Name: visualization of cellular electrical activity in zebrafish early embryos and tumors
Uploaded: 2018-04-25T14:00:00.000+00:00
Duration: 8 min 55 s
Description: Watch this Scientific Journal Video about Visualization of Cellular Electrical Activity in Zebrafish Early Embryos and Tumors at JoVE.com

O trabalho de pesquisa reportado nesta publicação foi apoiado pelo Instituto Nacional de General Medical Ciências, do institutos nacionais da saúde sob o prêmio número R35GM124913, programa de incentivo de PI4D Universidade de Purdue e PVM interno competitivo Programa de fundos de pesquisa básica. O conteúdo é exclusivamente da responsabilidade dos autores e não representa necessariamente a opinião oficial dos agentes de financiamento. Agradecemos a construção Tol2, Michael Lin para a construção de ASAP1, Koichi Kawakami e Leonard Zon para a promotora ubi construir através de Addgene.

O zebrafish estão alojados em instalações animais AAALAC-aprovado, e todos os experimentos foram realizados de acordo com os protocolos aprovados pelo cuidado do Animal de Purdue e Comissão de utilização (PACUC).
1. Tol2 Transposon plasmídeo construção preparação
Nota: Tol2, um transposon que foi descoberto no peixe medaka, tem sido amplamente utilizado na Comunidade de investigação o zebrafish8,9. Foi com sucesso adoptado para o Gateway site-specific recombinação sistema baseado em clonagem e conhecido como o Tol2 do kit10. O kit Tol2 permite uma maneira mais conveniente de criar construções personalizadas de expressão, enquanto também aumenta a eficiência da transgênese. Assim, foi uma decisão fácil para tirar vantagem deste sistema e criar uma linha onipresente de zebrafish expressão ASAP1 usando um promotor validado ubiquitin para conduzir ASAP111.
<ol><li>Criando uma construção de entrada meio ASAP1: pDONR221-ASAP1<ol>
<li>Adquira a construção de sensor ASAP1 tensão geneticamente codificado, pcDNA3.1/Puro-CAG-ASAP1 (plasmídeo #52519), de Addgene. Para amplificar a região codificante ASAP1, configure uma PCR utilizando primers personalizados (attB1-ASAP1F e attB2-ASAP1R) ladeados com sequências attB na extremidade 5' dos primers (Figura 1). Phusion DNA polimerase foi escolhido por sua alta eficiência, e condições PCR foram otimizadas com base no protocolo previamente publicado12.</li>
		<li>Carregar os produtos PCR 50 µ l em um 1% TAE gel usando uma pipeta regular com dicas de 200 µ l e executar eletroforese em 160 V em um tanque de gel de horizontal por cerca de 30 min.</li>
		<li>Verifique o gel sob um transiluminador UV (353 nm), excisar a banda desejada usando um lâmina/bisturi sob um transiluminador UV como anteriormente publicado13,14e coloque a amostra do DNA contendo gel em microcentrifuga limpa 1,5 mL tubo.</li>
		<li>Execute o gel de purificação para os produtos de PCR ASAP1. Recuperar o DNA no gel extirpado usando um kit comercial de purificação gel ADN seguindo as instruções do fabricante e eluir o DNA em 20 µ l de água. Tomar 1 µ l de como uma amostra e medir a concentração de DNA utilizando um espectrofotômetro. Fluxo as instruções de software utilizando a água como um controle em branco15.</li>
		<li>Pegue 100 ng de purificado o produto do PCR e misturá-lo com 150 ng do plasmídeo pDONR221 em 10 µ l de TE buffer (10 mM Tris, pH de 1 mM EDTA 8.0)16. Adicionar 2 µ l de BP Clonase II para a reação e incubar a reação à temperatura ambiente durante a noite.</li>
		<li>No segundo dia, adicionar 1 µ l de proteinase K para a reação e incubar a reação a 37 ° C por 30 min.</li>
		<li>Execute a transformação. A reação de transferência e misturá-lo com 50 µ l de Top10 competentes de Escherichia coli células e incubar as células no gelo por 30 min. Em seguida, transferência imediatamente, o tubo de reação em um banho de água de 42 ° C por 1 min. Retire o tubo e incubar no gelo por 2 min. Em seguida, colocar o tubo em um shaker de 37 ° C e incube por 1h.</li>
		<li>Retire o tubo e as células em um prato de canamicina LB da placa. Em seguida, incubar a placa durante a noite (16-18 h) a 37 ° C.</li>
		<li>Escolha única e bem separadas colônias e inoculá-los em tubos de cultura de células de 14 mL com 3 mL de meio LB. Cultura-los durante a noite a 37 ° C em uma coqueteleira com uma velocidade de rotação de 250 rpm (rotação por minuto).</li>
		<li>Execute miniprep usando um kit miniprep comercial seguindo seu manual de instrução17.</li>
		<li>Sequência 3-4 plasmídeos com Sanger sequenciamento identificar positivo pDONR221-ASAP1 clones usando M13F e M13R iniciadores de sequenciamento.</li>
	</ol>
</li>
	<li>Criando a construção Tol2 para microinjection: pDestTol2 -ubi-ASAP1<ol>
<li>Escolha que o sequenciamento e verificados pela medida pDONR221-ASAP1 clone sua concentração de DNA usando uma sequência de espectrofotômetro a instruções de software utilizando a água como um espaço em branco controlar15.</li>
		<li>Pegue 100 µ g de pDONR221-ASAP1 e misture com 100 µ g de plasmídeo de 5-final do Tol2 kit (pENTR5'_ubi, Addgene #27320), 100 µ g de p3E-polyA (kit de Tol2 #302) e 150 µ g de pDestTol2pA2 (kit de Tol2 #394). Ajustar o volume total de 8 µ l usando TE buffer (10 mM Tris, 1 mM EDTA, pH 8.0) numa microcentrifuga 1,5 mL do tubo e misture bem por um vórtice de breve s 2-5. Em seguida, adicionar 2 µ l de LR Clonase II plus e incubar a reação à temperatura ambiente durante a noite.</li>
		<li>No segundo dia, adicionar 1 µ l de proteinase K para a reação usando uma pipeta de 10 µ l e incubar a reação a 37 ° C por 30 min.</li>
		<li>Realizar a transformação e identificar clones positivos, como descrito acima (passos 1.1.7-11).</li>
