Development of this protocol was supported by the Advancing a Healthier Wisconsin and the National Center for Advancing Translational Sciences, National Institutes of Health, through Grant Number 8UL1TR000055. Its contents are solely the responsibility of the authors and do not necessarily represent the official views of the NIH.

NOTE: Patients and/or their guardians should give informed consent to participate in an Institutional Review Board approved study.
1. Buffers and Media Preparations
<ol>
	<li>Washing buffer: To prepare 100 ml of washing buffer, add 1 ml of 100x pen/strep Solution (100 U/ml penicillin + 100 &#181;g/ml of Streptomycin) to 99 ml of phosphate buffer saline (PBS).</li>
	<li>Urinary Progenitor Cell (UPC) Medium: To prepare UPC medium, mix equal volumes of Keratinocyte Serum Free (KSF) Medium + Progenitor Cell Medium.
	<ol>
		<li>KSF Medium: To prepare keratinocyte medium, add 5 ng/ml of epidermal growth factor (EGF), 50 ng/ml of bovine pituitary extract (BPE), 30 ng/ml of cholera toxin, and pen/strep solution (100 U/ml penicillin, 100 &#181;g/ml streptomycin) to 500 ml KSF medium.</li>
		<li>Progenitor Cell Medium: Add three quarters of DMEM with one quarter of Ham-F12 media and supplement with 10% FBS, 0.4 &#181;g/ml hydrocortisone, 0.1 nM cholera toxin, 5 ng/ml insulin, 1.8 x 10-4 M adenine, 5 &#181;g/ml transferrin, 2 x 10-9 M triiodo thyronine, 10 ng/ml EGF, and pen/strep solution.</li>
	</ol>
	</li>
	<li>hES Medium: Add 20% KO-serum replacement (K-SR), 1x MEM non-essential amino acids, 2 mM l-glutamine, 100 &#181;M &#946;-mercaptoethanol, 20 ng/ml bFGF and pen/strep to 400 ml DMEM/F12 medium.</li>
</ol>
2. Urine Sample Collection
<ol>
	<li>Instruct the patients to drink fluids 30 min prior to urine collection to ensure that an adequate amount (~30&#8211;40 ml) of urine can be collected.</li>
	<li>Give the patients and/or their guardians a urine collection kit containing the following items: (1) written instructions on how to obtain sterile or clean catch urine sample, (2) moist anti-bacterial toilettes, and (3) a 100 ml sterile specimen collection cup. Instruct patients to collect sample.</li>
	<li>Immediately place the urine samples on ice and transfer to the laboratory in a cooler. Process the urine for cell isolation immediately. If a delay is unavoidable, store the specimen on ice for up to 4 hr with minimal loss of cell viability.</li>
</ol>
3. Isolation and Expansion of Urine Cells
NOTE: Perform the following steps under sterile conditions in a BSL2 Biological Safety Cabinet.
<ol>
	<li>Using sterile pipettes, transfer urine samples to sterile 50-ml centrifuge tubes. Centrifuge at 400 &#215; g for 10 min at RT.</li>
	<li>Aspirate the supernatant leaving 1 ml in the tube; be careful not to disturb the cell pellet.</li>
	<li>Resuspend and combine the pellets from multiple tubes into 7 ml of washing buffer and repeat centrifugation at 400 &#215; g for 10 min at RT.</li>
	<li>Carefully aspirate the supernatant, leaving the cell pellet and ~0.2&#8211;0.5 ml of supernatant. Resuspend in 2&#8211;3 ml of Urinary Progenitor Cell (UPC) medium and transfer the suspension into 4&#8211;6 wells of an uncoated 24-well plate.</li>
	<li>After 72 hr, supplement the culture with 0.5 ml of fresh UPC medium per well and change medium every 2&#8211;3 days after. The erythrocytes and squamous cells that do not attach to the plate will be removed with the medium changes.</li>
	<li>Monitor culture after 4&#8211;6 days. 
	NOTE: Small 2&#8211;4 cell colonies will start to appear. Cells will be rounded or elongated which represent type I or type II of renal epithelial (RE) cells respectively3.</li>
	<li>Change the medium every 2&#8211;3 days since once the cells appear, they will undergo a rapid expansion phase.</li>
	<li>Once the cells reach 80&#8211;90% confluence, around 9&#8211;15 days after plating, dissociate and passage the cells (15,000&#8211;18,000 cells/cm2) onto 2&#8211;4 wells of 24 well plate for further expansion. Mark this as cell passage 1 (P1).</li>
	<li>Characterize urine cells for lineage specifications through flow cytometric analysis, immunohistochemical staining or through reverse transcriptase-polymerase chain reaction (RT-PCR).</li>
	<li>Reprogram isolated urine cells (section 4) or freeze them down in Freezing Medium (DMEM supplemented with 10% serum and 10% DMSO) for long-term cryostorage.</li>
</ol>
4. Urine Cell Reprogramming Using Sendai Virus
NOTE: The proper handling and the use of PPE (personal protective equipment) is recommended while manipulating the transfecting agents. Perform the following steps under sterile conditions in a BSL2 Biological Safety Cabinet. The proper disposal of transfecting agent and/or transfected cells is recommended to avoid risk of environmental and health hazards. For urine cell reprogramming, use a Sendai Reprogramming Kit with modifications to the manufacturer&#8217;s feeder-dependent protocol as detailed below.
<ol>
	<li>To ensure high efficiency reprogramming using the Sendai virus, use passages 1&#8211;5 of urine cells that are rapidly dividing. If the cells do not replicate well or become senescent, discard them as they will not reprogram efficiently.</li>
	<li>Seed 60,000 cells per well in two wells of a 6 well plate. Mark this as Day -2. Adjust cell seeding density (5 x 104 &#8211; 9 x 104 cells per well) as needed to reach 80&#8211;90% confluence by Day 0.</li>
	<li>On Day 0 (48 hr after plating the cells), prepare the Sendai reprogramming vectors (SeV) containing each of the four OSKM factors. Add each of the vectors to 1 ml of pre-warmed UPC medium. Use an MOI of 1&#8211;1.5 (5&#8211;7.5 x 105 CIU), which is sufficient for reprogramming urine cells. Aspirate the medium and slowly add the 1 ml UPC + SeV to one well of the urine cells. Use the second well as the transduction negative control.</li>
	<li>On Day 1, replace the UPC + SeV medium with fresh UPC medium. Some cell death is seen after 24 h due to viral cytotoxicity.</li>
	<li>Depending on efficiency of reprogrammed clone formations and the compact morphology, keep changing the medium daily until day 6 or 7.</li>
	<li>One day prior to dissociation of transduced cells (day 5 or 6), prepare MEF feeder plates by plating Mitomycin-C (10 &#181;g/ml for 3 hr) treated-MEFs at density of 5 x 104 cells/cm2, on 0.1% gelatin coated 100 mm2 culture dishes.</li>
	<li>Next day (day 6 or 7), dissociate the cells with 0.25% trypsin, resuspend the cells in UPC medium and plate 5 x 104 &#8211; 2 x 105 cells/100 mm2 MEF feeder plate.</li>
	<li>The following day, switch to hES medium and change the medium every day. Observe the cells under a microscope to monitor transformed cells. 
	NOTE: The cells form clonal aggregates with characteristic cobblestone morphology and having higher nucleus to cytoplasmic ratio (12&#8211;18 days post transduction).</li>
	<li>Within two to three weeks after transduction, pick colonies and transfer to new plates for clonal expansion.</li>
	<li>Perform live cell staining for selecting iPSC clones by incubating cells with TRA-1-81 antibody for 1 hr at 37 &#176;C in CO2 incubator followed by counter staining with specific florescent dye conjugated secondary antibody for 1 hr at 37 &#176;C in CO2 incubator.</li>
	<li>Use a 26 G&#160;1&#189; inch needle to cross-hatch the larger TRA-1-81 positive iPSC clones into small equal sized pieces (4&#8211;6 pieces per clone).</li>
	<li>Use a sterile pipette-tip to pick and transfer 10&#8211;20 cross-hatched pieces from multiple clones into each well of Matrigel (10 &#181;g/cm2)-coated 24 well plate with hES medium. 
	NOTE: Pieces from a single clone plated individually into a single well do not expand or maintain pluripotency.</li>
	<li>Change from hES to iPSC medium 24&#8211;48 hr after the reprogrammed clones are attached to the Matrigel surface.</li>
	<li>During maintenance on Matrigel-coated plates, manually scrape-off any differentiated cells or contaminating MEF feeder cells using a pipette-tip to enrich for fully reprogrammed and pluripotent dystrophic iPSC (MD-iPSC) clones.</li>
	<li>After individual clones have reached ~100 &#956;m size, expand the clones by dissociating with 0.48 mM EDTA (ethylenediaminetetraacetic acid) solution for 3 min and plating small cell aggregates of MD-iPSCs suspended in iPSC medium (supplemented with 5 &#956;M Y27632, RhO Kinase inhibitor) on fresh matrigel (10 &#181;g/cm2) coated 12 well plate. Change iPSC medium daily.</li>
	<li>Full reprogramming of each clone can be determined by both gene expression analysis of OSKM genes and immunohistochemical staining of pluripotency markers (Oct3/4 and TRA-1-81). A rigorous evaluation of pluripotency potential should be employed to confirm fully reprogrammed iPSC lines can differentiate into three germ layers. This can be accomplished either by embryoid body (EB) formation and differentiation assay or a teratoma formation assay.</li>
</ol>

