&gt; Ultrasonicator</td></tr><tr><td>Boric acid pH 8.4</td><td>Sigma Aldrich</td><td>B6768</td><td>&lt;strong&gt;Category:&lt;/strong&gt; Cell culture&lt;br/&gt; &lt;strong&gt;Abbreviation/Comment:&lt;/strong&gt; For CPC culturing</td></tr><tr><td>CFX Connect RT PCR Detection System</td><td>Bio-Rad</td><td>1855201</td><td>&lt;strong&gt;Category:&lt;/strong&gt; ChIP Analysis&lt;br/&gt; &lt;strong&gt;Abbreviation/Comment:&lt;/strong&gt; Detection system for qPCR</td></tr><tr><td>DMEM-F12</td><td>Life Technologies</td><td>11320-033</td><td>&lt;strong&gt;Category:&lt;/strong&gt; Cell culture&lt;br/&gt; &lt;strong&gt;Abbreviation/Comment:&lt;/strong&gt; For CGM</td></tr><tr><td>Dynabeads Protein A</td><td>Invitrogen</td><td>10001D</td><td>&lt;strong&gt;Category:&lt;/strong&gt; ChIP&lt;br/&gt; &lt;strong&gt;Abbreviation/Comment:&lt;/strong&gt; Magnetic beads, for ChIP</td></tr><tr><td>EPZ-5676</td><td>Selleckchem</td><td>S7062</td><td>&lt;strong&gt;Category:&lt;/strong&gt; DOT1L inhibition&lt;br/&gt; &lt;strong&gt;Abbreviation/Comment:&lt;/strong&gt; For DOT1L inhibition in cell culture</td></tr><tr><td>Ethylenediamine tetraacetic acid</td><td>SERVA</td><td>39760.01</td><td>&lt;strong&gt;Category:&lt;/strong&gt; ChIP&lt;br/&gt; &lt;strong&gt;Abbreviation/Comment:&lt;/strong&gt; EDTA</td></tr><tr><td>Fetal Bovine Serum 10% (v/v)</td><td>Gibco</td><td>10082147</td><td>&lt;strong&gt;Category:&lt;/strong&gt; Cell culture&lt;br/&gt; &lt;strong&gt;Abbreviation/Comment:&lt;/strong&gt; For CPC isolation and CGM</td></tr><tr><td>Glucose</td><td>Sigma-Aldrich</td><td>G5767</td><td>&lt;strong&gt;Category:&lt;/strong&gt; Cell culture&lt;br/&gt; &lt;strong&gt;Abbreviation/Comment:&lt;/strong&gt; For CGNP isolation</td></tr><tr><td>Glutathione (1.25 mg/ml)</td><td>Sigma-Aldrich</td><td>G4251</td><td>&lt;strong&gt;Category:&lt;/strong&gt; Cell culture&lt;br/&gt; &lt;strong&gt;Abbreviation/Comment:&lt;/strong&gt; For CCM</td></tr><tr><td>Glycine</td><td>Carl Roth</td><td>3187</td><td>&lt;strong&gt;Category:&lt;/strong&gt; ChIP&lt;br/&gt; &lt;strong&gt;Abbreviation/Comment:&lt;/strong&gt; For cell fixation</td></tr><tr><td>GoTaq mastermix</td><td>Promega</td><td>A6002</td><td>&lt;strong&gt;Category:&lt;/strong&gt; ChIP Analysis&lt;br/&gt; &lt;strong&gt;Abbreviation/Comment:&lt;/strong&gt; DNA polymerase master mix for qPCR</td></tr><tr><td>Hank&amp;rsquo;s Balanced Salt Solution</td><td>Life Technologies</td><td>14025-100</td><td>&lt;strong&gt;Category:&lt;/strong&gt; Cell culture&lt;br/&gt; &lt;strong&gt;Abbreviation/Comment:&lt;/strong&gt; HBSS</td></tr><tr><td>L-glutamine (200 mM)</td><td>Life Technologies</td><td>25030081</td><td>&lt;strong&gt;Category:&lt;/strong&gt; Cell culture&lt;br/&gt; &lt;strong&gt;Abbreviation/Comment:&lt;/strong&gt; For CCM</td></tr><tr><td>Laminin</td><td>Sigma-Aldrich</td><td>L2020</td><td>&lt;strong&gt;Category:&lt;/strong&gt; Cell culture&lt;br/&gt; &lt;strong&gt;Abbreviation/Comment:&lt;/strong&gt; For CPC culturing</td></tr><tr><td>Lithium chloride</td><td>Sigma-Aldrich</td><td>L4408</td><td>&lt;strong&gt;Category:&lt;/strong&gt; ChIP&lt;br/&gt; &lt;strong&gt;Abbreviation/Comment:&lt;/strong&gt; LiCl</td></tr><tr><td>N2 supplement</td><td>Life Technologies</td><td>17502048</td><td>&lt;strong&gt;Category:&lt;/strong&gt; Cell culture&lt;br/&gt; &lt;strong&gt;Abbreviation/Comment:&lt;/strong&gt; For CGM</td></tr><tr><td>NanoDrop 3300</td><td>Thermo Fisher</td><td>3300</td><td>&lt;strong&gt;Category:&lt;/strong&gt; ChIP&lt;br/&gt; &lt;strong&gt;Abbreviation/Comment:&lt;/strong&gt; Fluorospectrometer for DNA quantification</td></tr><tr><td>NEB Next Ultra DNA Library Prep Kit for Illumina</td><td>NEB</td><td>E7645S</td><td>&lt;strong&gt;Category:&lt;/strong&gt; ChIP Analysis&lt;br/&gt; &lt;strong&gt;Abbreviation/Comment:&lt;/strong&gt; Kit for Library preparation</td></tr><tr><td>NEBNext Multiplex Oligos for Illumina</td><td>NEB</td><td>E7335</td><td>&lt;strong&gt;Category:&lt;/strong&gt; ChIP Analysis&lt;br/&gt; &lt;strong&gt;Abbreviation/Comment:&lt;/strong&gt; Oligos for Library preparation</td></tr><tr><td>Neurobasal medium</td><td>Gibco</td><td>21103049</td><td>&lt;strong&gt;Category:&lt;/strong&gt; Cell culture&lt;br/&gt; &lt;strong&gt;Abbreviation/Comment:&lt;/strong&gt; For CCM</td></tr><tr><td>NP-40 Alternative</td><td>Calbiochem</td><td>492016</td><td>&lt;strong&gt;Category:&lt;/strong&gt; ChIP&lt;br/&gt; &lt;strong&gt;Abbreviation/Comment:&lt;/strong&gt; For ChIP buffer</td></tr><tr><td>Paraformaldehyde</td><td>Carl Roth</td><td>335</td><td>&lt;strong&gt;Category:&lt;/strong&gt; ChIP&lt;br/&gt; &lt;strong&gt;Abbreviation/Comment:&lt;/strong&gt; PFA, for cell