		<li>Medida a concentração de DNA de sequenciamento verificado clone pDestTol2-ubi-ASAP1 (figura 1B) usando um espectrofotômetro15. Normalmente, a concentração é em torno de 200ng / µ l.</li>
	</ol>
</li>
</ol>2. prepare Tol2 Transposase mRNA e injeção de solução
<ol><li>Raia Escherichia coli glicerol estoque de pCS2FA-transposase plasmídeo (kit de Tol2 #396) em uma placa LB (com 100 ampicilina µ g/mL) com uma ansa de inoculação esterilizado. Incube a placa a 37 ° C numa incubadora durante a noite. No dia seguinte, escolher uma única colônia e inoculá-lo em 3 mL de LB (Ampicilina 100 µ g/mL) com uma ponta de pipeta de 10 µ l esterilizado. Cultura-lo durante a noite a 37 ° C em uma coqueteleira com uma velocidade de rotação de 250 rpm.</li>
	<li>Execute miniprep na cultura de Escherichia coli usando um kit miniprep comercial seguindo seu manual de instruções. Eluir Plasmídeo em 30-50 µ l de tampão TE por 1 minuto centrifugação a 14.000 rpm e medir sua concentração de DNA com um espectrofotômetro.</li>
	<li>Linearizar 1-2 µ g do plasmídeo com eu não endonuclease e purificar o DNA com um DNA kit eu não seguindo o seu manual de instruções de limpeza digestão. Eluir o DNA em 5 µ l de água por centrifugação a 14.000 rpm por 1 minuto. A concentração esperada é de 200-300 ng / µ l.</li>
	<li>Executar em vitro transcrição com não eu linearizada transposase-pCS2FA como um modelo de DNA usando um kit de transcrição comercial SP6.</li>
	<li>Quando a reação estiver terminada, purifica Tol2 transposase mRNA usando um RNA de limpeza comercial kit seguindo as instruções do fabricante. Finalmente, eluir mRNA na água de RNAase livre 20 µ l e medir a concentração de RNA em um espectrofotômetro. A concentração esperada é sobre 1-3 µ g / µ l. as amostras podem ser armazenadas em um freezer-80 ° C, se necessário.</li>
	<li>Preparar a solução de microinjeção misturando 20 ng / µ l pDestTol2 -ubi-ASAP1 e Tol2 transposase mRNA (100 ng / µ l) em um tubo de microcentrifugadora por pipetagem. Para prevenir a degradação do ácido nucleico causada por repetidos descongelar e recongelar, alíquota 6 µ l pelo tubo e armazená-lo em um freezer-80 ° C para uso futuro.</li>
</ol>3. microinjection
<ol><li>Conjunto 4-6 tanques de criação pelo menos 2 machos e 2 fêmeas a tarde antes da injeção. Estes peixes não devem ser alimentados à tarde. Esta etapa irá reduzir a quantidade de resíduos de peixe e economizar tempo para limpá-los na manhã seguinte, enquanto também ajuda a induzir uma resposta de reprodução.</li>
	<li>Na manhã seguinte, retire a solução preparada de injeção (pDestTol2 -ubi-ASAP1 construção e Tol2 mRNA) do congelador a-80 ° C e coloque-o no gelo.</li>
	<li>Puxe os divisores nas tanques de piscicultura e permitir que os peixes acasalar. Em geral, peixes depositam ovos dentro de 20-30 minutos depois de puxar para fora o divisor. Se não, espere 1-2 horas a mais. Alguns peixes não podem colocar ovos em tudo. Neste caso, repita este experimento para colheita de embriões de peixe.</li>
	<li>Enquanto espera, certifique-se que existem agulhas preparadas com a ponta quebrada em um ângulo, criando uma borda chanfrada com fórceps, ou quebrando em um limpador de tarefa delicada.<ol>
<li>Puxe as agulhas de vidro capilar um puxador de micropipeta usando os seguintes parâmetros: aqueça 545; Puxe a 60; velocidade 80; tempo 250; pressão de 500. Quebre a agulha com pinça debaixo de um escopo de dissecação (com a parte do olho régua para estimativa de diâmetro), mantendo-se a pinça a um ângulo de aproximadamente 45 °. Diâmetros de agulha desejada podem ser variável dependendo das configurações de microinjector, mas menor diâmetro é preferível para diminuir a mortalidade do embrião.</li>
	</ol>
</li>
	<li>Uma vez que os peixes têm ovos, recolhê-los em um diâmetro de 10 cm de Petri e trazê-los para o escopo de dissecação. Remover todos os embriões anormais e resíduos de peixe.</li>
	<li>Pipetar os embriões fertilizados para a injeção de agarose preparado a 3% do molde. Remova o excesso de água para ajudar a manter os embriões no lugar.</li>
	<li>Uma vez que todas as linhas estão cheios de embriões viáveis, organizá-los para que as células únicas todas enfrentam o mesmo sentido em direção a agulha, que é aproximadamente um ângulo de 45° na horizontal. Isto facilitará injeção muito mais tarde.</li>
	<li>Usando luvas, usar uma pipeta de carregamento de 20 µ l ponta e retire o tubo no gelo 5 µ l de construção de preparado.</li>
	<li>Introduza cuidadosamente a ponta na extremidade traseira do tubo capilar quebrado até onde começa a seringueiro, para obter o reagente mais perto da ponta. Se ainda existem bolhas de ar, agite a seringa, certificando-se de não quebrar a ponta.</li>
	<li>Introduza a agulha direto para o suporte da agulha de microinjeção e aperte cuidadosamente até que a agulha permanece no lugar. Ajuste o ângulo de aproximadamente 45°.</li>
	<li>Uma vez que a agulha é preparada e ligada, ligue o microscópio e gás tanque de pressão. Comercial CO2 tanques são geralmente bons para essa finalidade. O volume de injeção é ajustado pela pressão de exploração e ejeção: aproximado de 0,5 psi para exploração e 30 psi para ejeção. Certifique-se de verificar que a solução vem quando pressionando o pedal.</li>
	<li>Usando um micrômetro de palco com uma gota de óleo mineral, ajustar o volume e o fluxo da solução a ~ 150 µm de diâmetro (cerca de 2 nL). Certifique-se de que a pressão de retorno vai deixar uma pequena quantidade a escorrer para fora da agulha. Se não houver pressão suficiente, ação capilar causará líquido inserir a agulha e destruir o mRNA.</li>