<ol>
	<li>Guan, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dystrophin-deficient+cardiomyocytes+derived+from+human+urine:+New+biologic+reagents+for+drug+discovery.">Dystrophin-deficient cardiomyocytes derived from human urine: New biologic reagents for drug discovery.</a> Stem Cell Research. 12 (2), 467-480 (2014).</li><li>Dick, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Exon+Skipping+and+Gene+Transfer+Restore+Dystrophin+Expression+in+Human+Induced+Pluripotent+Stem+Cells-Cardiomyocytes+Harboring+DMD+Mutations.">Exon Skipping and Gene Transfer Restore Dystrophin Expression in Human Induced Pluripotent Stem Cells-Cardiomyocytes Harboring DMD Mutations.</a> Stem Cells Dev. 22 (20), 2714-2724 (2013).</li><li>Zhou, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Generation+of+human+induced+pluripotent+stem+cells+from+urine+samples.">Generation of human induced pluripotent stem cells from urine samples.</a> Nat Protoc. 7 (12), 2080-2089 (2012).</li><li>Bellin, M., Marchetto, M. C., Gage, F. H., Mummery, C. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Induced+pluripotent+stem+cells:+the+new+patient.">Induced pluripotent stem cells: the new patient.</a> Nat Rev Mol Cell Biol. 13 (11), 713-726 (2012).</li><li>Carvajal-Vergara, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Patient-specific+induced+pluripotent+stem-cell-derived+models+of+LEOPARD+syndrome.">Patient-specific induced pluripotent stem-cell-derived models of LEOPARD syndrome.</a> Nature. 465 (7299), 808-812 (2010).</li><li>Sun, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Patient-Specific+Induced+Pluripotent+Stem+Cells+as+a+Model+for+Familial+Dilated+Cardiomyopathy.">Patient-Specific Induced Pluripotent Stem Cells as a Model for Familial Dilated Cardiomyopathy.</a> Science Translational Medicine. 4 (130), 130ra147 (2012).</li><li>Zhang, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Urine+derived+cells+are+a+potential+source+for+urological+tissue+reconstruction.">Urine derived cells are a potential source for urological tissue reconstruction.</a> J Urol. 180 (5), 2226-2233 (2008).</li><li>Bayart, E., Cohen-Haguenauer, O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Technological+overview+of+iPS+induction+from+human+adult+somatic+cells.">Technological overview of iPS induction from human adult somatic cells.</a> Curr Gene Ther. 13 (2), 73-92 (2013).</li><li>Malik, N., Rao, M. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+review+of+the+methods+for+human+iPSC+derivation.">A review of the methods for human iPSC derivation.</a> Methods Mol Biol. 997, 23-33 (2013).</li><li>Nakanishi, M., Otsu, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+of+Sendai+virus+vectors+and+their+potential+applications+in+gene+therapy+and+regenerative+medicine.">Development of Sendai virus vectors and their potential applications in gene therapy and regenerative medicine.</a> Curr. Gene Ther. 12 (5), 410-416 (2012).</li><li>Gonz&#225;lez-Ram&#237;rez, R., Morales-L&#225;zaro, S. L., Tapia-Ram&#237;rez, V., Mornet, D., Cisneros, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nuclear+and+nuclear+envelope+localization+of+dystrophin+Dp71+and+dystrophin-associated+proteins+(DAPs)+in+the+C2C12+muscle+cells:+DAPs+nuclear+localization+is+modulated+during+myogenesis.">Nuclear and nuclear envelope localization of dystrophin Dp71 and dystrophin-associated proteins (DAPs) in the C2C12 muscle cells: DAPs nuclear localization is modulated during myogenesis.</a> J Cell Biochem. 105 (3), 735-745 (2008).</li><li>Villarreal-Silva, M., Centeno-Cruz, F., Su&#225;rez-S&#225;nchez, R., Garrido, E., Cisneros, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Knockdown+of+dystrophin+Dp71+impairs+PC12+cells+cycle:+localization+in+the+spindle+and+cytokinesis+structures+implies+a+role+for+Dp71+in+cell+division.">Knockdown of dystrophin Dp71 impairs PC12 cells cycle: localization in the spindle and cytokinesis structures implies a role for Dp71 in cell division.</a> PloS One. 6 (8), e23504 (2011).</li></ol>

The authors declare that they have no competing financial interests.

