Name: recombinant protein expression, crystallization, and biophysical studies of a bacillus-conserved nucleotide pyrophosphorylase, bcmazg
Uploaded: 2017-05-16T13:00:00.000+00:00
Duration: 12 min 23 s
Description: Watch this Scientific Journal Video about Recombinant Protein Expression, Crystallization, and Biophysical Studies of a Bacillus-conserved Nucleotide Pyrophosphorylase, BcMazG at JoVE.com

The X-ray diffraction datasets were collected at beamline 7A of the Pohang Accelerator Laboratory (Korea). This study was supported by the Basic Science Research Program administered through the National Research Foundation of Korea (NRF), funded by the Ministry of Science, ICT &amp; Future Planning (2015R1A1A01057574 to MH).

1. Recombinant Protein Production and Purification of rBC1531
<ol>
	<li>Preparation of a recombinant BC1531 protein (rBC1531)-expression plasmid
	<ol>
		<li>Prepare genomic DNA of B. cereus10.</li>
		<li>Amplify the bc1531 gene from a template of B. cereus genomic DNA by polymerase chain reaction (PCR), using forward and reverse primers (see the Materials List) to create BamHI and SalI restriction enzyme sites, respectively10.</li>
		<li>Digest the PCR product and a modified pET49b vector (pET49bm) using BamHI and SalI, as described11.</li>
		<li>Mix the digested PCR product and vector (3:1 ratio) from step 1.1.3 using T4 DNA ligase in a 10 &#181;L reaction, as described11. Incubate at 18 &#176;C for 30 min.</li>
		<li>Pipette 3 &#181;L of the ligation reaction into 50 &#181;L of chemically competent E. coli DH5&#945; cells in a tube. Mix gently by pipetting up and down and place on ice for 30 min. Heat shock for 45 s at 42 &#176;C. Add 1 mL of Luria-Bertani (LB) medium and grow the cells while vigorously shaking (250 rpm, 37 &#176;C, 45 min).</li>
		<li>Take 100 &#181;L of the transformed cells from step 1.1.6 and spread them onto the LB-agar plates with 100 &#181;g/mL kanamycin (Kan). Incubate for ~18 h at 37 &#176;C.</li>
		<li>Pick colonies using a sterile tip and grow the cells in 3 mL of LB medium with 100 &#181;g/mL Kan; shake vigorously (250 rpm, 37 &#176;C, 18 h).</li>
		<li>Prepare plasmid DNA using an alkaline-SDS lysis method, as described10.</li>
		<li>Confirm the nucleotide sequence of the rBC1531-expression construct using DNA sequencing12.</li>
	</ol>
	</li>
	<li>Overexpression of the rBC1531 protein
	<ol>
		<li>Re-transform the E. coli BL21 (DE3) strain with rBC1531-expression plasmid, as described in steps 1.1.5-1.1.6, for overexpression.</li>
		<li>Select a colony and grow it in 10 mL of LB medium containing 50 &#181;g/mL Kan (LB+Kan); shake vigorously for 18 h at 37 &#176;C.</li>
		<li>Inoculate 10 mL of overnight culture in 1 L of LB+Kan medium and grow at 37 &#176;C until the OD600 (optical density at 600 nm) reaches ~0.7.</li>
		<li>Submerge the culture in ice-cold water for ~15 min to cool down the temperature to 18 &#176;C and add isopropyl &#946;-D-1-thiogalactopyranoside (IPTG) to the culture at a final concentration of 1 mM for recombinant protein expression. Grow the culture at 18 &#176;C for an additional ~16-18 h.</li>
	</ol>
	</li>
	<li>Purification of rBC1531
	<ol>
		<li>Harvest the cells by centrifugation (5,000 x g, 4 &#176;C, 30 min). Discard the supernatant carefully so as to not disturb the cells. Re-suspend the cells in 50 mL of phosphate-buffered saline (PBS) solution containing 10 mM imidazole.</li>
		<li>Lyse the cells twice by sonication on ice to prevent the over-heating of the cell lysates (time: 2 min 30 s; cycle on: 5 s; cycle off: 10 s; amplitude: 38%).</li>
		<li>Clear the cell lysate by centrifugation (~25,000 x g, 4 &#176;C, 30 min).</li>
		<li>Mix 3 mL of nickel beads and 60 mL of PBS containing 10 mM imidazole and gravity-flow the extra buffer to settle the equilibrated nickel beads in a 2.5 x 10 cm glass chromatography column.</li>
		<li>Pipette to transfer the supernatant from step 1.3.3 to the column with pre-equilibrated nickel beads and incubate at 4 &#176;C for 2 h on a spinning wheel at a low speed (~20 rpm).</li>
		<li>Allow the supernatant to drain by gravity and wash the nickel beads in the column three times with 100 mL of PBS containing 10 mM imidazole.</li>
		<li>Elute rBC1531 protein by applying 4 x 5 mL of PBS containing 250 mM imidazole.</li>
		<li>Take 15 &#181;L of the elution from step 1.3.7 and run it on 15% SDS-PAGE. Visualize the protein bands on the gel using Coomassie blue staining10.</li>
	</ol>
	</li>
	<li>Removal of the affinity tags of the rBC1531 protein by thrombin proteolysis
	<ol>
		<li>Pipette the fractions into dialysis tube (molecular weight cut off: 3 kDa) and place the tube in a beaker containing 4 L of thrombin cleavage-compatible buffer (20 mM HEPES, pH 7.4, 150 mM NaCl, and 1.5 mM &#946;-mercaptoethanol) at 4 &#176;C overnight.</li>
		<li>Pipette the fractions and transfer them to a conical tube.</li>
		<li>Measure the absorbance at 280 nm and estimate the rBC1531 protein concentration, as described13.</li>
		<li>Take 50 &#181;g of rBC1531 in a 0.5 mL tube and add various amounts of thrombin (i.e., 2, 1, 0.6, and 0.3 units). Incubate the rBC1531 and thrombin reactions at 20 &#176;C for ~3 h to determine the least amount of thrombin required to cleave the N-terminal affinity tag.</li>