	<li>Uma vez que a agulha é calibrada, começam a injetar a construção para a única célula dos embriões fertilizados. Nota: Isto leva a uma grande quantidade de prática, paciência e sutileza, devido à membrana celular, sendo difícil de furar. É importante injectar a solução dentro da célula, não a gema, para a geração de zebrafish transgênico. Isso é diferente de Morpholinos injeção. Não importa de que lado a agulha entra na célula, enquanto a construção vai na célula. A transgênese terá uma taxa muito baixa de sucesso se injetado a gema ao invés da célula. Injeção de célula única fase também é importante, ou peixe Quimera somática será criado. Isso reduzirá a possibilidade do transgene entrando para as células germinativas.</li>
	<li>Use a borda do gel de entalhe para fornecer um revestimento protetor que mantém o embrião no lugar e permite que a agulha aplicar pressão sem mover o embrião. Uma vez que a ponta da agulha na única célula, pressione o pedal para liberar a quantidade desejada de solução. Repita este processo para todos os embriões.</li>
	<li>Quando concluído, transferi os embriões injetados num prato rotulado enxaguando-os fora do entalhe de agarose com sistema de água de peixes e uma pipeta de transferência descartável 3,4 mL. Armazene os embriões em uma incubadora de 28,5 ° C para deixá-los a desenvolver. Verifique volta ao longo do dia removendo embriões de peixe morto e substitua a água com azul de metileno 0,1% em água de peixe.</li>
	<li>Cerca de 6-8 horas após a injeção, tome 10 indivíduo injetado embriões de peixe e preparar o DNA genômico de-los usando o método de Hotshot18.</li>
	<li>Na manhã seguinte, use um microscópio de dissecação com uma fonte de luz de fluorescência para classificar para fora os embriões mostrando GFP nos tecidos não-gema. Estes embriões de peixe devem conter a construção injetada.</li>
	<li>Realize o ensaio de impostos especiais de consumo Tol2 para verificar a atividade do transposon conforme descrito anteriormente,19. Se o plasmídeo excisado pode ser detectado, manter o injetado embriões de peixe e criá-los. Se nenhum plasmídeo excisado pode ser detectado, repita o processo de síntese e microinjeção de mRNA Tol2 até alcançar os resultados positivos do ensaio de impostos especiais de consumo do Tol2.</li>
</ol>4. a criação de peixes transgênicos ASAP1, Tg (ubi: ASAP1)
<ol><li>Levante o peixe injetado (geração de0 F) até a idade adulta, conforme descrito anteriormente no zebrafish livro20. Isto geralmente leva cerca de 4 meses.</li>
	<li>Tirar um único adulto F0 peixe e cruzá-lo com um único oposto sexo sua peixe. Colete embriões de peixes após a criação no final do dia. Manter os embriões de peixes coletados na incubadora de 28,5 ° C em peixes de água com azul de metileno 0,1%.</li>
	<li>No terceiro dia, verifique os embriões de peixes debaixo de um microscópio fluorescente dissecação com um filtro GFP. Resolver os embriões de peixe verde, se houver algum e criá-los até a idade adulta como F1 geração transgénica peixe, Tg (ubi: ASAP1). Nota: Proporção mendeliana não é esperada uma vez que a maioria dos peixes0 F parentais é quimeras genética germinal.</li>
	<li>Cruze o único F1 peixes adultos com peixes de sua e coletar embriões de peixes. Resolver os embriões de peixe verde e criá-los para a vida adulta como F2 geração de peixe. Nota: Verde e embriões de peixe não-verde devem ser próximo de 1:1 se há um único transgene.</li>
	<li>Para exibir as alterações de potenciais elétricas no tumor como tumores de bainha de nervo periférico maligno (MPNST), atravessar a geração de2 F Tg (ubi: ASAP1) peixe com peixe rpl35hi258/wt . Sabe-se que tumores visíveis começam a ser encontrados em 6-8 meses de idade adultos21,22.</li>
</ol>5. imaging
<ol><li>Que imagem zebrafish embriões tomar múltiplos fundador de geração F2 peixes e cruzá-los com sua peixe pares individuais. Colete embriões de peixe em diferentes estádios de desenvolvimento desejados, de acordo com o zebrafish encenando guia23.</li>
	<li>Para os estágios iniciais dos embriões de peixes, descascar e retirar chorions dos embriões com cuidado, usando um par de pinças em um escopo de dissecação de um diâmetro de 10 cm Petri com sistema de água de peixes.</li>
	<li>Transferi alguns embriões de peixe numa lâmina de vidro concaved com metilcelulose de 3%, utilizando uma pipeta de transferência descartável de 3,4 mL. Ajuste os embriões para as posições desejadas para visualizar a atividade celular de GFP usando uma agulha por baixo de um escopo de dissecação fluorescente.</li>
	<li>Para as fases móveis de embriões de peixes (mais de 12 palco somite), use o mesilato de metanosulfonato de 0,05% para anestesiar os embriões de peixe antes de transferi-los para slides. Brevemente, embriões de peixes foram surgiu em 0.05% tricaina mesilato em água de peixe até que eles pararam de natação e equilíbrio do corpo de perda. Além disso, adicione uma gota de mesilato de tricaina 0,05% com a metilcelulose no slide.</li>
	<li>Para menos de 12 embriões de peixe de estágio somite, use um microscópio composto de epi-fluorescência com uma câmera compatível e software para a imagem latente. Por mais de 12 embriões de peixe somite estágio, use um microscópio de fluorescência dissecação.</li>
	<li>Tensão de célula de tumor de imagem, primeiro, identificar os peixes com tumores MPNST. Em seguida, anestesia o peixe com mesilato de metanosulfonato de 0,05%. Para toda montagem imagem, coloque o peixe em um prato de Petri de 10-cm de diâmetro. Para visualizar a atividade elétrica de células de tumor, tumores de peixe podem ser dissecados para fora após toda montagem imagem.</li>
</ol>