fixation</td></tr><tr><td>Penicillin-Streptomycin-Neomycin 1% (v/v)</td><td>Life Technologies</td><td>15640055</td><td>&lt;strong&gt;Category:&lt;/strong&gt; Cell culture&lt;br/&gt; &lt;strong&gt;Abbreviation/Comment:&lt;/strong&gt; PSN, for CCM and CGM</td></tr><tr><td>Phosphate buffered saline</td><td>Life Technologies</td><td>10010023</td><td>&lt;strong&gt;Category:&lt;/strong&gt; Cell culture&lt;br/&gt; &lt;strong&gt;Abbreviation/Comment:&lt;/strong&gt; PBS, for CPC isolation</td></tr><tr><td>PicoGreen Kit</td><td>Thermo Fisher</td><td>P11496</td><td>&lt;strong&gt;Category:&lt;/strong&gt; ChIP Analysis&lt;br/&gt; &lt;strong&gt;Abbreviation/Comment:&lt;/strong&gt; Visualizing dye for DNA quantification</td></tr><tr><td>Poly-D-lysine</td><td>Sigma-Aldrich</td><td>P6407</td><td>&lt;strong&gt;Category:&lt;/strong&gt; Cell culture&lt;br/&gt; &lt;strong&gt;Abbreviation/Comment:&lt;/strong&gt; For CGNP isolation</td></tr><tr><td>Poly-L-ornithine hydrobromide</td><td>Sigma Aldrich</td><td>P3655</td><td>&lt;strong&gt;Category:&lt;/strong&gt; Cell culture&lt;br/&gt; &lt;strong&gt;Abbreviation/Comment:&lt;/strong&gt; For CPC culturing</td></tr><tr><td>Potassium chloride</td><td>Thermo Fisher</td><td>AM9640G</td><td>&lt;strong&gt;Category:&lt;/strong&gt; Cell culture&lt;br/&gt; &lt;strong&gt;Abbreviation/Comment:&lt;/strong&gt; KCl, for CGM</td></tr><tr><td>Protease inhibitor</td><td>Roche</td><td>4693159001</td><td>&lt;strong&gt;Category:&lt;/strong&gt; ChIP&lt;br/&gt; &lt;strong&gt;Abbreviation/Comment:&lt;/strong&gt; For ChIP</td></tr><tr><td>Proteinase K</td><td>Sigma-Aldrich</td><td>3115879001</td><td>&lt;strong&gt;Category:&lt;/strong&gt; ChIP&lt;br/&gt; &lt;strong&gt;Abbreviation/Comment:&lt;/strong&gt; For ChIP</td></tr><tr><td>Qiagen MinElute</td><td>Qiagen</td><td>28004</td><td>&lt;strong&gt;Category:&lt;/strong&gt; ChIP&lt;br/&gt; &lt;strong&gt;Abbreviation/Comment:&lt;/strong&gt; Kit for DNA purification</td></tr><tr><td>RNAse</td><td>Sigma-Aldrich</td><td>R6513</td><td>&lt;strong&gt;Category:&lt;/strong&gt; ChIP&lt;br/&gt; &lt;strong&gt;Abbreviation/Comment:&lt;/strong&gt; For ChIP</td></tr><tr><td>SGC0946</td><td>Selleckchem</td><td>S7079</td><td>&lt;strong&gt;Category:&lt;/strong&gt; DOT1L inhibition&lt;br/&gt; &lt;strong&gt;Abbreviation/Comment:&lt;/strong&gt; For DOT1L inhibition in cell culture</td></tr><tr><td>Sodium bicarbonate</td><td>Carl Roth</td><td>8551.1</td><td>&lt;strong&gt;Category:&lt;/strong&gt; ChIP&lt;br/&gt; &lt;strong&gt;Abbreviation/Comment:&lt;/strong&gt; for Elution buffer</td></tr><tr><td>Sodium chloride</td><td>Carl Roth</td><td>9265</td><td>&lt;strong&gt;Category:&lt;/strong&gt; ChIP&lt;br/&gt; &lt;strong&gt;Abbreviation/Comment:&lt;/strong&gt; NaCl, for ChIP buffer</td></tr><tr><td>Sodium deoxycholate</td><td>Sigma-Aldrich</td><td>30970</td><td>&lt;strong&gt;Category:&lt;/strong&gt; ChIP&lt;br/&gt; &lt;strong&gt;Abbreviation/Comment:&lt;/strong&gt; For ChIP</td></tr><tr><td>Sodium dodecylsulfate</td><td>Carl Roth</td><td>183</td><td>&lt;strong&gt;Category:&lt;/strong&gt; ChIP&lt;br/&gt; &lt;strong&gt;Abbreviation/Comment:&lt;/strong&gt; SDS, for ChIP</td></tr><tr><td>Sonic hedgehock (SHH)</td><td>Sigma-Aldrich</td><td>SRP6004</td><td>&lt;strong&gt;Category:&lt;/strong&gt; Cell culture&lt;br/&gt; &lt;strong&gt;Abbreviation/Comment:&lt;/strong&gt; For CGNP isolation</td></tr><tr><td>Superoxide dismutase (1mg/ml)</td><td>Sigma-Aldrich</td><td>S7571</td><td>&lt;strong&gt;Category:&lt;/strong&gt; Cell culture&lt;br/&gt; &lt;strong&gt;Abbreviation/Comment:&lt;/strong&gt; For CCM</td></tr><tr><td>Tris(hydroxymethyl)aminomethane</td><td>Carl Roth</td><td>9090</td><td>&lt;strong&gt;Category:&lt;/strong&gt; ChIP&lt;br/&gt; &lt;strong&gt;Abbreviation/Comment:&lt;/strong&gt; TRIS, for ChIP buffer</td></tr><tr><td>Triton X-100</td><td>Carl Roth</td><td>X100</td><td>&lt;strong&gt;Category:&lt;/strong&gt; ChIP&lt;br/&gt; &lt;strong&gt;Abbreviation/Comment:&lt;/strong&gt; For ChIP buffer</td></tr><tr><td>Trypsin-EDTA 0,05% (w/v)</td><td>Sigma Aldrich</td><td>59417C</td><td>&lt;strong&gt;Category:&lt;/strong&gt; Cell culture&lt;br/&gt; &lt;strong&gt;Abbreviation/Comment:&lt;/strong&gt; For CPC isolation</td></tr><tr><td>Tween20</td><td>Carl Roth</td><td>28320</td><td>&lt;strong&gt;Category:&lt;/strong&gt; ChIP&lt;br/&gt; &lt;strong&gt;Abbreviation/Comment:&lt;/strong&gt; For bead preparation</td></tr><tr><td>Other Lab devices: Neubauer counting chamber, Incubator, Rotator, Shaker, Disection set, Water bath</td><td></td><td></td><td></td></tr><tr><td>CCM: Cortical cell medium</td><td></td><td></td><td></td></tr><tr><td>CGM: CGNP cell culture medium</td><td></td><td></td><td></td></tr></tbody></table>