		<li>Run the rBC1531 and thrombin reactions on a 15% SDS-PAGE and determine the lowest amount of thrombin (e.g., 0.3 units of thrombin per 50 &#181;g of rBC1531) that completely digests the N-terminal affinity tag and produce a tag-free rBC1531.</li>
		<li>Add 10 mg of rBC1531 protein and 60 units of thrombin to a 15 mL tube and incubate at 20 &#176;C for ~3 h for the thrombin-proteolysis reaction.</li>
		<li>Apply gel-filtration standards to a size-exclusion chromatography (SEC) column to prepare a standard curve of molecular weights and elution volumes, as described13.</li>
		<li>Place the thrombin-digested rBC1531 protein from step 1.4.6 in a centrifugal filter tube (molecular weight cut off: 3 kDa) and centrifuge at 3,000 g at 4 &#176;C to reduce to a volume of less than 5 mL.</li>
		<li>Apply the concentrated rBC1531 protein to the SEC column and collect 60 eluted fractions in 0.5 mL per tube13.</li>
		<li>Take 15 &#181;L of each fraction, run them on a 15% SDS-PAGE, and stain the gel using Coomassie staining solution (0.15% (w/v) Coomassie brilliant blue, 40% (v/v) methanol, and 10% (v/v) glacial acetic acid) as described10.</li>
		<li>Pipette the fractions that contain rBC1531 and collect them in one tube.</li>
	</ol>
	</li>
</ol>
2. Crystallization Screening and Optimization of rBC1531
<ol>
	<li>Screening conditions for rBC1531 protein crystallization
	<ol>
		<li>Concentrate the rBC1531 from step 1.4.11 up to ~18.5 mg/mL using a centrifugal filter tube, as described in step 1.4.8.</li>
		<li>Add 50 &#181;L of each crystallization screening solution (see section 2.2)14 to the wells of 96-well sitting-drop crystallization plates. Place 0.5 &#181;L of the 18.5 mg/mL rBC1531 protein solution on a sitting bed. Mix the protein solution with 0.5 &#181;L of the well solution, repeating the process for the entire plate.</li>
		<li>Cover the plate with clear adhesive film. Place the 96-well plates at 18 &#176;C and allow for vapor diffusion.</li>
		<li>Scan the drops at 20-40X magnification using a light microscope to monitor crystal formation daily for 2-3 weeks.</li>
		<li>Collect X-ray diffraction data12 using the obtained rBC1531 protein crystals.</li>
	</ol>
	</li>
	<li>Optimization of rBC1531 crystallization conditions
	<ol>
		<li>Prepare 500 &#181;L of the selected initial crystallization condition solution (e.g., 0.1 M sodium cacodylate, pH 6.5 and 1.0 M sodium citrate) and fill a 24-well crystallization plate for the sitting drop.</li>
		<li>Add 0.5 &#181;L of the 18.5 mg/mL rBC1531 protein solution to a sitting bed, mix with 0.5 &#181;L of the well solution, and cover the plate immediately with clear adhesive film. Place the plate at 18 &#176;C.</li>
		<li>Observe crystal growth under a light microscope for a week.</li>
		<li>Optimize various crystallization conditions by varying the pH (i.e., pH 5.5-6.8) of 0.1 M cacodylate and by altering the salt concentration (i.e., 0.9-1.2 M) of sodium citrate to obtain singular crystals. Monitor crystal growth for ~1 week and collect X-ray diffraction data12.</li>
	</ol>
	</li>
</ol>
3. Characterization of the Nucleoside Triphosphatase (NTPase) Activity of rBC1531
<ol>
	<li>Validation of the inorganic phosphate-dependent colorimetric study
	<ol>
		<li>Prepare a stock of pyrophosphate (100 mM) and dilute it to final concentrations of 0.1, 0.25, 0.5, 1.0, 5.0, 10, 50, 100, and 250 &#181;M in 200 &#181;L of reaction buffer (20 mM HEPES, pH 7.4; 150 mM NaCl; and 2 mM MgCl2) in duplicate 96-well plates. Use the first plate as a control (this does not contain pyrophosphatase). Ensure that the second plate contains pyrophosphatase as a working plate, as directed in step 3.1.2.</li>
		<li>Add 0.01 unit of Saccharomyces cerevisiae inorganic pyrophosphatase (1 &#181;L) to the wells of the working plate and incubate at 20 &#176;C for 30-60 min.</li>
		<li>Prepare molybdate acid solution by mixing ammonium molybdate (0.86% v/v) and ascorbic acid (14% v/v) solutions in a 7:3 ratio. Add 16 &#181;L of molybdate acid solution to both the working and control wells and wait for 15 min.</li>
		<li>Read the optical density at 690 nm (OD690nm).</li>
	</ol>
	</li>
	<li>Colorimetric NTPase assay
	<ol>
		<li>Prepare a stock of 100 mM nucleoside triphosphate (NTP) substrate and dilute to the desired concentration (e.g., 0, 0.2, 4.4, 11, 22, 44, 88, or 132 &#181;M) in 180 &#181;L of assay buffer (20 mM HEPES, pH 7.4; 150 mM NaCl; and 2 mM MgCl2).</li>
		<li>Add 20 &#181;g of rBC1531 (1.5 mM) and the NTP substrates from step 3.2.1 up to 200 &#181;L per reaction in a 96-well plate and pipette up and down to mix well. Cover the plate with its lid and place it in a 37 &#176;C incubator for 30 min to perform the substrate hydrolysis reaction.</li>
		<li>Transfer the plate to a 70 &#176;C water bath and allow to stand for 15 min to stop rBC1531-mediated catalytic reactions.</li>
		<li>Add 0.01 unit of S. cerevisiae inorganic pyrophosphatase (1 &#181;L) to each well of the reaction plate (from step 3.2.3) and incubate at 20 &#176;C for 30 min. Add 16 &#181;L of molybdate acid solution to the reaction plate to develop the color (~15 min). Read at OD690nm.</li>
		<li>Analyze using the Michaelis-Menten equation, as described12.</li>
	</ol>
	</li>
</ol>