<ol>
	<li>Levin, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+bioelectricity:+how+endogenous+voltage+potentials+control+cell+behavior+and+instruct+pattern+regulation+in+vivo.">Molecular bioelectricity: how endogenous voltage potentials control cell behavior and instruct pattern regulation in vivo.</a> Molecular Biology of the Cell. 25 (24), 3835-3850 (2014).</li><li>Storace, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Toward+Better+Genetically+Encoded+Sensors+of+Membrane+Potential.">Toward Better Genetically Encoded Sensors of Membrane Potential.</a> Trends in Neuroscience. 39 (5), 277-289 (2016).</li><li>Inagaki, S., Nagai, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Current+progress+in+genetically+encoded+voltage+indicators+for+neural+activity+recording.">Current progress in genetically encoded voltage indicators for neural activity recording.</a> Current Opinion in Chemical Biology. 33, 95-100 (2016).</li><li>St-Pierre, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-fidelity+optical+reporting+of+neuronal+electrical+activity+with+an+ultrafast+fluorescent+voltage+sensor.">High-fidelity optical reporting of neuronal electrical activity with an ultrafast fluorescent voltage sensor.</a> Nature Neuroscience. 17 (6), 884-889 (2014).</li><li>Lieschke, G. J., Currie, P. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Animal+models+of+human+disease:+zebrafish+swim+into+view.">Animal models of human disease: zebrafish swim into view.</a> Nature Reviews Genetics. 8 (5), 353-367 (2007).</li><li>Santoriello, C., Zon, L. I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hooked!+Modeling+human+disease+in+zebrafish.">Hooked! Modeling human disease in zebrafish.</a> Journal of Clinical Investigation. 122 (7), 2337-2343 (2012).</li><li>Howe, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+zebrafish+reference+genome+sequence+and+its+relationship+to+the+human+genome.">The zebrafish reference genome sequence and its relationship to the human genome.</a> Nature. , (2013).</li><li>Kawakami, K., Shima, A., Kawakami, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+a+functional+transposase+of+the+Tol2+element,+an+Ac-like+element+from+the+Japanese+medaka+fish,+and+its+transposition+in+the+zebrafish+germ+lineage.">Identification of a functional transposase of the Tol2 element, an Ac-like element from the Japanese medaka fish, and its transposition in the zebrafish germ lineage.</a> Proceedings of the National Academy of Science USA. 97 (21), 11403-11408 (2000).</li><li>Urasaki, A., Asakawa, K., Kawakami, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+transposition+of+the+Tol2+transposable+element+from+a+single-copy+donor+in+zebrafish.">Efficient transposition of the Tol2 transposable element from a single-copy donor in zebrafish.</a> Proceedings of the National Academy of Science USA. 105 (50), 19827-19832 (2008).</li><li>Kwan, K. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Tol2kit:+a+multisite+gateway-based+construction+kit+for+Tol2+transposon+transgenesis+constructs.">The Tol2kit: a multisite gateway-based construction kit for Tol2 transposon transgenesis constructs.</a> Developmental Dynamics. 236 (11), 3088-3099 (2007).</li><li>Mosimann, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ubiquitous+transgene+expression+and+Cre-based+recombination+driven+by+the+ubiquitin+promoter+in+zebrafish.">Ubiquitous transgene expression and Cre-based recombination driven by the ubiquitin promoter in zebrafish.</a> Development. 138 (1), 169-177 (2011).</li><li>Lorenz, T. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Polymerase+chain+reaction:+basic+protocol+plus+troubleshooting+and+optimization+strategies.">Polymerase chain reaction: basic protocol plus troubleshooting and optimization strategies.</a> Journal of Visualized Experiments. (63), e3998 (2012).</li><li>Ordovas, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Separation+of+small-size+DNA+fragments+using+agarose+gel+electrophoresis.">Separation of small-size DNA fragments using agarose gel electrophoresis.</a> Methods in Molecular Biology. 110, 35-42 (1998).</li><li>Downey, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Extraction+of+DNA+from+agarose+gels.">Extraction of DNA from agarose gels.</a> Methods Mol Biol. 235, 137-139 (2003).</li><li>Desjardins, P., Conklin, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=NanoDrop+microvolume+quantitation+of+nucleic+acids.">NanoDrop microvolume quantitation of nucleic acids.