isolation and cultivation of neural progenitors followed by chromatin-immunoprecipitation of histone 3 lysine 79 dimethylation mark

Brain development is a complex process, which is controlled in a temporo-spatial manner by gradients of morphogens and different transcriptional programs. Additionally, epigenetic chromatin modifications, like histone methylation, have an important role for establishing and maintaining specific cell fates within this process. The vast majority of histone methylation occurs on the flexible histone tail, which is accessible to histone modifiers, erasers, and histone reader proteins. In contrast, H3K79 methylation is located in the globular domain of histone 3 and is implicated in different developmental functions. H3K79 methylation is evolutionarily conserved and can be found in a wide range of species from Homo sapiens to Saccharomyces cerevisiae. The modification occurs in different cell populations within organisms, including neural progenitors. The location of H3K79 methylation in the globular domain of histone 3 makes it difficult to assess. Here, we present methods to isolate and culture cortical progenitor cells (CPCs) from embryonic cortical brain tissue (E11.5-E14.5) or cerebellar granular neuron progenitors (CGNPs) from postnatal tissue (P5-P7), and to efficiently immunoprecipitate H3K79me2 for quantitative PCR (qPCR) and genome-wide sequencing.

General scheme of neural progenitor isolation, cultivation, H3K79me2 ChIP and ChIP analysis methods: Figure 1 shows a flowchart to perform H3K79me2 ChIP of cortical progenitor cells at different time points during embryonic brain development or of cerebellar granular neuron progenitors in postnatal stages. As a first step, the brain has to be isolated and the telencephalon (between E11.5 and E14.5) or the cerebellum (P5-P7) has to be retrieved. It is possible to analyze the different regions of the telencephalon by dividing it into the DT and VT. Afterwards the tissue will be homogenized and the neural progenitors segregated. Now, it is possible to culture the progenitor cells and treat them with DOT1L inhibitors. Another possibility is to fix the progenitors directly and subject them to the ChIP procedure. For ChIP, the chromatin will be sheared into fragments of 200-500 bp and incubated subsequently with magnetic-beads-coupled antibody against H3K79me2. After washing the beads and retrieving the DNA, the precipitated DNA can be analyzed by sequencing or by qPCR (Figure 1A). It is essential to have a good size distribution of the chromatin fragments after shearing, so it is advisable to check the fragment size with DNA gel electrophoresis or with other methods (examples in Figure 1B). When choosing genome-wide sequencing, ChIP-seq-reads for H3K79me2 occupancy will be provided as a fastq-file for further analysis (Figure 1C). The quality of the sequencing reads needs to be assessed by application of FastQC and, if necessary, the fastq-files can be trimmed using TrimGalore. Mapping to the Mus musculus genome mm9 or mm10 can be performed with Bowtie2 and controlled via PlotFingerprint. It is advisable to remove duplicates with MarkDuplicates and to normalize the reads by BamCoverage and to compare the ChIP to the input samples with BamCompare. The ChIP-seq reads can subsequently be visualized genome wide in heatmaps or gene-wise in Integrative Genomics Viewer (IGV) browser sessions.
CPC culture and DOT1L inhibition: CPCs were isolated and treated with 5 &#181;M DOT1L inhibitor SGC0946 at day 0 and day 2. The solvent DMSO was used as a control. At day 3, CPCs were harvested, the proteins were isolated, quantified, and analyzed via immunoblot (Figure 2A). Figure 2A shows that H3K79me2 levels are effectively decreased after three days of CPC culturing and DOT1L inhibition ensuring an effective inhibitor treatment scheme. The protein amount of H3, GAPDH, or Tubulin-alpha serving as loading controls was thereby not impaired. Immunostaining of fixed CPCs with antibodies against active caspase 3 (CASP3+) for detecting apoptosis and HuC/D for visualizing neuronal cells indicated that treatment of CPCs with DOT1L inhibitor led to increased cell death after three days in culture, as shown in Figure 2B. Quantification of the cells which are CASP3+/DAPI+ or HuC/D+/DAPI+ within the CPC culture revealed a significant rise of CASP3+ cells revealing programmed cell death upon DOT1L inhibition. The number of HuC/D-positive neurons, however, remained unchanged (Figure 2C).