Modeling cardiovascular diseases using iPSCs is becoming a common approach to understand the genetic contribution4-6. Some unanticipated difficulties of obtaining cell samples from patients, especially young children, can be avoided by offering the option of a non-invasive approach such as a urine collection. In this young patient population, it is often difficult to collect a volume of urine sufficient to yield enough urine cells for reprogramming. Coaching the young patients to drink fluids 30 min prior to the urine collection improves the success of urine cell isolation. However, repeat urine collections may be necessary in this population. We have combined and adapted two different protocols3,7 in order to optimize the isolation and culture of UCs from patients with muscular dystrophy.
Induced pluripotent stem cells have been generated from either skin fibroblasts or urine cells from muscular dystrophy patients1,2. However, both reprogramming protocols relied on lentiviruses to introduce the reprogramming factors into the somatic cells. This integrating virus delivery method can be problematic if the transgene randomly integrates into the host genome and causes either transgene reactivation or mutagenesis (reviewed in 8). Therefore, we improved upon these techniques by using the Sendai virus to transduce the OSKM transgenes into the urine cells in a non-integrating manner9.
This method using Sendai virus to reprogram UCs offers the advantage of a non-integrating approach with a higher transduction efficiency9,10. Urine cells collected from muscular dystrophy patients are reprogrammed within 2&#8211;3 weeks post-transduction. These reprogramming kinetics are comparable to UC reprogramming using lentiviral transduction1. Although this protocol can be scaled to establish feeder-free method for urine cell reprogramming, being an efficient method using Sendai-virus transduction of urine cells isolated from muscular dystrophy patients. This method described relies on MEFs as a feeder-layer in order to fully establish the pluripotent MD clone prior to transfer to feeder-free conditions at passage 2.
The nuclear distribution of the Dp71 isoform of the dystrophin protein has long been established in different embryonic stage cell models11,12. This ubiquitous expression of Dp71 in nuclear matrix fraction of early progenitor/embryonic stage cells suggests their role in nuclear architecture and cell cycle regulation12. Our reprogrammed wild type iPSCs express Dp71; however, its absence in dystrophic iPSCs does not inhibit the reprogramming or pluripotent potential of dystrophic cells. In conclusion, the dystrophic gene mutations are conserved in reprogrammed iPSCs; making it an efficient tool to model dystrophic cardiomyopathy.

Cardiomyopathy is the second leading cause of death in patients with Duchenne and Becker muscular dystrophy (MD). Although mutations in the X-linked dystrophin gene occur in 1:3,500 male births, very little is known about the molecular and cellular events leading to progressive cardiac muscle damage. Human induced pluripotent stem cells derived from muscular dystrophy patients have emerged as a novel tool to study the underlying disease mechanisms and to use for drug screening1,2.
The anticipated discomfort of skin biopsies or blood samples may dissuade young patients and/or their guardians to give consent for study participation. Urine samples are a non-invasive source of somatic cells that are amendable to reprogramming methods. We have recently shown that urine cells collected from muscular dystrophy patients may be cultured and efficiently reprogrammed into iPSCs using retroviral transduction with the Yamanaka factors (Oct3/4, Sox2, Klf4, and c-Myc; OSKM)1. The disadvantage of retroviral gene delivery is the random integration of the reprogramming genes into the host chromosomes. To overcome this limitation, we have used the non-integrating Sendai virus for urine cell reprogramming.
This protocol details the Sendai virus reprogramming of isolated urine cells from muscular dystrophy patients which can then be differentiated into cardiomyocytes or other cell types for further study. This protocol can also be adapted for other patient specific diseases.