</a> Journal of Visualized Experiments. 45 (45), (2010).</li><li>Green, M. R., Sambrook, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Molecular cloning : a laboratory manual. , (2012).</li><li>Zhang, S., Cahalan, M. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Purifying+plasmid+DNA+from+bacterial+colonies+using+the+QIAGEN+Miniprep+Kit.">Purifying plasmid DNA from bacterial colonies using the QIAGEN Miniprep Kit.</a> Journal of Visualized Experiments. (6), 247 (2007).</li><li>Meeker, N. D., Hutchinson, S. A., Ho, L., Trede, N. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Method+for+isolation+of+PCR-ready+genomic+DNA+from+zebrafish+tissues.">Method for isolation of PCR-ready genomic DNA from zebrafish tissues.</a> Biotechniques. 43 (5), (2007).</li><li>Kawakami, K., Koga, A., Hori, H., Shima, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Excision+of+the+tol2+transposable+element+of+the+medaka+fish,+Oryzias+latipes,+in+zebrafish,+Danio+rerio.">Excision of the tol2 transposable element of the medaka fish, Oryzias latipes, in zebrafish, Danio rerio.</a> Gene. 225 (1-2), 17-22 (1998).</li><li>Westerfield, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> The zebrafish book. A guide for the laboratory use of zebrafish (Danio rerio). , (2000).</li><li>Amsterdam, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Many+ribosomal+protein+genes+are+cancer+genes+in+zebrafish.">Many ribosomal protein genes are cancer genes in zebrafish.</a> PLoS Biology. 2 (5), E139 (2004).</li><li>Lai, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Many+ribosomal+protein+mutations+are+associated+with+growth+impairment+and+tumor+predisposition+in+zebrafish.">Many ribosomal protein mutations are associated with growth impairment and tumor predisposition in zebrafish.</a> Developmental Dynamics. 238 (1), 76-85 (2009).</li><li>Kimmel, C. B., Ballard, W. W., Kimmel, S. R., Ullmann, B., Schilling, T. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Stages+of+embryonic+development+of+the+zebrafish.">Stages of embryonic development of the zebrafish.</a> Developmental Dynamics. 203 (3), 253-310 (1995).</li><li>Zhang, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparative+oncogenomic+analysis+of+copy+number+alterations+in+human+and+zebrafish+tumors+enables+cancer+driver+discovery.">Comparative oncogenomic analysis of copy number alterations in human and zebrafish tumors enables cancer driver discovery.</a> PLoS Genetics. 9 (8), e1003734 (2013).</li><li>Zhang, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Highly+aneuploid+zebrafish+malignant+peripheral+nerve+sheath+tumors+have+genetic+alterations+similar+to+human+cancers.">Highly aneuploid zebrafish malignant peripheral nerve sheath tumors have genetic alterations similar to human cancers.</a> Proceedings of the National Academy of Science USA. 107 (39), 16940-16945 (2010).</li><li>Urrego, D., Tomczak, A. P., Zahed, F., Stuhmer, W., Pardo, L. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Potassium+channels+in+cell+cycle+and+cell+proliferation.">Potassium channels in cell cycle and cell proliferation.</a> Philosophical Transactions of the Royal Society of London Series B. 369 (1638), 20130094 (2014).</li><li>Yang, H. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Subcellular+Imaging+of+Voltage+and+Calcium+Signals+Reveals+Neural+Processing+In+Vivo.">Subcellular Imaging of Voltage and Calcium Signals Reveals Neural Processing In Vivo.</a> Cell. 166 (1), 245-257 (2016).</li><li>Chamberland, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fast+two-photon+imaging+of+subcellular+voltage+dynamics+in+neuronal+tissue+with+genetically+encoded+indicators.">Fast two-photon imaging of subcellular voltage dynamics in neuronal tissue with genetically encoded indicators.</a> Elife. 6, (2017).</li><li>Hochbaum, D. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=All-optical+electrophysiology+in+mammalian+neurons+using+engineered+microbial+rhodopsins.">All-optical electrophysiology in mammalian neurons using engineered microbial rhodopsins.</a> Nature Methods. 11 (8), 825-833 (2014).</li><li>Sugiyama, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Illuminating+cell-cycle+progression+in+the+developing+zebrafish+embryo.">Illuminating cell-cycle progression in the developing zebrafish embryo.</a> Proceedings of the National Academy of Science USA. 106 (49), 20812-20817 (2009).</li></ol>