H3K79me2 ChIP-qPCR of Aft4, Ddit3, Scd1, Aft3, and Npm1 from CPCs treated with DOT1L inhibitor: To test if the SGC0946 inhibitor treatment of DOT1L was efficient and led to a reduction of H3K79me2 at specific genes, we performed a ChIP analysis followed by qPCR of CPC treated for 3 days. Rabbit IgG was used as a ChIP control. Since it is known that H3K79me2 is located at the endoplasmatic stress-responsive genes Aft4, Ddit3, Scd1, and Aft3 as well at the nuclear transport gene Npm133,38, we used qPCR primers covering the TSS, the TES, and genomic regions within the gene bodies to determine differences in H3K79me2 distribution after DOT1L inhibition (Figure 3A). Genes with high H3K79me2 levels in the first place such as Atf4, Ddit3, and Npm1 were most responsive to the inhibitor treatment so that three days of inhibition of DOT1L led to a significant decrease of H3K79me2. Genes with a lower H3K79me2 coverage, such as Atf3 and Scd1, showed no significant change in H3K79me2 levels.
Overview of H3K79me2 ChIP-seq analysis: Genome-wide analysis of the H3K79me2 levels in CPCs from E14.5, performed and analyzed according to the presented schemes and protocols (Figure 1), revealed a very high quality ChIP. Whereas the binned counts, sorted according to their frequency of the input reads in the Fingerprint blot (Figure 4A), were evenly distributed, the H3K79me2 counts showed enrichment at specific regions (bins ranked with 1), which displays successful accumulation of chromatin fragments modified at H3K79. A heatmap of H3K79me2 along genes between their TSS and their TES and +/-10Kb upstream or downstream shows (Figure 4B) that H3K79me2 peaks around the TSS and decreased towards the TES in general. There are genes, which are completely covered with H3K79me2, and genes, which have a peak only within the TSS region. Endoplasmatic-stress related genes such as Atf4, Ddit3, and the nucleophosmin Npm1 harbor, for instance, a high H3K79me2 level at the TSS, which is only slightly decreased along the whole gene body (Figure 4C). In contrast, Scd1 has a low H3K79me2 occupancy at the TSS and no H3K79me2 within the gene body. Atf3 as a last example has different sharp and low level H3K79me2 peaks along the gene body.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/56631/56631fig1.jpg" /> 
Figure 1: Scheme of H3K79me2 ChIP protocol from isolated CPCs or CGNPs and flowchart of sequencing analysis. (A) Overview of presented protocol. For CPC isolation, first E14.5 brains will be isolated and the cortices can be divided into DT and VT, if needed. For CGNPs, cerebelli have to be retrieved from P5-P7 mice. The tissue will be homogenized, the progenitors segregated, and then the cells can be cultured and treated with an appropriate inhibitor or directly used for ChIP. For ChIP, fixation of the chromatin is followed by shearing and immunoprecipitation with an anti-H3K79me2 antibody and rabbit IgG as control. After the DNA purification, ChIP samples can be analyzed via library preparation and sequencing or can be analyzed via qPCR. (B) Examples of appropriate and inappropriate quality chromatin. The DNA fragment distribution is shown in bp. (C) ChIP-seq results can be subjected to an analysis pipeline on the Freiburg/Galaxy server. After a quality control (FastQC), reads may be trimmed with TrimGalore and then mapped via Bowtie2 to the mouse genome (in the presented cases mm9). PlotFingerprint evaluates the quality of the ChIP. To define peaks for H3K79me2, MACSpeaks can be applied. For normalization BamCoverage and for comparison to the input BamCompare are usable. To visualize the results IGV browser and heatmaps are suitable. Expected file-formats are italicized. <a href="https://cloudflare-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/56631/56631fig1large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/56631/56631fig2.jpg" /> 
Figure 2: Cortical progenitor culture and DOT1L inhibition. (A) Immunoblots showing H3K79me2 levels in CPC at E14.5 after DOT1L inhibition for 3 days (day 3, n=3-11) in comparison to the DMSO control. H3, GAPDH, and Tubulin alpha were used as loading controls. (B) Immunocytological staining of a CPC culture at days 2 and 3. Activated Caspase 3 (CASP3 green)-positive cells and neurons (HuC/D: red) were stained. DAPI (blue) was used to visualize the cell nuclei. Scale bar: 100 &#181;m. (C) Quantification of the immunostainings presented in (B). The ratio of positive cells for CASP3+/DAPI+ or HuC/D+/DAPI+ in percent is given. For statistical analysis, unpaired Student&#39;s t-tests were performed. p&#60;0.01 **. This figure was modified from Roidl et al.33,38 <a href="https://cloudflare-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/56631/56631fig2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/56631/56631fig3.jpg" /> 