<ol>
	<li>Ivanova, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome+sequence+of+Bacillus+cereus+and+comparative+analysis+with+Bacillus+anthracis.">Genome sequence of Bacillus cereus and comparative analysis with Bacillus anthracis.</a> Nature. 423, 87-91 (2003).</li><li>Spencer, R. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bacillus+anthracis.">Bacillus anthracis.</a> J Clin Pathol. 56, 182-187 (2003).</li><li>Deli, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=LmbE+proteins+from+Bacillus+cereus+are+de-N-acetylases+with+broad+substrate+specificity+and+are+highly+similar+to+proteins+in+Bacillus+anthracis.">LmbE proteins from Bacillus cereus are de-N-acetylases with broad substrate specificity and are highly similar to proteins in Bacillus anthracis.</a> FEBS J. 277, 2740-2753 (2010).</li><li>Gross, M., Marianovsky, I., Glaser, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MazG+--+a+regulator+of+programmed+cell+death+in+Escherichia+coli.">MazG -- a regulator of programmed cell death in Escherichia coli.</a> Mol Microbiol. 59, 590-601 (2006).</li><li>Galperin, M. Y., Moroz, O. V., Wilson, K. S., Murzin, A. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=House+cleaning,+a+part+of+good+housekeeping.">House cleaning, a part of good housekeeping.</a> Mol Microbiol. 59, 5-19 (2006).</li><li>Lee, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Crystal+structure+of+Escherichia+coli+MazG,+the+regulator+of+nutritional+stress+response.">Crystal structure of Escherichia coli MazG, the regulator of nutritional stress response.</a> J Biol Chem. 283, 15232-15240 (2008).</li><li>Moroz, O. V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dimeric+dUTPases,+HisE,+and+MazG+belong+to+a+new+superfamily+of+all-alpha+NTP+pyrophosphohydrolases+with+potential+&amp;#34;house-cleaning&amp;#34;+functions.">Dimeric dUTPases, HisE, and MazG belong to a new superfamily of all-alpha NTP pyrophosphohydrolases with potential &amp;#34;house-cleaning&amp;#34; functions.</a> J Mol Biol. 347, 243-255 (2005).</li><li>Robinson, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+putative+house-cleaning+enzyme+encoded+within+an+integron+array:+1.8+A+crystal+structure+defines+a+new+MazG+subtype.">A putative house-cleaning enzyme encoded within an integron array: 1.8 A crystal structure defines a new MazG subtype.</a> Mol Microbiol. 66, 610-621 (2007).</li><li>Moroz, O. V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+crystal+structure+of+a+complex+of+Campylobacter+jejuni+dUTPase+with+substrate+analogue+sheds+light+on+the+mechanism+and+suggests+the+&amp;#34;basic+module&amp;#34;+for+dimeric+d(C/U)TPases.">The crystal structure of a complex of Campylobacter jejuni dUTPase with substrate analogue sheds light on the mechanism and suggests the &amp;#34;basic module&amp;#34; for dimeric d(C/U)TPases.</a> J Mol Biol. 342, 1583-1597 (2004).</li><li>Green, M., Sambrook, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Molecular cloning: A laboratory Manual. 1, (2012).</li><li>Brown, T. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Gene cloning an introduction. , (1986).</li><li>Kim, M. I., Hong, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Crystal+structure+of+the+Bacillus-conserved+MazG+protein,+a+nucleotide+pyrophosphohydrolase.">Crystal structure of the Bacillus-conserved MazG protein, a nucleotide pyrophosphohydrolase.</a> Biochem Biophys Res Commun. 472, 237-242 (2016).</li><li>Sheehan, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Physical biochemistry: Principles and applications. , (2009).</li><li>Lesley, S. A., Wilson, I. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protein+production+and+crystallization+at+the+joint+center+for+structural+genomics.">Protein production and crystallization at the joint center for structural genomics.</a> J Struct Funct Genomics. 6, 71-79 (2005).</li><li>Jeon, Y. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Structural+and+biochemical+characterization+of+bacterial+YpgQ+protein+reveals+a+metal-dependent+nucleotide+pyrophosphohydrolase.">Structural and biochemical characterization of bacterial YpgQ protein reveals a metal-dependent nucleotide pyrophosphohydrolase.</a> J Struct Biol. 195, 113-122 (2016).</li></ol>

The authors have nothing to disclose.

Studies of true pathogens are limited due to safety restrictions and regulations. Alternatively, pathogens can be studied using evolutionarily related non-pathogens or less pathogenic species. The ba1554 gene is considered a critical gene in B. anthracis. Fortunately, an identical gene is present in nonclinical B. cereus. Thus, without serious safety concerns, recombinant BC1531 protein can be used for biophysical and enzymatic characterization. Here, we described detailed procedures, moving fr...

Recombinant protein expression is widely used to overcome problems associated with natural protein sources, such as limited protein quantities and harmful contamination. Moreover, in studies of pathogenic genes and proteins, an alternative laboratory strain that does not require additional safety precautions can be utilized. For example, Bacillus cereus is a useful model for studying Bacillus anthracis due to their close evolutionary relationship1.
B. anthracis is an obligate pathogen that causes fatal inhalational anthrax in humans and livestock and can potentially be used as a bioweapon2. Thus, laboratory studies on B. anthracis are strictly regulated by the US Centers for Disease Control, requiring biosafety level 3 (BSL-3) practices, which mandate that the laboratory area be segregated with negative room pressure. In contrast to B. anthracis, B. cereus is categorized as a BSL-1 agent and thus has minimal safety concerns. B. cereus is an opportunistic pathogen that, upon infection, causes food poisoning that can be treated without medical assistance. However, because B. cereus shares many critical genes with B. anthracis, the functions of B. anthracis proteins can be studied using the corresponding homologs of B. cereus1.
The ba1554 - ba1558 gene cluster of B. anthracis is highly conserved with the bc1531- bc1535 cluster of B. cereus, as well as with the bt1364-bt1368 cluster of Bacillus thuringiensis, in terms of gene organization and sequence. Furthermore, the first genes (ba1554, bc1531, and bt1364) of the respective clusters are absolutely conserved (i.e., 100% nucleotide sequence identity), implying a critical role of the gene product in the Bacillus species. Due to its location in these gene clusters, ba1554 was misidentified as a putative transcription regulator3. However, amino acid sequence analysis of the ba1554 product indicates that it belongs to the MazG family, which has nucleotide pyrophosphohydrolase activity and is not associated with transcription factor activity4,5. Although proteins belonging to the MazG family are diverse with respect to overall sequence and length, they share a common ~100-residue MazG domain characterized by an EXXE12-28EXXD motif (&#34;X&#34; stands for any amino acid residue, and the number indicates the number of X residues).
The MazG domain does not always directly account for a certain catalytic activity. A MazG member from Escherichia coli (EcMazG) possesses two MazG domains, but only the C-terminal MazG domain is enzymatically active6. Moreover, the substrate specificity of MazG enzymes varies from non-specific nucleoside triphosphates (for EcMazG) to specific dCTP/dATP (for integrin-associated MazG) and dUTP (for dUTPases)6,7,8,9. Therefore, biophysicochemical analyses of the BA1554 protein are necessary to confirm its NTPase activity and to decipher its substrate specificity.
Here, we provide a step-by-step protocol that most laboratories without a BSL-3 facility can follow to characterize the protein product of the B. cereus bc1531 gene, which is an ortholog of B. anthracis ba1554, at the molecular level. Briefly, recombinant BC1531 (rBC1531) was expressed in E. coli and purified using an affinity tag. For X-ray crystallographic experiments, the crystallization conditions of the rBC1531 protein were screened and optimized. To assess the enzymatic activity of rBC1531, NTPase activity was monitored colorimetrically to avoid radioactively labeled nucleotides that have been conventionally used. Finally, analyses of the obtained biophysicochemical data enabled us to determine the oligomerization state and catalytic parameters of rBC1531, as well as to obtain X-ray diffraction data from the rBC1531 crystal.