Os autores não têm nada para divulgar.

Embora as atividades elétricas nível celular e tecidos durante o desenvolvimento embrionário e doença humana foram descobertas há muito tempo atrás, na vivo elétrica mudanças dinâmicas e seus papéis biológicos ainda permanecem em grande parte desconhecidos. Um dos maiores desafios é Visualizar e quantificar as alterações elétricas. Tecnologia de braçadeira do remendo é um quebra-through para acompanhamento de células únicas, mas sua aplicação aos embriões vertebrados é limitada, porque ele...

Bioeletricidade refere-se a sinalização eléctrica endógeno mediada por canais iônicos e bombas localizadas na membrana celular1. Intercâmbio iônico através da membrana celular e as acoplado mudanças atuais e potenciais elétricas, é essencial para a sinalização de processos das células neuronais e musculares excitáveis. Além disso, bioeletricidade e gradientes de íons têm uma variedade de outras funções biológicas importantes, incluindo o armazenamento de energia, biossíntese e transporte do metabólito. Sinalização bioelétrica também foi descoberto como um regulador de formação embrionária padrão, tais como machados do corpo, o ciclo celular e de diferenciação celular1. Assim, é fundamental para a compreensão de muitas doenças congênitas humanas que resultam do Regulamento mis deste tipo de sinalização. Embora a braçadeira do remendo tem sido amplamente utilizada para gravação de células únicas, é ainda longe do ideal para o monitoramento simultâneo de várias células durante o desenvolvimento embrionário em vivo. Além disso, pequenas moléculas sensíveis de tensão também não são ideais para aplicações em vivo devido às suas especificidades, sensibilidades e toxicidades.
A criação de uma variedade de geneticamente codificado fluorescente tensão indicadores (GEVIs) oferece um novo mecanismo para superar este problema e permite a fácil aplicação estudar o desenvolvimento embrionário, mesmo que eles foram originalmente destinados para monitoramento neural células de2,3. Dentre os GEVIs atualmente disponíveis é o acelerado Sensor de potenciais de ação 1 (ASAP1)4. É composto por um loop extracelular de um domínio sensor de tensão de tensão sensível fosfatase e uma circular permutada proteína verde fluorescente. Portanto, ASAP1 permite a visualização de alterações de potenciais elétricas celulares (polarização: verde brilhante; despolarização: verde-escuro). ASAP1 tem 2 ms sobre-e-off cinética e pode seguir abaixo do limite potencial mudança4. Assim, esta ferramenta genética permite um novo nível de eficácia no monitoramento em tempo real bioelétrica em células vivas. Mais compreensão dos papéis de bioeletricidade no desenvolvimento embrionário e muitas doenças humanas, tais como câncer, derramará nova luz sobre os mecanismos subjacentes, que é fundamental para a prevenção e tratamento da doença.
Zebrafish provaram um poderoso modelo animal para estudar a biologia do desenvolvimento e doenças humanas, incluindo o câncer5,6. Eles compartilham genes ortólogos de 70% com os humanos, e eles têm biologia vertebrada semelhante7. Zebrafish fornecer cuidados relativamente fácil, um tamanho de embreagem grande de ovos, genética tractable, transgênese fácil e desenvolvimento embrionário externo transparente, que faz com que um sistema superior na vivo de imagem5,6. Com uma grande fonte de linhas de peixes mutantes já presentes e um genoma completamente sequenciado, zebrafish fornecerá uma variedade relativamente ilimitada de descoberta científica.
Para investigar na vivo em tempo real atividade elétrica das células, aproveitamos o sistema modelo de zebrafish e ASAP1. Neste artigo, descrevemos como incorporar o biosensor fluorescente tensão ASAP1 no genoma da zebrafish usando Tol2 transposon transgênese e visualizar a atividade elétrica celular durante o desenvolvimento embrionário, movimento larvas de peixe e no tumor ao vivo .