Figure 3: H3K79me2 ChIP-qPCR of Aft4, Ddit3, Aft3, Scd1, and Npm1 from CPCs treated with DOT1L inhibitor. (A) E14.5-derived CPCs were treated with 5 &#181;M DOT1L inhibitor 4-5 h after isolation and for a second time at day 2 in culture. CPCs were fixed at day 3, which was followed by chromatin extraction, ChIP experiment, and qPCR. Results are represented as the mean (+/-SEM) % input (n=3). IgG was used as a negative control. The mean of the IgG level is depicted as dashed line. For statistical analysis, two-way ANOVA was applied. p&#60;005 *; p&#60;0.01 **, p&#60;0.001 ***; TSS transcriptional start site, TES transcriptional end site. This figure was modified from Roidl et al.33,38 <a href="https://cloudflare-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/56631/56631fig3large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/56631/56631fig4.jpg" /> 
Figure 4: Overview of H3K79me2 ChIP-seq analysis. (A) Fingerprint of H3K79me2 ChIP-seq from E14.5-derived CPCs compared to input shows an enrichment of DNA fragments for H3K79me2 ensuring a high ChIP-seq quality. (B) H3K79me2 ChIP-seq results plotted in a heatmap. Strongly enriched genomic regions ARE presented in blue. Scaling 0 (dark red) - 45 (dark blue). H3K79me2 peaks near the TSS and declines in the 3&#180; direction to TES. (C) H3K79me2 ChIP-seq reads were mapped to the mm9 genome and visualized with the integrative genome viewer (IGV). The H3K79me2 occupancy of a gene is displayed as log2 of the number of reads ratio between ChIP and input reads per kilobase per million (Scaling: -10 to 10). Refseq gene structure is represented while a red box indicates the first exon including the TSS. The genes Aft4, Ddit3, Scd1, Aft3, and Npm1 are shown. For comparison, a H3K4me3 signal of the same genomic region is displayed. TSS transcriptional start site, TES transcriptional end site. This figure was modified from Roidl38. <a href="https://cloudflare-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/56631/56631fig4large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Gene</td>
			<td>Region</td>
			<td colspan="2">Primer forward 5&#39;-3&#39;</td>
			<td colspan="2">Primer reverse 5&#39;-3&#39;</td>
		</tr>
		<tr>
			<td>Aft4</td>
			<td>TSS</td>
			<td colspan="2">GGACGATCTCTAACGCCACA</td>
			<td colspan="2">GCCCTAAACCCGCCCTTTAT</td>
		</tr>
		<tr>
			<td>Aft4</td>
			<td>TSS+1500</td>
			<td colspan="2">CTCCCGAATATGACATGAACCG</td>
			<td colspan="2">TCCATTCGAAACAGAGCATCG</td>
		</tr>
		<tr>
			<td>Aft4</td>
			<td>TES</td>
			<td colspan="2">CCGTAATAGGGTAGTCAGGTGC</td>
			<td colspan="2">AAAGAATGACACTGAAAACCCACA</td>
		</tr>
		<tr>
			<td>Ddit3</td>
			<td>TSS</td>
			<td colspan="2">GTACTGGCTCCGTCTAACCC</td>
			<td colspan="2">CAAGAGAGGGCCTGTAAGCA</td>
		</tr>
		<tr>
			<td>Ddit3</td>
			<td>TSS+2500</td>
			<td colspan="2">TCAAGCAGCCGGTCTCATAG</td>
			<td colspan="2">CTCAGATCCCCCAATGGCTT</td>
		</tr>
		<tr>
			<td>Ddit3</td>
			<td>TSS+4500</td>
			<td colspan="2">GAGCTGGAAGCCTGGTATGA</td>
			<td colspan="2">TCACCTCTTCGTTTCCTGGG</td>
		</tr>
		<tr>
			<td>Ddit3</td>
			<td>TES</td>
			<td colspan="2">CACCAAGCATGAACAGTGGG</td>
			<td colspan="2">GTACCGTCTATGTGCAAGCC</td>
		</tr>
		<tr>
			<td>Aft3</td>
			<td>TSS</td>
			<td colspan="2">AACTGAGAGCGCAACTCCTC</td>
			<td colspan="2">GCTGCCGTTCTTAGCTGGTA</td>
		</tr>
		<tr>
			<td>Aft3</td>
			<td>TES</td>
			<td colspan="2">CTGTTGGCACAAAGTGGCTC</td>
			<td colspan="2">GGGATCTGCCATGGTGGAAA</td>
		</tr>
		<tr>
			<td>Scd1</td>
			<td>TSS</td>
			<td colspan="2">TAGTGACCACACACAAAAGCTC</td>
			<td colspan="2">CCCAAGTGTAATTTGGATGATTTCC</td>
		</tr>
		<tr>
			<td>Npm1</td>
			<td>TSS</td>
			<td colspan="2">TCCCCCTCCAGTCAGTTACC</td>
			<td colspan="2">CGTCCTTTCCTTGGCGTGA</td>
		</tr>
		<tr>
			<td>Npm1</td>
			<td>TES</td>
			<td colspan="2">AGGGACATACTTAAGACAAGCCAG</td>
			<td colspan="2">AGGATTGAGGCAGACTGTCAAT</td>
		</tr>
		<tr>
			<td colspan="2">TSS:Transcriptional start site</td>
			<td colspan="2"></td>
			<td colspan="2"></td>
		</tr>
		<tr>
			<td colspan="2">TES:Transcriptional end site</td>
			<td colspan="2"></td>
			<td colspan="2"></td>
		</tr>
	</tbody>
</table>
Table 1: List of primers used for ChIP-qPCR.