<table><tbody><tr><td colspan="4">&lt;strong&gt;Materials&lt;/strong&gt;</td></tr><tr><td>4 Oz. Specimen Cup with Lid</td><td>STL Medical Supply</td><td>M9AMSAS340</td><td>For Urine Sample Collection</td></tr><tr><td>15 ml BD-Falcon Tubes</td><td>Fisher Scientific</td><td>352097</td><td></td></tr><tr><td>50 ml BD-Falcon Tubes</td><td>Fisher Scientific</td><td>352098</td><td></td></tr><tr><td>Round Glass Coverslips</td><td>Fisher Scientific</td><td>12-545-81</td><td></td></tr><tr><td>CytoTune-iPS Sendai Reprogramming Kit</td><td>Life Technologies</td><td>A1378-001</td><td></td></tr><tr><td>PBS, pH 7.4</td><td>Life Technologies</td><td>10010-023</td><td></td></tr><tr><td>Pen-Strep w/o Glutamine&amp;nbsp;</td><td>Life Technologies</td><td>15140-122</td><td>Warm in 37 &amp;deg;C water bath before use</td></tr><tr><td>RPMI Medium 1640</td><td>Life Technologies</td><td>11875-093</td><td>Warm in 37 &amp;deg;C water bath before use</td></tr><tr><td>B-27 Supplement w/Insulin (50x)</td><td>Life Technologies</td><td>17504-044</td><td>Warm in 37 &amp;deg;C water bath before use</td></tr><tr><td>B-27 Supplement w/o Insulin (50x)</td><td>Life Technologies</td><td>0050129SA</td><td>Warm in 37 &amp;deg;C water bath before use</td></tr><tr><td>DMEM/F12 (1:1)</td><td>Life Technologies</td><td>11330-032</td><td>Warm in 37 &amp;deg;C water bath before use</td></tr><tr><td>Versene, 1:5,000</td><td>Life Technologies</td><td>15040066</td><td>Warm in 37 &amp;deg;C water bath before use</td></tr><tr><td>bFGF (10 &amp;micro;g)</td><td>Life Technologies</td><td>13256-029</td><td>Warm in 37 &amp;deg;C water bath before use</td></tr><tr><td>Cell Counter Cartridges</td><td>Life Technologies</td><td>C10228</td><td></td></tr><tr><td>Knockout Serum (500&amp;nbsp;ml Bottle)</td><td>Life Technologies</td><td>10828-028</td><td>Warm in 37 &amp;deg;C water bath before use</td></tr><tr><td>Recovery Cell Culture Freezing Medium</td><td>Life Technologies</td><td>12648-010</td><td></td></tr><tr><td>Keratinocyte-SFM (1x), Liquid</td><td>Life Technologies</td><td>17005-042</td><td>Warm in 37 &amp;deg;C water bath before use</td></tr><tr><td>DMEM, High Glucose, Glutamax</td><td>Life Technologies</td><td>10566-016</td><td>Warm in 37 &amp;deg;C water bath before use</td></tr><tr><td>Ham&#039;s F-12 Nutrient Mix&amp;nbsp;</td><td>Life Technologies</td><td>11765-054</td><td>Warm in 37 &amp;deg;C water bath before use</td></tr><tr><td>EGF Recombinant Human Protein, Liquid Form</td><td>Life Technologies</td><td>PHG0311L</td><td>Warm in 37 &amp;deg;C water bath before use</td></tr><tr><td>Insulin, Human Recombinant, Zinc Soln</td><td>Life Technologies</td><td>12585-014</td><td>Warm in 37 &amp;deg;C water bath before use</td></tr><tr><td>TeSR-E8</td><td>Stem Cell Technologies</td><td>5940</td><td>Warm in 37 &amp;deg;C water bath before use</td></tr><tr><td>ROCK Inhibitor (Y-27632)</td><td>Selleck</td><td>S1049</td><td>Warm in 37 &amp;deg;C water bath before use</td></tr><tr><td>Matrigel</td><td>BD Biosciences</td><td>354277</td><td>hESC Qualified Matrix, LVED Free</td></tr><tr><td>RNeasy Mini Kit&amp;nbsp;</td><td>Qiagen</td><td>74104</td><td></td></tr><tr><td>iScript cDNA Synthesis Kit</td><td>Bio-Rad</td><td>170-8890</td><td></td></tr><tr><td>DreamTaq Green PCR Master Mix (2x)</td><td>Thermo-Scientific</td><td>K1081</td><td></td></tr><tr><td>FBS-Qualified</td><td>Sigma Aldrich</td><td>F6178</td><td>Warm in 37 &amp;deg;C water bath before use</td></tr><tr><td>Adenine Bioreagent</td><td>Sigma Aldrich</td><td>A2786-5G</td><td>Warm in 37 &amp;deg;C water bath before use</td></tr><tr><td>Cholera Toxin from &lt;em&gt;Vibrio cholerae&lt;/em&gt;</td><td>Sigma Aldrich</td><td>C8052-.5MG</td><td>Warm in 37 &amp;deg;C water bath before use</td></tr><tr><td>Hydrocortisone</td><td>Sigma Aldrich</td><td>H0888-1G</td><td>Warm in 37 &amp;deg;C water bath before use</td></tr><tr><td>Holo-transferrin from human</td><td>Sigma Aldrich</td><td>T0665-50MG</td><td>Warm in 37 &amp;deg;C water bath before use</td></tr><tr><td>3,3&#039;,5-Triiodo-L-thyronine sodium salt</td><td>Sigma Aldrich</td><td>T6397-100MG</td><td>Warm in 37 &amp;deg;C water bath before use</td></tr><tr><td>DAPI&amp;nbsp;</td><td>Santa Cruz Biotechnology</td><td>SC-3598</td><td></td></tr><tr><td>Fluoromount Aquous mounting medium</td><td>Sigma Aldrich</td><td>F4680</td><td></td></tr><tr><td>16% Paraformaldehyde</td><td>Alfa-Aesar</td><td>43368</td><td></td></tr><tr><td colspan="4">&lt;strong&gt;Antibodies&lt;/strong&gt;</td></tr><tr><td>Mouse anti CD44 - labeled with FITC&amp;nbsp;</td><td>BD Biosciences</td><td>560977</td><td></td></tr><tr><td>Mouse anti CD146 - labeled with PE</td><td>BD Biosciences</td><td>561013</td><td></td></tr><tr><td>Mouse anti CD73 - labeled with PE</td><td>BD Biosciences</td><td>561014</td><td></td></tr><tr><td>Mouse anti-&amp;alpha;-smooth muscle actin</td><td>Sigma Aldrich</td><td>A2547</td><td></td></tr><tr><td>Mouse anti-Vimentin</td><td>Abcam</td><td>ab8978-100</td><td></td></tr><tr><td>Mouse Anti - TRA-1-81</td><td>Life Technologies</td><td>411100</td><td></td></tr><tr><td>Rabbit anti Oct 3/4</td><td>Santa Cruz Biotechnology</td><td>SC-9081</td><td></td></tr><tr><td>Mouse Anti Dystrophin</td><td>Leica Biosystems</td><td>NCL-DYSB</td><td></td></tr></tbody></table>

generation of induced pluripotent stem cells from muscular dystrophy patients: efficient integration-free reprogramming of urine derived cells

Dystrophic cardiomyopathy is a poorly understood consequence of muscular dystrophy. Generating induced Pluripotent Stem Cells (iPSCs) from patients with muscular dystrophy is an invaluable cellular source for in&#160;vitro disease model systems and can be used for drug screening studies. Patient-derived urine cells have been used in successful reprogramming into induced pluripotent stem cells in order to model dystrophic cardiomyopathy1. Addressing the safety concerns of integrating vector systems, we present a protocol using a non-integrating Sendai virus vector for transduction of Yamanaka factors into urine cells collected from patients with muscular dystrophy. This protocol generates fully reprogrammed clones within 2&#8211;3 weeks. The pluripotent cells are vector-free by passage-13. These dystrophic iPSCs can be differentiated into cardiomyocytes and used either to study disease mechanisms or for drug screening.