<table><tbody><tr><td>&lt;em&gt;Bacillus cereus&lt;/em&gt; ATCC14579</td><td>Korean Collection for Tissue Culture</td><td>3624</td><td></td></tr><tr><td>Genomic DNA prep kit</td><td>GeneAll</td><td>106-101</td><td>Genomic DNA preparation</td></tr><tr><td>Forward primer</td><td>Macrogen</td><td>GAAGGATCCGGAAGCAAAAA&lt;br/&gt; CGATGAAAGATATGCA</td><td>&lt;em&gt;Bam&lt;/em&gt;HI site is underlined</td></tr><tr><td>Reverse primer</td><td>Macrogen</td><td>CTTGTCGACTTATTCTTTCTCT&lt;br/&gt; CCCTCATCAATACGTG</td><td>&lt;em&gt;Sal&lt;/em&gt;I site is underlined</td></tr><tr><td>nPfu-Forte</td><td>Enzynomics</td><td>P410</td><td>PCR polymerase</td></tr><tr><td>&lt;em&gt;Bam&lt;/em&gt;HI</td><td>Enzynomics</td><td>R003S</td><td></td></tr><tr><td>&lt;em&gt;Sal&lt;/em&gt;I</td><td>Enzynomics</td><td>R009S</td><td></td></tr><tr><td>pET49b expression vector</td><td>Novagen</td><td>71463</td><td>Expression vector was modified to add affinity tags and BamHI/SalI sites&lt;sup&gt;10&lt;/sup&gt;</td></tr><tr><td>T4 DNA ligase</td><td>Enzynomics</td><td>M001S</td><td></td></tr><tr><td>Dialysis memebrane</td><td>Thermofisher</td><td>18265017</td><td></td></tr><tr><td>Dry block heater</td><td>JSR</td><td>JSBL-02T</td><td></td></tr><tr><td>LB broth (Luria-Bertani)</td><td>LPS solution</td><td>LB-05</td><td></td></tr><tr><td>LB Agar, Miller (Luria-Bertani)</td><td>Becton, Dickinson and Company</td><td></td><td></td></tr><tr><td>Kanamycin</td><td>LPS solution</td><td>KAN025</td><td></td></tr><tr><td>Mini-prep kit</td><td>Favorgen</td><td>FAPDE300</td><td>Plasmid DNA preparation</td></tr><tr><td>BL21(DE3) Competent cell</td><td>Novagen</td><td>69450-3CN</td><td></td></tr><tr><td>Isopropyl &amp;beta;-D-1-thiogalactopyranoside (IPTG)</td><td>Fisher BioReagents</td><td>50-213-378</td><td></td></tr><tr><td>Sodium chloride</td><td>Daejung</td><td>7548-4100</td><td>PBS material</td></tr><tr><td>Potassium chloride</td><td>Daejung</td><td>6566-4405</td><td>PBS material</td></tr><tr><td>Potassium phosphate</td><td>Bio Basic Inc</td><td>PB0445</td><td>PBS material</td></tr><tr><td>Sodium phosphate</td><td>Bio Basic Inc</td><td>S0404</td><td>PBS material</td></tr><tr><td>Imidazole</td><td>Bio Basic Inc</td><td>IB0277</td><td></td></tr><tr><td>Sonicator</td><td>Sonics</td><td>VCX 130</td><td></td></tr><tr><td>Ni-NTA agaros</td><td>Qiagen</td><td>30210</td><td>Nickel bead</td></tr><tr><td>Rotator</td><td>Finepcr</td><td>AG</td><td></td></tr><tr><td>Precision Plus Protein Dual Color Standards</td><td>Bio-rad</td><td>1610374</td><td>SDS-PAGE protein standard</td></tr><tr><td>Coonmassie Brilliant Blue R-250</td><td>Fisher BioReagents</td><td>BP101-25</td><td>Coomassie staining solution</td></tr><tr><td>Methyl alcohol</td><td>Samchun chemical</td><td>M0585</td><td>Coomassie staining solution</td></tr><tr><td>Acetic acid</td><td>Daejung</td><td>1002-4105</td><td>Coomassie staining solution</td></tr><tr><td>Dialysis memebrane</td><td>Thermofisher</td><td>68035</td><td></td></tr><tr><td>2-Mercaptoethanol</td><td>Sigma-aldrich</td><td>M6250</td><td></td></tr><tr><td>Thrombin</td><td>Merckmillipore</td><td>605157-1KUCN</td><td>Prepare aliquots of 20 &amp;mu;L (1 Unit per &amp;mu;L) and store at 70 &amp;deg;C and thaw before use</td></tr><tr><td>Superdex 200 16/600</td><td>General Electric</td><td>28989335</td><td>Size exclusion chromatography</td></tr><tr><td>Gel filtration standard</td><td>Bio-rad</td><td>151-1901</td><td></td></tr><tr><td>Centrifugal filter</td><td>Amicon</td><td>UFC800396</td><td></td></tr><tr><td>Crystralization plates</td><td>Hampton research</td><td>HR3-083</td><td>96-well sitting drop plate</td></tr><tr><td>The JCSG core suite I-IV</td><td>Qiagen</td><td>130924-130927</td><td>Crystallization secreening solution</td></tr><tr><td>Microscope</td><td>Nikon</td><td>SMZ745T</td><td></td></tr><tr><td>Cryschem plates</td><td>Hampton research</td><td>HR3-158</td><td>24-well sitting drop plate</td></tr><tr><td>Inorganic pyrophosphatase</td><td>Sigma</td><td>10108987001</td><td></td></tr><tr><td>Ammonium molybdate solution</td><td>Sigma</td><td>13106-76-8</td><td></td></tr><tr><td>L-ascorbic acid</td><td>Sigma</td><td>50-81-7</td><td></td></tr><tr><td>NTP substrate</td><td>Startagene</td><td>200415-51</td><td></td></tr><tr><td>Spectrophotometer</td><td>Biotek</td><td>SynergyH1</td><td>microplate reader</td></tr><tr><td>GraphPad Prism 5</td><td>GraphPad</td><td>Prism 5 for Window</td><td></td></tr></tbody></table>

recombinant protein expression, crystallization, and biophysical studies of a bacillus-conserved nucleotide pyrophosphorylase, bcmazg