Watch this Scientific Journal Video about Isolation and Cultivation of Neural Progenitors Followed by Chromatin-Immunoprecipitation of Histone 3 Lysine 79 Dimethylation Mark at JoVE.com

Isolation and Cultivation of Neural Progenitors Followed by Chromatin-Immunoprecipitation of Histone 3 Lysine 79 Dimethylation Mark

We present an effective and reproducible method to isolate and culture neural progenitor cells from embryonic and postnatal brain tissue for chromatin immunoprecipitation (ChIP) of histone 3 lysine 79 dimethylation (H3K79me2) - a histone mark located within the globular domain of histone 3.

Brain development is a complex process, which is controlled in a temporo-spatial manner by gradients of morphogens and different transcriptional programs. ...

isolation-cultivation-neural-progenitors-followed-chromatin

Universidad San Sebastian

Research

Education

JoVE Journal

JoVE Core

Molecular Biology

Neuroscience

Unit 2

Analyzing Gene Expression and Function

SCIENTISTS IN ACTION

7.4K Views.  University of Freiburg. We present an effective and reproducible method to isolate and culture neural progenitor cells from embryonic and postnatal brain tissue for chromatin immunoprecipitation (ChIP) of histone 3 lysine 79 dimethylation (H3K79me2) - a histone mark located within the globular domain of histone 3.

Video: Isolation and Cultivation of Neural Progenitors Followed by Chromatin-Immunoprecipitation of Histone 3 Lysine 79 Dimethylation Mark

Isolation of Neural Stem/Progenitor Cells from the Periventricular Region of the Adult Rat and Human Spinal Cord

Adult rat and human spinal cord neural stem/progenitor cells (NSPCs) cultured in growth factor-enriched medium allows for the proliferation of multipotent, self-renewing, and expandable neural stem cells. In serum conditions, these multipotent NSPCs will differentiate, generating neurons, astrocytes, and oligodendrocytes. The harvested tissue is enzymatically dissociated in a papain-EDTA solution and then mechanically dissociated and separated through a discontinuous density gradient to yield a single cell suspension which is plated in neurobasal medium supplemented with epidermal growth factor (EGF), basic fibroblast growth factor (bFGF), and heparin. Adult rat spinal cord NSPCs are cultured as free-floating neurospheres and adult human spinal cord NSPCs are grown as adherent cultures. Under these conditions, adult spinal cord NSPCs proliferate, express markers of precursor cells, and can be continuously expanded upon passage. These cells can be studied in vitro in response to various stimuli, and exogenous factors may be used to promote lineage restriction to examine neural stem cell differentiation. Multipotent NSPCs or their progeny can also be transplanted into various animal models to assess regenerative repair.

The adult mammalian spinal cord contains neural stem/progenitor cells (NSPCs) that can be isolated and expanded in culture. This protocol describes the harvesting, isolation, culture, and passaging of NSPCs generated from the periventricular region of the adult spinal cord from the rat and from human organ transplant donors.

Adult rat and human spinal cord neural stem/progenitor cells (NSPCs) cultured in growth factor-enriched medium allows for the proliferation of ...

Developmental Biology

Electric Field-controlled Directed Migration of Neural Progenitor Cells in 2D and 3D Environments

Endogenous electric fields (EFs) occur naturally in vivo and play a critical role during tissue/organ development and regeneration, including that of the central nervous system1,2. These endogenous EFs are generated by cellular regulation of ionic transport combined with the electrical resistance of cells and tissues. It has been reported that applied EF treatment can promote functional repair of spinal cord injuries in animals and humans3,4. In particular, EF-directed cell migration has been demonstrated in a wide variety of cell types5,6, including neural progenitor cells (NPCs)7,8. Application of direct current (DC) EFs is not a commonly available technique in most laboratories. We have described detailed protocols for the application of DC EFs to cell and tissue cultures previously5,11. Here we present a video demonstration of standard methods based on a calculated field strength to set up 2D and 3D environments for NPCs, and to investigate cellular responses to EF stimulation in both single cell growth conditions in 2D, and the organotypic spinal cord slice in 3D. The spinal cordslice is an ideal recipient tissue for studying NPC ex vivo behaviours, post-transplantation, because the cytoarchitectonic tissue organization is well preserved within these cultures9,10. Additionally, this ex vivo model also allows procedures that are not technically feasible to track cells in vivo using time-lapse recording at the single cell level. It is critically essential to evaluate cell behaviours in not only a 2D environment, but also in a 3D organotypic condition which mimicks the in vivo environment. This system will allow high-resolution imaging using cover glass-based dishes in tissue or organ culture with 3D tracking of single cell migration in vitro and ex vivo and can be an intermediate step before moving onto in vivo paradigms.

This protocol demonstrates methods used to establish 2D and 3D environments in custom-designed electrotactic chambers, which can track cells in vivo/ex vivo using time-lapse recording at the single cell level, in order to investigate galvanotaxis/electrotaxis and other cellular responses to direct current (DC) electric fields (EFs).

Endogenous electric fields (EFs) occur naturally in vivo and play a critical role during tissue/organ development and regeneration, including that of the ...