<table><tbody><tr><td>14mL cell culture tubes</td><td>VWR</td><td>60818-725</td><td>E.Coli culture</td></tr><tr><td>Agarose electrophoresis tank</td><td>Thermo Scientific</td><td>Owl B2</td><td>DNA eletrophoresis</td></tr><tr><td>Agarose RA</td><td>Amresco</td><td>N605-500G</td><td>For making the injection gels</td></tr><tr><td>Attb1-ASAP1-F primer</td><td>IDT DNA</td><td>GGGGACAAGTTTGTACAAAAAA&lt;br /&gt;GCAGGCTTCACCATGGAGACGA&lt;br /&gt;CTGTGAGGTATGAACA</td><td>ASAP1 coding region amplification for subcloning</td></tr><tr><td>Attb2-ASAP1-R primer</td><td>IDT DNA</td><td>GGGGACCACTTTGTACAAGAAA&lt;br /&gt;GCTGGGTCTTAGGTTACCACTTC&lt;br /&gt;AAGTTGTTTCTTCTGTGAAGCCA</td><td>ASAP1 coding region amplification for subcloning</td></tr><tr><td>Bright field dissection scope</td><td>Nikon</td><td>SMZ 745</td><td>Dechorionation, microinjection, mounting</td></tr><tr><td>Color camera</td><td>Zeiss</td><td>AxioCam MRc</td><td>Fish embryo image recording</td></tr><tr><td>Concave slide</td><td>VWR</td><td>48336-001</td><td>For holding fish embryos during imaging process</td></tr><tr><td>Disposable transfer pipette 3.4 ml</td><td>Thermo Scientific</td><td>13-711-9AM</td><td>Fish embryos and water transfer</td></tr><tr><td>Endonuclease enzyme, Not I</td><td>NEB</td><td>R0189L</td><td>For linearizing plasmid DNA</td></tr><tr><td>Epifuorescent compound scope</td><td>Zeiss</td><td>Axio Imager.A2</td><td>Fish embryo imaging</td></tr><tr><td>Epifuorescent stereo dissection scope</td><td>Zeiss</td><td>Stereo Discovery.V12</td><td>Fish embryo imaging</td></tr><tr><td>Fluorescent light source</td><td>Lumen dynamics</td><td>X-cite seris 120</td><td>Light source for fluorescence microscopes</td></tr><tr><td>Forceps #5</td><td>WPI</td><td>500342</td><td>Dechorionation and needle breaking</td></tr><tr><td>Gateway BP Clonase II Enzyme mix</td><td>Thermo Scientific</td><td>11789020</td><td>Gateway BP recombination cloning</td></tr><tr><td>Gateway LR Clonase II Plus enzyme</td><td>Thermo Scientific</td><td>12538120</td><td>Gateway LR recombination cloning</td></tr><tr><td>Gel DNA Recovery Kit</td><td>Zymo Research</td><td>D4002</td><td>DNA gel purification</td></tr><tr><td>Loading tip</td><td>Eppendorf</td><td>930001007</td><td>For loading injection solution into capilary needles</td></tr><tr><td>Methylcellulose (1600cPs)</td><td>Alfa Aesar</td><td>43146</td><td>Fish embryo mounting</td></tr><tr><td>Methylene blue</td><td>Sigma-Aldrich</td><td>M9140</td><td>Suppresses fungal outbreaks in Petri dishes</td></tr><tr><td>Microinjection mold</td><td>Adaptive Science Tools</td><td>TU-1</td><td>To prepare agaorse mold tray for holding fish embryos during injection</td></tr><tr><td>Microinjector</td><td>WPI</td><td>Pneumatic Picopump PV820</td><td>Microinjection injector</td></tr><tr><td>Micro-manipulator</td><td>WPI</td><td>Microinjector MM3301R</td><td>Microinjection operation</td></tr><tr><td>Micropipette puller</td><td>Sutter instrument</td><td>P-1000</td><td>For preparing capillary needle</td></tr><tr><td>Mineral oil</td><td>Amresco</td><td>J217-500ml</td><td>For calibrating injection volume</td></tr><tr><td>mMESSAGE mMACHINE SP6 Transcription Kit</td><td>Thermo Scientific</td><td>AM1340</td><td>mRNA in vitro transcription</td></tr><tr><td>Monocolor camera</td><td>Zeiss</td><td>AxioCam MRm</td><td>Fish embryo image recording</td></tr><tr><td>Plasmid Miniprep Kit</td><td>Zymo Research</td><td>D4020</td><td>Prepare small amount of plasmid DNA</td></tr><tr><td>Plastic Petri dishes</td><td>VWR</td><td>25384-088</td><td>For holding fish or fish embryos during imaging process</td></tr><tr><td>RNA Clean &amp;amp; Concentrator-5</td><td>Zymo Research</td><td>R1015</td><td>mRNA cleaning after in vitro transcription</td></tr><tr><td>Spectrophotometer</td><td>Thermo Scientific</td><td>NanoDrop 2000</td><td>For measuring DNA and RNA concentrations</td></tr><tr><td>Stage Micrometer</td><td>Am Scope</td><td>MR100</td><td>Microinjection volume calibration</td></tr><tr><td>Thermocycler</td><td>Bio-Rad</td><td>T100</td><td>DNA amplification for gene cloning</td></tr><tr><td>Thin wall glass capillaries</td><td>WPI</td><td>TW100F-4</td><td>Raw glass for making cappilary needle</td></tr><tr><td>Tol2-exL1 primer</td><td>IDT DNA</td><td>GCACAACACCAGAAATGCCCTC</td><td>Tol2 excise assay</td></tr><tr><td>Tol2-exR primer</td><td>IDT DNA</td><td>ACCCTCACTAAAGGGAACAAAAG</td><td>Tol2 excise assay</td></tr><tr><td>TOP10 Chemically Competent E. coli</td><td>Thermo Scientific</td><td>C404006</td><td>Used for transformation during gene cloning</td></tr><tr><td>Tricaine mesylate</td><td>Sigma-Aldrich</td><td>A5040</td><td>For anesthetizing fish or fish embryos</td></tr><tr><td>UV trans-illuminator 302nm</td><td>UVP</td><td>M-20V</td><td>DNA visualization</td></tr><tr><td>Water bath</td><td>Thermo Scientific</td><td>2853</td><td>For transformation process of gene cloning</td></tr></tbody></table>

visualization of cellular electrical activity in zebrafish early embryos and tumors