To overcome safety restrictions and regulations when studying genes and proteins from true pathogens, their homologues can be studied. Bacillus anthracis is an obligate pathogen that causes fatal inhalational anthrax. Bacillus cereus is considered a useful model for studying B. anthracis due to its close evolutionary relationship. The gene cluster ba1554 - ba1558 of B. anthracis is highly conserved with the bc1531- bc1535 cluster in B. cereus, as well as with the bt1364-bt1368 cluster in Bacillus thuringiensis, indicating the critical role of the associated genes in the Bacillus genus. This manuscript describes methods to prepare and characterize a protein product of the first gene (ba1554) from the gene cluster in B. anthracis using a recombinant protein of its ortholog in B. cereus, bc1531.

Characterization of the protein of interest in this study began by preparing a sufficient quantity of recombinant B. cereus bc1531 (rBC1531) protein, preferably more than several milligrams. The DNA fragment encoding the BC1531 protein was prepared by PCR using the genomic DNA of B. cereus as a template, as it contains orthologous genes identical to ba1554. rBC1531 was overexpressed as a soluble protein in E. coli cells. The rBC1531 protein was expresse...

Watch this Scientific Journal Video about Recombinant Protein Expression, Crystallization, and Biophysical Studies of a Bacillus-conserved Nucleotide Pyrophosphorylase, BcMazG at JoVE.com

Recombinant Protein Expression, Crystallization, and Biophysical Studies of a Bacillus-conserved Nucleotide Pyrophosphorylase, BcMazG

Bacillus anthracis is the obligate pathogen of fatal inhalational anthrax, so studies of its genes and proteins are strictly regulated. An alternative approach is to study orthologous genes. We describe biophysicochemical studies of a B. anthracis ortholog in B. cereus, bc1531, requiring minimal experimental equipment and lacking serious safety concerns.

Recombinant Protein Expression, Crystallization, and Biophysical Studies of a Bacillus-conserved Nucleotide Pyrophosphorylase, BcMazG

To overcome safety restrictions and regulations when studying genes and proteins from true pathogens, their homologues can be studied. Bacillus anthracis ...

recombinant-protein-expression-crystallization-biophysical-studies

Universidad San Sebastian

Research

JoVE Journal

Biochemistry

7.5K Views.  Yonsei University. Bacillus anthracis is the obligate pathogen of fatal inhalational anthrax, so studies of its genes and proteins are strictly regulated. An alternative approach is to study orthologous genes. We describe biophysicochemical studies of a B. anthracis ortholog in B. cereus, bc1531, requiring minimal experimental equipment and lacking serious safety concerns.

Video: Recombinant Protein Expression, Crystallization, and Biophysical Studies of a Bacillus-conserved Nucleotide Pyrophosphorylase, BcMazG

Production, Crystallization and Structure Determination of C. difficile PPEP-1 via Microseeding and Zinc-SAD

New therapies are needed to treat Clostridium difficile infections that are a major threat to human health. The C. difficile metalloprotease PPEP-1 is a target for future development of inhibitors to decrease the virulence of the pathogen. To perform biophysical and structural characterization as well as inhibitor screening, large amounts of pure and active protein will be needed. We have developed a protocol for efficient production and purification of PPEP-1 by the use of E. coli as the expression host yielding sufficient amounts and purity of protein for crystallization and structure determination. Additionally, using microseeding, highly intergrown crystals of PPEP-1 can be grown to well-ordered crystals suitable for X-ray diffraction analysis. The methods could also be used to produce other recombinant proteins and to study the structures of other proteins producing intergrown crystals.

Production, Crystallization and Structure Determination of C. difficile PPEP-1 via Microseeding and Zinc-SAD

Proline-proline endopeptidase-1 (PPEP-1) is a secreted metalloprotease and promising drug-target from the human pathogen Clostridium difficile. Here we describe all methods necessary for the production and structure determination of this protein.

New therapies are needed to treat Clostridium difficile infections that are a major threat to human health. The C. difficile metalloprotease PPEP-1 is a ...

Microcrystallography of Protein Crystals and In Cellulo Diffraction

The advent of high-quality microfocus beamlines at many synchrotron facilities has permitted the routine analysis of crystals smaller than 10 &#181;m in their largest dimension, which used to represent a challenge. We present two alternative workflows for the structure determination of protein microcrystals by X-ray crystallography with a particular focus on crystals grown in vivo. The microcrystals are either extracted from cells by sonication and purified by differential centrifugation, or analyzed in cellulo after cell sorting by flow cytometry of crystal-containing cells. Optionally, purified crystals or crystal-containing cells are soaked in heavy atom solutions for experimental phasing. These samples are then prepared for diffraction experiments in a similar way by application onto a micromesh support and flash cooling in liquid nitrogen. We briefly describe and compare serial diffraction experiments of isolated microcrystals and crystal-containing cells using a microfocus synchrotron beamline to produce datasets suitable for phasing, model building and refinement.
These workflows are exemplified with crystals of the Bombyx mori cypovirus 1 (BmCPV1) polyhedrin produced by infection of insect cells with a recombinant baculovirus. In this case study, in cellulo analysis is more efficient than analysis of purified crystals and yields a structure in ~8 days from expression to refinement.

Microcrystallography of Protein Crystals and In Cellulo Diffraction

A protocol is presented for X-ray crystallography using protein microcrystals. Two examples analyzing in vivo-grown microcrystals after purification or in cellulo are compared.

The advent of high-quality microfocus beamlines at many synchrotron facilities has permitted the routine analysis of crystals smaller than 10 &#181;m in ...