Bioengineering

Native Chromatin Immunoprecipitation Using Murine Brain Tumor Neurospheres

Epigenetic modifications may be involved in the development and progression of glioma. Changes in methylation and acetylation of promoters and regulatory regions of oncogenes and tumor suppressors can lead to changes in gene expression and play an important role in the pathogenesis of brain tumors. Native chromatin immunoprecipitation (ChIP) is a popular technique that allows the detection of modifications or other proteins tightly bound to DNA. In contrast to cross-linked ChIP, in native ChIP, cells are not treated with formaldehyde to covalently link protein to DNA. This is advantageous because sometimes crosslinking may fix proteins that only transiently interact with DNA and do not have functional significance in gene regulation. In addition, antibodies are generally raised against unfixed peptides. Therefore, antibody specificity is increased in native ChIP. However, it is important to keep in mind that native ChIP is only applicable to study histones or other proteins that bind tightly to DNA. This protocol describes the native chromatin immunoprecipitation on murine brain tumor neurospheres.

Epigenetic mechanisms are frequently altered in glioma. Chromatin immunoprecipitation could be used to study the consequences of genetic alterations in glioma that result from changes in histone modifications which regulate chromatin structure and gene transcription. This protocol describes native chromatin immunoprecipitation on murine brain tumor neurospheres.

Epigenetic modifications may be involved in the development and progression of glioma. Changes in methylation and acetylation of promoters and regulatory ...

Cancer Research

Localizing Protein in 3D Neural Stem Cell Culture: a Hybrid Visualization Methodology

The importance of 3-dimensional (3D) topography in influencing neural stem and progenitor cell (NPC) phenotype is widely acknowledged yet challenging to study. When dissociated from embryonic or post-natal brain, single NPCs will proliferate in suspension to form neurospheres. Daughter cells within these cultures spontaneously adopt distinct developmental lineages (neurons, oligodendrocytes, and astrocytes) over the course of expansion despite being exposed to the same extracellular milieu. This progression recapitulates many of the stages observed over the course of neurogenesis and gliogenesis in post-natal brain and is often used to study basic NPC biology within a controlled environment. Assessing the full impact of 3D topography and cellular positioning within these cultures on NPC fate is, however, difficult. To localize target proteins and identify NPC lineages by immunocytochemistry, free-floating neurospheres must be plated on a substrate or serially sectioned. This processing is required to ensure equivalent cell permeabilization and antibody access throughout the sphere. As a result, 2D epifluorescent images of cryosections or confocal reconstructions of 3D Z-stacks can only provide spatial information about cell position within discrete physical or digital 3D slices and do not visualize cellular position in the intact sphere. Here, to reiterate the topography of the neurosphere culture and permit spatial analysis of protein expression throughout the entire culture, we present a protocol for isolation, expansion, and serial sectioning of post-natal hippocampal neurospheres suitable for epifluorescent or confocal immunodetection of target proteins. Connexin29 (Cx29) is analyzed as an example. Next, using a hybrid of graphic editing and 3D modelling softwares rigorously applied to maintain biological detail, we describe how to re-assemble the 3D structural positioning of these images and digitally map labelled cells within the complete neurosphere. This methodology enables visualization and analysis of the cellular position of target proteins and cells throughout the entire 3D culture topography and will facilitate a more detailed analysis of the spatial relationships between cells over the course of neurogenesis and gliogenesis in vitro.
Both Imbeault and Valenzuela contributed equally and should be considered joint first authors.

Here, we describe how to produce, expand, and immunolabel postnatal hippocampal neural progenitor cells (NPCs) in three-dimensional (3D) culture. Next, using hybrid visualization technologies, we demonstrate how digital images of immunolabelled cryosections can be used to reconstruct and map the spatial position of immunopositive cells throughout the entire 3D neurosphere.

The importance of 3-dimensional (3D) topography in influencing neural stem and progenitor cell (NPC) phenotype is widely acknowledged yet challenging to ...

Isolation and Culture of Neural Crest Cells from Embryonic Murine Neural Tube

The embryonic neural crest (NC) is a multipotent progenitor population that originates at the dorsal aspect of the neural tube, undergoes an epithelial to mesenchymal transition (EMT) and migrates throughout the embryo, giving rise to diverse cell types 1-3. NC also has the unique ability to influence the differentiation and maturation of target organs4-6. When explanted in vitro, NC progenitors undergo self-renewal, migrate and differentiate into a variety of tissue types including neurons, glia, smooth muscle cells, cartilage and bone. 
NC multipotency was first described from explants of the avian neural tube7-9. In vitro isolation of NC cells facilitates the study of NC dynamics including proliferation, migration, and multipotency. Further work in the avian and rat systems demonstrated that explanted NC cells retain their NC potential when transplanted back into the embryo10-13. Because these inherent cellular properties are preserved in explanted NC progenitors, the neural tube explant assay provides an attractive option for studying the NC in vitro. 
To attain a better understanding of the mammalian NC, many methods have been employed to isolate NC populations. NC-derived progenitors can be cultured from post-migratory locations in both the embryo and adult to study the dynamics of post-migratory NC progenitors11,14-20, however isolation of NC progenitors as they emigrate from the neural tube provides optimal preservation of NC cell potential and migratory properties13,21,22. Some protocols employ fluorescence activated cell sorting (FACS) to isolate a NC population enriched for particular progenitors11,13,14,17. However, when starting with early stage embryos, cell numbers adequate for analyses are difficult to obtain with FACS, complicating the isolation of early NC populations from individual embryos. Here, we describe an approach that does not rely on FACS and results in an approximately 96% pure NC population based on a Wnt1-Cre activated lineage reporter23. 
The method presented here is adapted from protocols optimized for the culture of rat NC11,13. The advantages of this protocol compared to previous methods are that 1) the cells are not grown on a feeder layer, 2) FACS is not required to obtain a relatively pure NC population, 3) premigratory NC cells are isolated and 4) results are easily quantified. Furthermore, this protocol can be used for isolation of NC from any mutant mouse model, facilitating the study of NC characteristics with different genetic manipulations. The limitation of this approach is that the NC is removed from the context of the embryo, which is known to influence the survival, migration and differentiation of the NC2,24-28.