Most progenitor cells isolated from human urine are positive for uroepithelial progenitor and pericyte markers such as CD44, CD73, and CD146 (97.37%, 97.09%, and 97.3% respectively; Figure 1A and 1B). These cells also expressed other mesenchymal markers such as alpha-smooth muscle actin and vimentin (Figure 1B). RT-PCR analysis gives evidence of a mixed population of cells in the cultures in that there is weak expression of Cytokeratin-7 (CK-7) and Uroplakin (UP)-Ia &#38; -IIIa, markers of uroepithelial lineage (Figure 1C).
The reprogramming steps are summarized by schematic in Figure 2A. Representative images demonstrate the morphology of the cells during different time points throughout the protocol (Figure 2B). The urine cells transform from elongated, type II cells (Day 0) into a cobblestone pattern (Day 4) during reprogramming. By Day 12, typical pluripotent clones (iPSC) are seen and are able to maintain their pluripotent morphology under feeder free conditions (iPSC-P2). Live cell staining for TRA-1-81 identifies reprogrammed clones (Figure 2C).
To confirm the generation of vector and transgene free pluripotent clones, RT-PCR is performed using primers against the SeV viral genome and each of the exogenous OSKM factors. The up-regulation of endogenous reprogramming factors can also be confirmed at this step. The exogenous gene expression is no longer detected by passage-13, but the up-regulation of endogenous factors is seen (Figure 3A). Immunofluorescent staining confirms pluripotency marker expression on iPSCs (Oct3/4 and TRA-1-81; Figure 3B). The endogenous reprogramming gene expression seen in urine cells may lead these cells to reprogram at higher efficiencies1, as compared to other somatic cell sources. The expression of dystrophin gene and protein is verified by immunofluorescence staining, western blot (WB) and RT-PCR analyses (Figure 3C-E). Immunofluorescent staining of wild type UCs and iPSCs for dystrophin demonstrate evident nuclear localization11 in iPSCs, but very few UCs expressed positive (Figure 3C). To verify dystrophin expression in the cells, immunoblot analysis for dystrophin revealed that the ubiquitous dystrophin isoform (Dp71) is the predominant isoform produced in wild type iPSCs, while dystrophic iPSCs lacking dystrophin gene expression has undetectable Dp71 expression (Figure 3D). The exon deletion mutations of dystrophin can be confirmed in the dystrophic iPSCs using specific primers flanking the deleted exons. No PCR amplification is detected in the dystrophic iPSCs whereas wild type iPSCs demonstrate dystrophin transcript amplification (Figure 3E).
<img alt="Figure 1" src="/files/ftp_upload/52032/52032fig1.jpg" /> 
Figure 1. Characterization of isolated Urine Cells (UCs) shows uroepithelial progenitor, mesenchymal and smooth muscle lineages. (A) Flow cytometric analysis of UCs probed with conjugated antibodies against uroepithelial and pericyte markers CD44, CD73 and CD146. (B) Immunofluorescent staining of UCs with CD44, &#945;SMA and Vimentin. (C) Gene expression profile of UCs show weak expression of CK-7 and UP-Ia and UP-IIIa as compared to positive control samples while gene expression of alpha-smooth muscle actin (&#945;SMA) is comparable to positive control. <a href="https://www-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/52032/52032fig1highres.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" src="/files/ftp_upload/52032/52032fig2.jpg" /> 
Figure 2. Reprogramming of UC to generate iPSCs. (A) Schematic overview of the reprogramming timeline. (B) Images representing different morphologies of UCs during the SeV transduction, at Day 0 (SeV transduction), Day 4 (morphological transition), Day 12 (pluripotent clones emerging on MEFs) and the characteristic iPSC clone under feeder-free conditions (iPSC-P2 on Matrigel). (C) Live cell imaging for TRA-1-81 to identify pluripotent colonies at Day 17. <a href="https://www-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/52032/52032fig2highres.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" src="/files/ftp_upload/52032/52032fig3.jpg" /> 
Figure 3. Generation of Viral Genome and Transgene Free iPSCs. (A) Gene expression analysis shows the presence of the SeV genome and OSKM transgenes at passage 2 (iPSC-P2) and their disappearance by passage 13 (iPSC-P13) while endogenous gene expression persists throughout. (B) Phase contrast images and immunofluorescence comparing Oct3/4 and TRA-1-81 staining in UCs and resultant iPSCs. (C) Dystrophin is detected by immunofluorescence in wild-type iPSCs compared to wild-type UCs, and (D) the specific dystrophin isoform (Dp71) can be confirmed by WB. (E) RT-PCR analysis is used to confirm the specific dystrophin exon deletion in the dystrophic iPSCs compared to wild-type UCs and iPSCs. <a href="https://www-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/52032/52032fig3highres.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<table border="0" cellpadding="0" cellspacing="0">
	<tbody>
		<tr>
			<td>Name of Reagent/Material/Equipment</td>
			<td>Company</td>
			<td>Catalog Number</td>
			<td>Comments</td>
		</tr>
		<tr>
			<td>GAPDH-Forward Primer</td>
			<td>IDT Inc.</td>
			<td>Seq given in comments</td>
			<td>GTGGACCTGACCTGCCGTCT</td>
		</tr>
		<tr>
			<td>GAPDH-Reverse Primer</td>
			<td>IDT Inc.</td>
			<td>Seq given in comments</td>
			<td>GGAGGAGTGGGTGTCGCTGT</td>
		</tr>
		<tr>
			<td>CK7-Forward Primer</td>
			<td>IDT Inc.</td>
			<td>Seq given in comments</td>
			<td>TGGTGCTGAAGAAGGATGTG</td>
		</tr>
		<tr>
			<td>CK7-Reverse Primer</td>
			<td>IDT Inc.</td>
			<td>Seq given in comments</td>
			<td>CACGCTGGTTCTTGATGTTG</td>
		</tr>
		<tr>
			<td>Up-Ia-Forward Primer</td>
			<td>IDT Inc.</td>
			<td>Seq given in comments</td>
			<td>ACGTCCTACACCCACCGTGA</td>
		</tr>
		<tr>
			<td>Up-Ia-Reverse Primer</td>
			<td>IDT Inc.</td>
			<td>Seq given in comments</td>
			<td>ACCCCACGTGTAGCTGTCGAT</td>
		</tr>
		<tr>
			<td>Up-IIIa-Forward Primer</td>
			<td>IDT Inc.</td>
			<td>Seq given in comments</td>
			<td>ACAAACAGAGGGTGGGAGGA 
			CAG</td>
		</tr>
		<tr>
			<td>Up-IIIa-Reverse Primer</td>
			<td>IDT Inc.</td>
			<td>Seq given in comments</td>
			<td>AGAAGGGCAGGGAGCCCAGG</td>
		</tr>
		<tr>
			<td>&#945;SMA-Forward Primer</td>
			<td>IDT Inc.</td>
			<td>Seq given in comments</td>
			<td>ACCCACAATGTCCCCATCTA</td>
		</tr>
		<tr>
			<td>&#945;SMA-Reverse Primer</td>
			<td>IDT Inc.</td>
			<td>Seq given in comments</td>
			<td>TGATCCACATCTGCTGGAAG</td>
		</tr>
		<tr>
			<td>Oct3/4 (Exogenous)-Forward Primer*</td>
			<td>IDT Inc.</td>
			<td>*Life Tech-Cytotune kit</td>
			<td>CCCGAAAGAGAAAGCGAACCAG</td>
		</tr>
		<tr>
			<td>Oct3/4 (Exogenous)-Reverse Primer*</td>
			<td>IDT Inc.</td>
			<td>*Life Tech-Cytotune kit</td>
			<td>AATGTATCGAAGGTGCTCAA</td>
		</tr>
		<tr>
			<td>Sox2 (Exogenous)-Forward Primer*</td>
			<td>IDT Inc.</td>
			<td>*Life Tech-Cytotune kit</td>
			<td>ATGCACCGCTACGACGTGAG 
			CGC</td>
		</tr>
		<tr>
			<td>Sox2 (Exogenous)-Reverse Primer*</td>
			<td>IDT Inc.</td>
			<td>*Life Tech-Cytotune kit</td>
			<td>AATGTATCGAAGGTGCTCAA</td>
		</tr>
		<tr>
			<td>Klf4 (Exogenous)-Forward Primer*</td>
			<td>IDT Inc.</td>
			<td>*Life Tech-Cytotune kit</td>
			<td>TTCCTGCATGCCAGAGGAGCCC</td>
		</tr>
		<tr>
			<td>Klf4 (Exogenous)-Reverse Primer*</td>
			<td>IDT Inc.</td>
			<td>*Life Tech-Cytotune kit</td>
			<td>AATGTATCGAAGGTGCTCAA</td>
		</tr>
		<tr>
			<td>cMyc (Exogenous)-Forward Primer*</td>
			<td>IDT Inc.</td>
			<td>*Life Tech-Cytotune kit</td>
			<td>TAACTGACTAGCAGGCTTGTCG</td>
		</tr>
		<tr>
			<td>cMyc (Exogenous)-Reverse Primer*</td>
			<td>IDT Inc.</td>
			<td>*Life Tech-Cytotune kit</td>
			<td>TCCACATACAGTCCTGGATGAT 
			GATG</td>
		</tr>
		<tr>
			<td>SeV (Exogenous)-Forward Primer*</td>
			<td>IDT Inc.</td>
			<td>*Life Tech-Cytotune kit</td>
			<td>GGATCACTAGGTGATATCGAGC</td>
		</tr>
		<tr>
			<td>SeV (Exogenous)-Reverse Primer*</td>
			<td>IDT Inc.</td>
			<td>*Life Tech-Cytotune kit</td>
			<td>ACCAGACAAGAGTTTAAGAGA 
			TATGTATC</td>
		</tr>
		<tr>
			<td>Oct3/4 (Endogenous)-Forward Primer</td>
			<td>IDT Inc.</td>
			<td>Seq given in comments</td>
			<td>CAGTGCCCGAAACCCACAC</td>
		</tr>
		<tr>
			<td>Oct3/4 (Endogenous)-Reverse Primer</td>
			<td>IDT Inc.</td>
			<td>Seq given in comments</td>
			<td>GGAGACCCAGCAGCCTCAAA</td>
		</tr>
		<tr>
			<td>Sox2 (Endogenous)-Forward Primer</td>
			<td>IDT Inc.</td>
			<td>Seq given in comments</td>
			<td>CAAGATGCACAACTCGGAGA</td>
		</tr>
		<tr>
			<td>Sox2 (Endogenous)-Reverse Primer</td>
			<td>IDT Inc.</td>
			<td>Seq given in comments</td>
			<td>GTTCATGTGCGCGTAACTGT</td>
		</tr>
		<tr>
			<td>Dystrophin-Forward Primer</td>
			<td>IDT Inc.</td>
			<td>Seq given in comments</td>
			<td>GGCAAAAACTGCCAAAAGAA</td>
		</tr>
		<tr>
			<td>Dystrophin-Reverse Primer</td>
			<td>IDT Inc.</td>
			<td>Seq given in comments</td>
			<td>GACCTGCCAGTGGAGGATTA</td>
		</tr>
	</tbody>
</table>
Table 1. List of Primer Sequences.