Expression and Purification of Mammalian Bestrophin Ion Channels

The human genome encodes four bestrophin paralogs, namely BEST1, BEST2, BEST3, and BEST4. BEST1, encoded by the BEST1 gene, is a Ca2+-activated Cl- channel (CaCC) predominantly expressed in retinal pigment epithelium (RPE). The physiological and pathological significance of BEST1 is highlighted by the fact that over 200 distinct mutations in the BEST1 gene have been genetically linked to a spectrum of at least five retinal degenerative disorders, such as Best vitelliform macular dystrophy (Best disease). Therefore, understanding the biophysics of bestrophin channels at the single-molecule level holds tremendous significance. However, obtaining purified mammalian ion channels is often a challenging task. Here, we report a protocol for the expression of mammalian bestrophin proteins with the BacMam baculovirus gene transfer system and their purification by affinity and size-exclusion chromatography. The purified proteins have the potential to be utilized in subsequent functional and structural analyses, such as electrophysiological recording in lipid bilayers and crystallography. Importantly, this pipeline can be adapted to study the functions and structures of other ion channels.

The purification of ion channels is often challenging, but once achieved, it can potentially allow in vitro investigations of the functions and structures of the channels. Here, we describe the stepwise procedures for the expression and purification of mammalian bestrophin proteins, a family of Ca2+-activated Cl- channels.

The human genome encodes four bestrophin paralogs, namely BEST1, BEST2, BEST3, and BEST4. BEST1, encoded by the BEST1 gene, is a Ca2+-activated Cl- ...

Multi-target Parallel Processing Approach for Gene-to-structure Determination of the Influenza Polymerase PB2 Subunit

Pandemic outbreaks of highly virulent influenza strains can cause widespread morbidity and mortality in human populations worldwide. In the United States alone, an average of 41,400 deaths and 1.86 million hospitalizations are caused by influenza virus infection each year 1. Point mutations in the polymerase basic protein 2 subunit (PB2) have been linked to the adaptation of the viral infection in humans 2. Findings from such studies have revealed the biological significance of PB2 as a virulence factor, thus highlighting its potential as an antiviral drug target.
The structural genomics program put forth by the National Institute of Allergy and Infectious Disease (NIAID) provides funding to Emerald Bio and three other Pacific Northwest institutions that together make up the Seattle Structural Genomics Center for Infectious Disease (SSGCID). The SSGCID is dedicated to providing the scientific community with three-dimensional protein structures of NIAID category A-C pathogens. Making such structural information available to the scientific community serves to accelerate structure-based drug design.
Structure-based drug design plays an important role in drug development. Pursuing multiple targets in parallel greatly increases the chance of success for new lead discovery by targeting a pathway or an entire protein family. Emerald Bio has developed a high-throughput, multi-target parallel processing pipeline (MTPP) for gene-to-structure determination to support the consortium. Here we describe the protocols used to determine the structure of the PB2 subunit from four different influenza A strains.

Structure-based drug design plays an important role in drug development. Pursuing multiple targets in parallel greatly increases the chance of success for lead discovery. The following article highlights how the Seattle Structural Genomics Center for Infectious Disease utilizes a multi-target approach for gene-to-structure determination of the PB2 influenza A subunit.

Pandemic outbreaks of highly virulent influenza strains can cause widespread morbidity and mortality in human populations worldwide. In the United States ...

Immunology and Infection

Engineering Cell-permeable Protein

The protein transduction technique enables the direct delivery of biologically active material into mammalian cells [for review see 1,2]. For this one can make use of the translocating ability of so-called cell penetrating peptides (CPPs), also designated as protein transduction domains (PTDs). The TAT-CPP derived from the human immunodeficiency virus type 1 (HIV-1) Tat (trans-activator of transcription) protein has been widely used. The positively charged TAT promotes cell permeability thereby overcoming the barriers of the cellular membrane by endocytosis or/and direct membrane penetration2. In combination with a nuclear localization signal (NLS) fusion proteins are able to enter the nucleus exhibiting functionality. Our video presentation demonstrates, as an exemplification for the engineering of cell-permeable proteins, the construction, production and application of a cell-permeable version of the DNA-modifying enzyme Cre.
Cre is a site-specific recombinase that is able to recognize and recombine 34 base pair loxP sites in mammalian cells in vitro and in vivo. Therefore the Cre/loxP system is widely used to conditionally induce mutations in the genome of living cells3,4. The delivery of active Cre recombinase to cells, however, represents a limitation.
We describe the pSESAME vector system, which allows a direct insertion of the gene-of-interest and provides a platform to rapidly clone different domains and tags used within the vector in a convenient and standardized manner. Rearranging of the different tags has been shown to modify the biochemical properties of the fusion proteins providing a possibility to achieve higher yield and better solubility. We demonstrate how to express and purify recombinant cell-permeant proteins in and from E. coli. The functionality of the recombinant Cre protein is finally validated in cell culture by assessing its intracellular recombinase activity.

Protein transduction enables the direct delivery of biologically active proteins into cells. In contrast to conventional methods such as DNA transfection or viral transduction this non-invasive paradigm allows highly efficient cellular manipulation in a titratable manner circumventing cellular toxicity and the risk of oncogenic transformation by permanent genetic modification.

The protein transduction technique enables the direct delivery of biologically active material into mammalian cells [for review see 1,2]. For this one can ...

Biology

Production of Recombinant PRMT Proteins using the Baculovirus Expression Vector System

Protein arginine methyltransferases (PRMTs) methylate arginine residues on a wide variety of proteins that play roles in numerous cellular processes. PRMTs can either mono- or dimethylate arginine guanidino groups symmetrically or asymmetrically. The enzymology of these proteins is a complex and intensely investigated area that requires milligram quantities of high-quality recombinant protein. The baculovirus expression vector system (BEVS) employing Autographa californica multiple nucleopolyhedrovirus (AcMNPV) and Spodoptera frugiperda 9 (Sf9) insect cells has been used for expression screening and production of many PRMTs, including PRMT 1, 2, and 4 through 9. To simultaneously screen for the expression of multiple constructs of these proteins, including domains and truncated fragments as well as the full-length proteins, we have applied scalable methods utilizing adjustable and programmable multichannel pipettes, combined with 24- and 96-well plates and blocks. Overall, these method adjustments enabled a large-scale generation of bacmid DNA, recombinant viruses, and protein expression screening. Using culture vessels with a high-fill volume of Sf9 cell suspension helped to overcome space limitations in the production pipeline for single batch large-scale protein production. Here, we describe detailed protocols for the efficient and cost-effective expression of functional PRMTs for biochemical, biophysical, and structural studies.