Isolation of embryonic neural crest from the neural tube facilitates the use of in vitro methods for studying migration, self-renewal, and multipotency of neural crest.

The embryonic neural crest (NC) is a multipotent progenitor population that originates at the dorsal aspect of the neural tube, undergoes an epithelial to ...

Isolation and Culture of Embryonic Mouse Neural Stem Cells

Neural stem cells (NSCs) are multipotent and can give rise to the three major cell types of the central nervous system (CNS). In vitro culture and expansion of NSCs provide a suitable source of cells for neuroscientists to study the function of neurons and glial cells along with their interactions. There are several reported techniques for the isolation of neural stem cells from adult or embryo mammalian brains. During the microsurgical operation to isolate NSCs from different regions of the embryonic CNS, it is very important to reduce the damage to the brain cells to obtain the highest ratio of live and expandable stem cells. A possible technique for stress reduction during isolation of these cells from the mouse embryo brain is the reduction of surgical time. Here, we demonstrate a developed technique for rapid isolation of these cells from the E13 mouse embryo ganglionic eminence. Surgical procedures include harvesting E13 mouse embryos from the uterus, cutting the frontal fontanelle of the embryo with a bent needle tip, extracting the brain from the skull, microdissection of the isolated brain to harvest the ganglionic eminence, dissociation of the harvested tissue in NSC medium to gain a single cell suspension, and finally plating cells in suspension culture to generate neurospheres.

Here, we introduce a novel microsurgical technique for the isolation of neural stem cells from the E13 mouse embryo ganglionic eminence.

Neural stem cells (NSCs) are multipotent and can give rise to the three major cell types of the central nervous system (CNS). In vitro culture and ...

Native Chromatin Immunoprecipitation of Neurosphere Cells

<a href='https://app-jove-com.bdigitaluss.remotexs.co/v/57016/native-chromatin-immunoprecipitation-using-murine-brain-tumor'>Source: Mendez, F. M. et al., Native Chromatin Immunoprecipitation Using Murine Brain Tumor Neurospheres.&#160;J. Vis. Exp.&#160; (2018).</a>This video demonstrates the isolation of protein-DNA complexes from neurosphere cells derived from a mouse brain tumor using native chromatin immunoprecipitation. It details the steps for chromatin preparation, immunoprecipitation, washing, and protein digestion to release DNA for downstream analysis.

Source: Mendez, F. M. et al., Native Chromatin Immunoprecipitation Using Murine Brain Tumor Neurospheres.&#160;J. Vis. Exp.&#160; (2018).This video ...

JoVE Encyclopedia of Experiments

Neuropathology

Tumors

Isolating Induced Neural Progenitor Cell Colonies Derived From Adult Human Fibroblasts

Source: Meyer, S. et al., <a href="https://app-jove-com.bdigitaluss.remotexs.co/v/52831">Derivation of Adult Human Fibroblasts and their Direct Conversion into Expandable Neural Progenitor Cells.</a>&#160;J. Vis. Exp. (2015).
This video demonstrates a technique for isolating induced neural progenitor cells (iNPCs) derived from adult human fibroblasts. It outlines the steps involved in isolating the iNPC colonies and culturing them in laminin-coated multi-well plate wells in the presence of suitable culture media that facilitate the continued proliferation and expansion of the iNPC population.

All procedures involving sample collection have been performed in accordance with the institute&#39;s IRB guidelines.
1. Isolation of Putative Induced ...

Neuronal Culture Techniques

Primary Neuronal Culture

Isolating and Culturing Murine Cerebellar Granular Neuron Progenitors

Source: Bovio, P., et al., <a href="https://app-jove-com.bdigitaluss.remotexs.co/v/56631">Isolation and Cultivation of Neural Progenitors Followed by Chromatin-Immunoprecipitation of Histone 3 Lysine 79 Dimethylation Mark.</a> J. Vis. Exp. (2018)
This video demonstrates the isolation and cultivation of cerebellar neural progenitor cells from a mouse pup&#39;s cerebellum. Cerebellar granule neuron progenitors are isolated and purified through differential adhesion, effectively removing astrocytes. These cultured progenitors subsequently differentiate into cerebellar granule neurons.

All procedures involving sample collection have been performed in accordance with the institute&#39;s IRB guidelines.
1.&#160;Preparations

	Preparations ...

Isolation of Neural Stem Progenitor Cells from the Spinal Cord Periventricular Region of an Adult Rat

Source: Mothe, A., et al., <a href="https://app-jove-com.bdigitaluss.remotexs.co/v/52732">Isolation of Neural Stem/Progenitor Cells from the Periventricular Region of the Adult Rat and Human Spinal Cord.</a> J. Vis. Exp. (2015).
This video presents a method for isolating neural stem/progenitor cells from the periventricular tissue of the spinal cord in adult rats. The technique includes incubating the tissue fragments in a solution containing proteolytic enzymes to disrupt the extracellular matrix and release the cells. Subsequently, the released cells are plated in a medium containing specific growth factors that enhance neural stem/progenitor proliferation and promote aggregation into three-dimensional neurospheres.

All procedures involving animal samples have been reviewed and approved by the appropriate animal ethical review committee. 
1. Preparation of Dissection ...