Watch this Scientific Journal Video about Generation of Induced Pluripotent Stem Cells from Muscular Dystrophy Patients: Efficient Integration-free Reprogramming of Urine Derived Cells at JoVE.com

Generation of Induced Pluripotent Stem Cells from Muscular Dystrophy Patients: Efficient Integration-free Reprogramming of Urine Derived Cells

This protocol entails detailed procedures for isolation of urine derived cells from muscular dystrophy patients; their efficient and rapid reprogramming through Sendai virus transduction.

Dystrophic cardiomyopathy is a poorly understood consequence of muscular dystrophy. Generating induced Pluripotent Stem Cells (iPSCs) from patients with ...

generation-induced-pluripotent-stem-cells-from-muscular-dystrophy

Nanyang Technological University

Research

JoVE Journal

Medicine

11.2K Views.  Medical College of Wisconsin. This protocol entails detailed procedures for isolation of urine derived cells from muscular dystrophy patients; their efficient and rapid reprogramming through Sendai virus transduction. 

Video: Generation of Induced Pluripotent Stem Cells from Muscular Dystrophy Patients: Efficient Integration-free Reprogramming of Urine Derived Cells

Generation of Induced Pluripotent Stem Cells from Frozen Buffy Coats using Non-integrating Episomal Plasmids

Somatic cells can be reprogrammed into induced pluripotent stem cells (iPSCs) by forcing the expression of four transcription factors (Oct-4, Sox-2, Klf-4, and c-Myc), typically expressed by human embryonic stem cells (hESCs). Due to their similarity with hESCs, iPSCs have become an important tool for potential patient-specific regenerative medicine, avoiding ethical issues associated with hESCs. In order to obtain cells suitable for clinical application, transgene-free iPSCs need to be generated to avoid transgene reactivation, altered gene expression and misguided differentiation. Moreover, a highly efficient and inexpensive reprogramming method is necessary to derive sufficient iPSCs for therapeutic purposes. Given this need, an efficient non-integrating episomal plasmid approach is the preferable choice for iPSC derivation. Currently the most common cell type used for reprogramming purposes are fibroblasts, the isolation of which requires tissue biopsy, an invasive surgical procedure for the patient. Therefore, human peripheral blood represents the most accessible and least invasive tissue for iPSC generation.
In this study, a cost-effective and viral-free protocol using non-integrating episomal plasmids is reported for the generation of iPSCs from human peripheral blood mononuclear cells (PBMNCs) obtained from frozen buffy coats after whole blood centrifugation and without density gradient separation.

Induced pluripotent stem cells (iPSCs) represent a source of patient-specific tissues for clinical applications and basic research. Here, we present a detailed protocol to reprogram human peripheral blood mononuclear cells (PBMNCs) obtained from frozen buffy coats into viral-free iPSCs using non-integrating episomal plasmids.

Somatic cells can be reprogrammed into induced pluripotent stem cells (iPSCs) by forcing the expression of four transcription factors (Oct-4, Sox-2, ...

Developmental Biology

Transplantation of Induced Pluripotent Stem Cell-derived Mesoangioblast-like Myogenic Progenitors in Mouse Models of Muscle Regeneration

Patient-derived iPSCs could be an invaluable source of cells for future autologous cell therapy protocols. iPSC-derived myogenic stem/progenitor cells similar to pericyte-derived mesoangioblasts (iPSC-derived mesoangioblast-like stem/progenitor cells: IDEMs) can be established from iPSCs generated from patients affected by different forms of muscular dystrophy. Patient-specific IDEMs can be genetically corrected with different strategies (e.g. lentiviral vectors, human artificial chromosomes) and enhanced in their myogenic differentiation potential upon overexpression of the myogenesis regulator MyoD. This myogenic potential is then assessed in vitro with specific differentiation assays and analyzed by immunofluorescence. The regenerative potential of IDEMs is further evaluated in vivo, upon intramuscular and intra-arterial transplantation in two representative mouse models displaying acute and chronic muscle regeneration. The contribution of IDEMs to the host skeletal muscle is then confirmed by different functional tests in transplanted mice. In particular, the amelioration of the motor capacity of the animals is studied with treadmill tests. Cell engraftment and differentiation are then assessed by a number of histological and immunofluorescence assays on transplanted muscles. Overall, this paper describes the assays and tools currently utilized to evaluate the differentiation capacity of IDEMs, focusing on the transplantation methods and subsequent outcome measures to analyze the efficacy of cell transplantation.

Induced pluripotent stem cell (iPSC)-derived myogenic progenitors are promising candidates for cell therapy strategies to treat muscular dystrophies. This protocol describes transplantation and functional measurements required to evaluate the engraftment and differentiation of iPSC-derived mesoangioblasts (a type of muscle progenitors) in mouse models of acute and chronic muscle regeneration.