The baculovirus expression vector system (BEVS) is a robust platform for expression screening and production of protein arginine methyltransferases (PRMTs) to be used for biochemical, biophysical, and structural studies. Milligram quantities of material can be produced for the majority of PRMTs and other proteins of interest requiring a eukaryotic expression platform.

Protein arginine methyltransferases (PRMTs) methylate arginine residues on a wide variety of proteins that play roles in numerous cellular processes. ...

Crystallization of ABC Transporter Membrane Proteins in Lipidic Bicelles

ABCG5/G8 Crystallization in a Lipidic Bicelle Environment for X-Ray Crystallography

ATP-binding cassette (ABC) transporters constitute lipid-embedded membrane proteins. Extracting these membrane proteins from the lipid bilayer to an aqueous environment is typically achieved by employing detergents. These detergents disintegrate the lipid bilayer and solubilize the proteins. The intrinsic habitat of membrane proteins within the lipid bilayer poses a challenge in maintaining their stability and uniformity in solution for structural characterization. Bicelles, which comprise a blend of long and short-chain phospholipids and detergents, replicate the natural lipid structure. The utilization of lipid bicelles and detergents serves as a suitable model system for obtaining high-quality diffraction crystals, specifically to determine the high-resolution structure of membrane proteins. Through these synthetic microenvironments, membrane proteins preserve their native conformation and functionality, facilitating the formation of three-dimensional crystals. In this approach, the detergent-solubilized heterodimeric ABCG5/G8 was reintegrated into DMPC/CHAPSO bicelles, supplemented with cholesterol. This setup was employed in the vapor diffusion experimental procedure for protein crystallization.

Author Spotlight: A Bicelle Crystallization Setup for ABC Transporter Membrane Proteins to Advance Drug Development 

This protocol describes a setup for the crystallization of the sterol transporter ABCG5/G8. ABCG5/G8 is reconstituted into bicelles for hanging-drop crystallization. The protocol does not require specialized materials or substrates, making it accessible and easy to adapt in any laboratory for determining the protein structure through X-ray crystallography.

ATP-binding cassette (ABC) transporters constitute lipid-embedded membrane proteins. Extracting these membrane proteins from the lipid bilayer to an ...

Strategies for Expressing and Purifying Solute Carrier Transporters

High-Throughput Expression and Purification of Human Solute Carriers for Structural and Biochemical Studies

Solute carriers (SLCs) are membrane transporters that import and export a range of endogenous and exogenous substrates, including ions, nutrients, metabolites, neurotransmitters, and pharmaceuticals. Despite having emerged as attractive therapeutic targets and markers of disease, this group of proteins is still relatively underdrugged by current pharmaceuticals. Drug discovery projects for these transporters are impeded by limited structural, functional, and physiological knowledge, ultimately due to the difficulties in the expression and purification of this class of membrane-embedded proteins. Here, we demonstrate methods to obtain high-purity, milligram quantities of human SLC transporter proteins using&#160;codon-optimized gene sequences. In conjunction with a systematic exploration of construct design and high-throughput expression, these protocols ensure the preservation of the structural integrity and biochemical activity of the target proteins. We also highlight critical steps in the eukaryotic cell expression, affinity purification, and size-exclusion chromatography of these proteins. Ultimately, this workflow yields pure, functionally active, and stable protein preparations suitable for high-resolution structure determination, transport studies, small-molecule engagement assays, and high-throughput in vitro screening.

Author Spotlight: Expression and Purification of Human Solute Carrier Transporters Using Codon-Optimized Genes 

Structural and biochemical studies of human membrane transporters require milligram quantities of stable, intact, and homogeneous protein. Here we describe scalable methods to screen, express, and purify human solute carrier transporters using codon-optimized genes.

Solute carriers (SLCs) are membrane transporters that import and export a range of endogenous and exogenous substrates, including ions, nutrients, ...

The MultiBac Protein Complex Production Platform at the EMBL

Proteomics research revealed the impressive complexity of eukaryotic proteomes in unprecedented detail. It is now a commonly accepted notion that proteins in cells mostly exist not as isolated entities but exert their biological activity in association with many other proteins, in humans ten or more, forming assembly lines in the cell for most if not all vital functions.1,2 Knowledge of the function and architecture of these multiprotein assemblies requires their provision in superior quality and sufficient quantity for detailed analysis. The paucity of many protein complexes in cells, in particular in eukaryotes, prohibits their extraction from native sources, and necessitates recombinant production. The baculovirus expression vector system (BEVS) has proven to be particularly useful for producing eukaryotic proteins, the activity of which often relies on post-translational processing that other commonly used expression systems often cannot support.3 BEVS use a recombinant baculovirus into which the gene of interest was inserted to infect insect cell cultures which in turn produce the protein of choice. MultiBac is a BEVS that has been particularly tailored for the production of eukaryotic protein complexes that contain many subunits.4 A vital prerequisite for efficient production of proteins and their complexes are robust protocols for all steps involved in an expression experiment that ideally can be implemented as standard operating procedures (SOPs) and followed also by non-specialist users with comparative ease. The MultiBac platform at the European Molecular Biology Laboratory (EMBL) uses SOPs for all steps involved in a multiprotein complex expression experiment, starting from insertion of the genes into an engineered baculoviral genome optimized for heterologous protein production properties to small-scale analysis of the protein specimens produced.5-8 The platform is installed in an open-access mode at EMBL Grenoble and has supported many scientists from academia and industry to accelerate protein complex research projects.

Protein complexes catalyze key cellular functions. Detailed functional and structural characterization of many essential complexes requires recombinant production. MultiBac is a baculovirus/insect cell system particularly tailored for expressing eukaryotic proteins and their complexes. MultiBac was implemented as an open-access platform, and standard operating procedures developed to maximize its utility.

Proteomics  research revealed the impressive complexity of eukaryotic proteomes in  unprecedented detail. It is now a commonly accepted notion that ...