Patient-derived iPSCs could be an invaluable source of cells for future autologous cell therapy protocols. iPSC-derived myogenic stem/progenitor cells ...

Bioengineering

Exon Skipping in Directly Reprogrammed Myotubes Obtained from Human Urine-Derived Cells

Duchenne muscular dystrophy (DMD), a progressive and fatal muscle disease, is caused by mutations in the DMD gene that result in the absence of dystrophin protein. To date, we have completed an investigator-initiated first-in-human study at the National Center of Neurology and Psychiatry based on the systemic injection of the morpholino oligonucleotides which are prone to exon-53 skipping. For the effective treatment of DMD, in vitro testing with myoblasts derived from DMD patients to screen drugs and assess patient eligibility before undertaking clinical trials is thought to be essential. Very recently, we reported a new MYOD1-converted urine-derived cell (UDC) treated with the histone methyltransferase inhibitor (3-deazaneplanocin A hydrochloride), as a cellular model of DMD. The new autologous UDC might show phenocopy of the disease-specific phenotypes of DMD, leading to the application of precision medicine in a variety of muscle-related diseases. In this article, we describe a detailed protocol for efficient modelling of DMD muscle cells using MYOD1-converted UDCs along with reverse transcriptase polymerase chain reaction (RT-PCR), Western blotting, and immunocytochemistry to evaluate the restoration of dystrophin mRNA and protein levels after exon skipping.

In this article, we describe a detailed protocol for efficient modelling of Duchenne muscular dystrophy muscle using MYOD1-converted urine-derived cells to evaluate the restoration of dystrophin mRNA and protein levels after exon skipping.

Duchenne muscular dystrophy (DMD), a progressive and fatal muscle disease, is caused by mutations in the DMD gene that result in the absence of dystrophin ...

Genetics

Direct Reprogramming of Human Fibroblasts into Myoblasts to Investigate Therapies for Neuromuscular Disorders

Investigations into both the pathophysiology and therapeutic targets in muscular dystrophies have been hampered by the limited proliferative capacity of human myoblasts. Several mouse models have been created but they either do not truly represent the human physiopathology of the disease or are not representative of the broad spectrum of mutations found in humans. The immortalization of human primary myoblasts is an alternative to this limitation; however, it is still dependent on muscle biopsies, which are invasive and not easily available. In contrast, skin biopsies are easier to obtain and less invasive to patients. Fibroblasts derived from skin biopsies can be immortalized and transdifferentiated into myoblasts, providing a source of cells with excellent myogenic potential. Here, we describe a fast and direct reprogramming method of fibroblast into a myogenic lineage. Fibroblasts are transduced with two lentiviruses: hTERT to immortalize the primary culture and a tet-inducible MYOD, which upon the addition of doxycycline, induces the conversion of fibroblasts into myoblasts and then mature myotubes, which express late differentiation markers. This quick transdifferentiation protocol represents a powerful tool to investigate pathological mechanisms and to investigate innovative gene-based or pharmacological biotherapies for neuromuscular disorders.

This protocol describes the conversion of skin fibroblasts into myoblasts and their differentiation into myotubes. The cell lines are derived from patients with neuromuscular disorders and can be used to investigate pathological mechanisms and to test therapeutic strategies.

Investigations into both the pathophysiology and therapeutic targets in muscular dystrophies have been hampered by the limited proliferative capacity of ...

RNA-based Reprogramming of Human Primary Fibroblasts into Induced Pluripotent Stem Cells

Induced pluripotent stem cells (iPSCs) have proven to be a valuable tool to study human development and disease. Further advancing iPSCs as a regenerative therapeutic requires a safe, robust, and expedient reprogramming protocol. Here, we present a clinically relevant, step-by-step protocol for the extremely high-efficiency reprogramming of human dermal fibroblasts into iPSCs using a non-integrating approach. The core of the protocol consists of expressing pluripotency factors (SOX2, KLF4, cMYC, LIN28A, NANOG, OCT4-MyoD fusion) from in vitro transcribed messenger RNAs synthesized with modified nucleotides (modified mRNAs). The reprogramming modified mRNAs are transfected into primary fibroblasts every 48 h together with mature embryonic stem cell-specific microRNA-367/302 mimics for two weeks. The resulting iPSC colonies can then be isolated and directly expanded in feeder-free conditions. To maximize efficiency and consistency of our reprogramming protocol across fibroblast samples, we have optimized various parameters including the RNA transfection regimen, timing of transfections, culture conditions, and seeding densities. Importantly, our method generates high-quality iPSCs from most fibroblast sources, including difficult-to-reprogram diseased, aged, and/or senescent samples.

Here we describe a clinically relevant, high-efficiency, feeder-free method to reprogram human primary fibroblasts into induced pluripotent stem cells using modified mRNAs encoding reprogramming factors and mature microRNA-367/302 mimics. Also included are methods to assess reprogramming efficiency, expand clonal iPSC colonies, and confirm expression of the pluripotency marker TRA-1-60.

Induced pluripotent stem cells (iPSCs) have proven to be a valuable tool to study human development and disease. Further advancing iPSCs as a regenerative ...

CRISPR/Cas9 Technology in Restoring Dystrophin Expression in iPSC-Derived Muscle Progenitors

Duchenne muscular dystrophy (DMD) is a severe progressive muscle disease caused by mutations in the dystrophin gene, which ultimately leads to the exhaustion of muscle progenitor cells. Clustered regularly interspaced short palindromic repeats/CRISPR-associated 9 (CRISPR/Cas9) gene editing has the potential to restore the expression of the dystrophin gene. Autologous induced pluripotent stem cells (iPSCs)-derived muscle progenitor cells (MPC) can replenish the stem/progenitor cell pool, repair damage, and prevent further complications in DMD without causing an immune response. In this study, we introduce a combination of CRISPR/Cas9 and non-integrated iPSC technologies to obtain muscle progenitors with recovered dystrophin protein expression. Briefly, we use a non-integrating Sendai vector to establish an iPSC line from dermal fibroblasts of Dmdmdx mice. We then use the CRISPR/Cas9 deletion strategy to restore dystrophin expression through a non-homologous end joining of the reframed dystrophin gene. After PCR validation of exon23 depletion in three colonies from 94 picked iPSC colonies, we differentiate iPSC into MPC by doxycycline (Dox)-induced expression of MyoD, a key transcription factor playing a significant role in regulating muscle differentiation. Our results show the feasibility of using CRISPR/Cas9 deletion strategy to restore dystrophin expression in iPSC-derived MPC, which has significant potential for developing future therapies for the treatment of DMD.

Here, we present a Cas9-based exon23 deletion protocol to restore dystrophin expression in iPSC from Dmdmdx mouse-derived skin fibroblasts and directly differentiate iPSCs into myogenic progenitor cells (MPC) using the Tet-on MyoD activation system.