Protein Crystallization

Protein crystallization, obtaining a solid lattice of biomolecules, elucidates protein structure and enables the study of protein function. Crystallization involves drying purified protein under a combination of many factors, including pH, temperature, ionic strength, and protein concentration. Once crystals are obtained, the protein structure can be elucidated by x-ray diffraction and computation of an electron density model.
This video introduces protein crystallization and shows a general procedure. Protein expression and purification, crystallization, and x-ray diffraction are covered in the procedure. Applications of protein crystallization include in silico drug design, binding site determination, and membrane protein structure analysis.
<div class="chapter_text" id="script_0">
Protein crystallization is the process of obtaining a latticed solid form of a protein. These crystals are especially valuable to structural biologists, assisting in the study of protein function. Other techniques, such as mass spec or SDS-PAGE, can only provide information on the one-dimensional structure of proteins. Protein crystallization is complemented by the techniques of recombinant protein expression and x-ray diffraction. This video will show the principles of protein crystallization, a general laboratory procedure, and several of its applications in the biochemical field.
</div>
<div class="chapter_text" id="script_1">
The first step required in the process is to obtain milligram quantities of very pure protein, typically using recombinant protein expression. The gene corresponding to the protein of interest is cloned into an expression vector, and the expressed protein is fused to an affinity tag, such as poly-histidine, to assist in the purification by affinity chromatography. To learn more, see this collection&#39;s video on affinity chromatography.
Formation of the purified protein into crystals is dependent on the proper combination of many factors, including pH, ionic strength, concentrations of precipitant and protein, temperature, and rate of equilibration. The most common method used is vapor diffusion, of which there are two categories: hanging drop and sitting drop. A droplet containing pure protein, buffer, and precipitant, which is an ionic solid that binds water molecules, reducing water availability for the protein and mimicking higher protein concentration, is in an enclosed microwell with a reservoir with a more highly concentrated mixture of the same buffer and precipitant. At the beginning, the concentrations of protein and precipitant are too low to cause crystallization. During the course of the experiment, water vaporizes from the droplet and collects in the reservoir; a decrease in the amount of water in the droplet causes the system to become supersaturated, and nucleation, followed by crystallization, can occur. The net transfer of water from the droplet is in equilibrium, and the system is maintained until the process is complete.
To visualize the 3D structure, x-ray diffraction is used. To obtain x-ray data from a crystal, it is placed in a monochromatic x-ray beam, where it is exposed to the beam at all angles. Each exposure provides an image, where each spot is a diffracted x-ray, which emerges from the crystal and is registered by a detector. The data are combined to produce a model of the arrangement of atoms within the crystal. The resulting crystal structure demonstrates the 3-dimensional placement of the atoms, with a typical resolution of 2 angstroms.

</div>
<div class="chapter_text" id="script_2">
Now that we have covered the principles of protein crystallization, let us look at a generalized protocol.
To begin the procedure an expression vector containing the gene of interest is transformed into cells. The cells are incubated and at mid-log phase, expression is initiated by adding an inducer, such as IPTG, which triggers transcription of the gene&#39;s mRNA. After protein expression, the crude material is suspended in lysis buffer, and then clarified by centrifugation.
The clarified lysate is then loaded onto a nickel column, and the polyhistidine-tagged protein binds to the column while all other biomolecules are washed away.
Once several milligrams of pure protein have been obtained, it is ready for crystallization by vapor diffusion. A 24-well hanging/sitting drop tray is filled with varying concentrations of sodium chloride and sodium acetate buffer solutions. For the sitting drop method, equal volumes of protein and reservoir solution are pipetted onto the shelf above each well, and then the tray is covered with transparent tape. The tray is then placed in an incubation chamber, and the wells are monitored for growth the following day, then every few days.
Once a proper crystal has been obtained it is ready for x-ray diffraction analysis. The crystal is mounted on a goniometer to position the crystal at selected orientations. The crystal is illuminated with a monochromatic beam of x-rays at all angles, producing a diffraction pattern. The software converts the two-dimensional images, taken at different orientations, to a three-dimensional model of the density of electrons within the crystal by determining the positions of the atoms in the crystal.
</div>
<div class="chapter_text" id="script_3">
Now that we have reviewed a procedure, let&#39;s review some useful applications of protein crystallization, and another crystallization technique.
Protein crystallization may be used for in silico drug design. The three-dimensional structure of Influenza virus&#39;s polymerase basic protein 2, which has been linked to viral infection in mammals, was determined by crystallization and x-ray diffraction. Potential binding sites in the protein are visualized, and with the use of a docking program, a three-dimensional molecule was designed that would insert into a cleft in the protein.
Co-crystallization of protein-DNA complexes is also a useful technique. DNA-binding proteins modulate a wide variety of biological functions such as transcription and DNA polymerization and DNA repair; and crystal structures of these complexes can provide insight into protein function, mechanism, and the nature of the specific interaction. The E. coli protein SeqA, a negative regulator of DNA replication, was co-crystallized with hemimethylated DNA.
Integral membrane proteins such as G-protein coupled receptors, or GCPRs, are difficult to crystallize due to their limited amount of polar surface area available for forming crystal lattice contacts, which has led to the development of fusion-protein-assisted protein crystallization. Genes encoding &#946;2 adrenergic receptor, a GCPR, and a lysozyme were inserted into an expression vector. The crystallization of the &#946;2AR- lysozyme fusion protein was achieved due to the increased extracellular hydrophilic surface over the naturally hydrophobic &#946;2AR, provided by the lysozyme, necessary for forming packing interactions in the crystal lattice.
</div>
<div class="chapter_text" id="script_4">
You&#39;ve just watched JoVE&#39;s video on protein crystallization. This video described its principles, a generalized protocol, and some its uses in the biomedical field. Thanks for watching!
</div>

Recombinant Protein Expression, Crystallization, and Biophysical Studies of a Bacillus-conserved Nucleotide Pyrophosphorylase, BcMazG

Summary

Explore More Videos

Chapters in this video

Production, Crystallization and Structure Determination of C. difficile PPEP-1 via Microseeding and Zinc-SAD

Microcrystallography of Protein Crystals and In Cellulo Diffraction

Expression and Purification of Mammalian Bestrophin Ion Channels

Multi-target Parallel Processing Approach for Gene-to-structure Determination of the Influenza Polymerase PB2 Subunit

Engineering Cell-permeable Protein

Production of Recombinant PRMT Proteins using the Baculovirus Expression Vector System

ABCG5/G8 Crystallization in a Lipidic Bicelle Environment for X-Ray Crystallography

High-Throughput Expression and Purification of Human Solute Carriers for Structural and Biochemical Studies

The MultiBac Protein Complex Production Platform at the EMBL

Protein Crystallization