Duchenne muscular dystrophy (DMD) is a severe progressive muscle disease caused by mutations in the dystrophin gene, which ultimately leads to the ...

Derivation of Adult Human Fibroblasts and their Direct Conversion into Expandable Neural Progenitor Cells

Generation of&#160;induced pluripotent stem cell (iPSCs) from adult skin fibroblasts and subsequent differentiation into somatic cells provides fascinating prospects for the derivation of autologous transplants that circumvent histocompatibility barriers. However, progression through a pluripotent state and subsequent complete differentiation into desired lineages remains a roadblock for the clinical translation of iPSC technology because of the associated neoplastic potential and genomic instability. Recently, we and others showed that somatic cells cannot only be converted into iPSCs but also into different types of multipotent somatic stem cells by using defined factors, thereby circumventing progression through the pluripotent state. In particular, the direct conversion of human fibroblasts into induced neural progenitor cells (iNPCs) heralds the possibility of a novel autologous cell source for various applications such as cell replacement, disease modeling and drug screening. Here, we describe the isolation of adult human primary fibroblasts by skin biopsy and their efficient direct conversion into iNPCs by timely restricted expression of Oct4, Sox2, Klf4, as well as c-Myc. Sox2-positive neuroepithelial colonies appear after 17 days of induction and iNPC lines can be established efficiently by monoclonal isolation and expansion. Precise adjustment of viral multiplicity of infection and supplementation of leukemia inhibitory factor during the induction phase represent critical factors to achieve conversion efficiencies of up to 0.2%. Thus far, patient-specific iNPC lines could be expanded for more than 12 passages and uniformly display morphological and molecular features of neural stem/progenitor cells, such as the expression of Nestin and Sox2. The iNPC lines can be differentiated into neurons and astrocytes as judged by staining against TUJ1 and GFAP, respectively. In conclusion, we report a robust protocol for the derivation and direct conversion of human fibroblasts into stably expandable neural progenitor cells that might provide a cellular source for biomedical applications such as autologous neural cell replacement and disease modeling.

Generation of induced pluripotent stem cells provides fascinating prospects for the derivation of autologous transplants. However, progression through a pluripotent state and laborious re-differentiation still hinders clinical translation. Here we describe the derivation of adult human fibroblasts and their direct conversion into induced neural progenitor cells and the subsequent differentiation into neural lineages.

Generation of&#160;induced pluripotent stem cell (iPSCs) from adult skin fibroblasts and subsequent differentiation into somatic cells provides ...

Neuroscience

Selecting and Isolating Colonies of Human Induced Pluripotent Stem Cells Reprogrammed from Adult Fibroblasts

Herein we present a protocol of reprogramming human adult fibroblasts into human induced pluripotent stem cells (hiPSC) using retroviral vectors encoding Oct3/4, Sox2, Klf4 and c-myc (OSKM) in the presence of sodium butyrate 1-3. We used this method to reprogram late passage (&gt;p10) human adult fibroblasts derived from Friedreich's ataxia patient (GM03665, Coriell Repository). The reprogramming approach includes highly efficient transduction protocol using repetitive centrifugation of fibroblasts in the presence of virus-containing media. The reprogrammed hiPSC colonies were identified using live immunostaining for Tra-1-81, a surface marker of pluripotent cells, separated from non-reprogrammed fibroblasts and manually passaged 4,5. These hiPSC were then transferred to Matrigel plates and grown in feeder-free conditions, directly from the reprogramming plate. Starting from the first passage, hiPSC colonies demonstrate characteristic hES-like morphology. Using this protocol more than 70% of selected colonies can be successfully expanded and established into cell lines. The established hiPSC lines displayed characteristic pluripotency markers including surface markers TRA-1-60 and SSEA-4, as well as nuclear markers Oct3/4, Sox2 and Nanog. 
The protocol presented here has been established and tested using adult fibroblasts obtained from Friedreich's ataxia patients and control individuals 6, human newborn fibroblasts, as well as human keratinocytes.

We present a protocol for efficient reprogramming of human somatic cells into human induced pluripotent stem cells (hiPSC) using retroviral vectors encoding Oct3/4, Sox2, Klf4 and c-myc (OSKM) and identification of correctly reprogrammed hiPSC by live staining with Tra-1-81 antibody.

Herein we present a protocol of reprogramming human adult fibroblasts into human induced pluripotent stem cells (hiPSC) using retroviral vectors encoding ...

Biology

Generation of Myospheres From hESCs by Epigenetic Reprogramming

Generation of a homogeneous and abundant population of skeletal muscle cells from human embryonic stem cells (hESCs) is a requirement for cell-based therapies and for a "disease in a dish" model of human neuromuscular diseases. Major hurdles, such as low abundance and heterogeneity of the population of interest, as well as a lack of protocols for the formation of three-dimensional contractile structures, have limited the applications of stem cells for neuromuscular disorders. We have designed a protocol that overcomes these limits by ectopic introduction of defined factors in hESCs - the muscle determination factor MyoD and SWI/SNF chromatin remodeling complex component BAF60C - that are able to reprogram hESCs into skeletal muscle cells. Here we describe the protocol established to generate hESC-derived myoblasts and promote their clustering into tridimensional miniaturized structures (myospheres) that functionally mimic miniaturized skeletal muscles7.

Here, we describe a protocol based on epigenetic reprogramming of human embryonic stem cells (hESCs) toward generating a homogeneous population of skeletal muscle progenitors that under permissive culture conditions form three-dimensional clusters of contractile myofibers (myospheres), which recapitulate biological features of human skeletal muscles.

Generation of a homogeneous and abundant population of skeletal muscle cells from human embryonic stem cells (hESCs) is a requirement for cell-based ...

Generation and Maintenance of Primate Induced Pluripotent Stem Cells Derived from Urine

Cross-species approaches studying primate pluripotent stem cells and their derivatives are crucial to better understand the molecular and cellular mechanisms of disease, development, and evolution. To make primate induced pluripotent stem cells (iPSCs) more accessible, this paper presents a non-invasive method to generate human and non-human primate iPSCs from urine-derived cells, and their maintenance using a feeder-free culturing method.
The urine can be sampled from a non-sterile environment (e.g., the cage of the animal) and treated with a broad-spectrum antibiotic cocktail during primary cell culture to reduce contamination efficiently. After propagation of the urine-derived cells, iPSCs are generated by a modified transduction method of a commercially available Sendai virus vector system. First&#160;iPSC colonies may already be visible after 5 days, and can be picked after 10 days at the earliest. Routine clump passaging with enzyme-free dissociation buffer supports pluripotency of the generated iPSCs for more than 50 passages.

The present protocol describes a method to isolate, expand, and reprogram human and non-human primate urine-derived cells to induced pluripotent stem cells (iPSCs), as well as instructions for feeder-free maintenance of the newly generated iPSCs.