Bioeletricidade, sinalização eléctrica endógeno mediada por canais iônicos e bombas localizadas na membrana celular, desempenha papéis importantes na sinalização de processos das células neuronais e musculares excitáveis e muitos outros processos biológicos, tais como embrionárias padronização do desenvolvimento. No entanto, há uma necessidade na vivo monitoramento da atividade elétrica em vertebrados embriogênese. Os avanços dos indicadores de voltagem fluorescente geneticamente codificado (GEVIs) tornaram possível fornecer uma solução para este desafio. Aqui, descrevemos como criar um indicador de tensão transgénicos zebrafish usando o indicador de tensão estabelecida, ASAP1 (acelerado Sensor de potenciais de ação 1), por exemplo. O kit de Tol2 e um promotor de zebrafish onipresente, ubi, foram escolhidos neste estudo. Nós também explicar os processos de clonagem de site-specific Gateway Tol2 baseados em transposon zebrafish transgênese e o processo de imagem para tumores de embriões e peixes peixes fase inicial usando regular epifluorescente microscópios. Usando esta linha de peixe, achamos que há mudanças de tensão elétrica celular durante a embriogênese de zebrafish e movimento de larvas de peixes. Além disso, observou-se que em alguns zebrafish tumores de bainha de nervo periférico maligno, o tumor de células foram geralmente polarizadas em comparação com os tecidos normais circundantes.

Em uma injeção bem sucedida, mais do que embriões de peixe 50% injetado irão exibir algum grau de fluorescência verde nas células somáticas, e a maioria deles será positiva por meio de ensaio Tol2 transposon impostos especiais de consumo (Figura 2). Após 2-4 gerações de para fora-Cruz com sua peixes (até que o peixe fluorescente chegar a 50%, a proporção mendeliana esperada), os peixes transgênicos foram utilizados para o experimento de imagem ...

Watch this Scientific Journal Video about Visualization of Cellular Electrical Activity in Zebrafish Early Embryos and Tumors at JoVE.com

Visualization of Cellular Electrical Activity in Zebrafish Early Embryos and Tumors

Visualização da atividade elétrica celular no Zebrafish embriões adiantados e tumores

Aqui, mostramos o processo de criação de uma linha de zebrafish do repórter de tensão elétrica celular para visualizar o desenvolvimento embrionário, movimento, e células de tumor de peixe em vivo.

Bioelectricity, endogenous electrical signaling mediated by ion channels and pumps located on the cell membrane, plays important roles in signaling ...

visualization-cellular-electrical-activity-zebrafish-early-embryos

Universidad San Sebastian

Research

JoVE Journal

Developmental Biology

8.7K visualizações.  Purdue University. Aqui, mostramos o processo de criação de uma linha de zebrafish do repórter de tensão elétrica celular para visualizar o desenvolvimento embrionário, movimento, e células de tumor de peixe em vivo.

Vídeo: Visualization of Cellular Electrical Activity in Zebrafish Early Embryos and Tumors

Time-lapse Live Imaging of Clonally Related Neural Progenitor Cells in the Developing Zebrafish Forebrain

Precise patterns of division, migration and differentiation of neural progenitor cells are crucial for proper brain development and function1,2. To understand the behavior of neural progenitor cells in the complex in vivo environment, time-lapse live imaging of neural progenitor cells in an intact brain is critically required. In this video, we exploit the unique features of zebrafish embryos to visualize the development of forebrain neural progenitor cells in vivo. We use electroporation to genetically and sparsely label individual neural progenitor cells. Briefly, DNA constructs coding for fluorescent markers were injected into the forebrain ventricle of 22 hours post fertilization (hpf) zebrafish embryos and electric pulses were delivered immediately. Six hours later, the electroporated zebrafish embryos were mounted with low melting point agarose in glass bottom culture dishes. Fluorescently labeled neural progenitor cells were then imaged for 36hours with fixed intervals under a confocal microscope using water dipping objective lens. The present method provides a way to gain insights into the in vivo development of forebrain neural progenitor cells and can be applied to other parts of the central nervous system of the zebrafish embryo.

The present video demonstrates a method which takes advantage of the combination of electroporation and confocal microscopy to perform live imaging on individual neural progenitor cells in the developing zebrafish forebrain. In vivo analysis of the development of forebrain neural progenitor cells at a clonal level can be achieved in this way.

Lapso de tempo de imagens ao vivo de relação clonal células progenitoras neurais no desenvolvimento Zebrafish Encéfalo anterior

Precise patterns of division, migration and differentiation of neural progenitor cells are crucial for proper brain development and function1,2. To ...

Neurociência

Biosensing Motor Neuron Membrane Potential in Live Zebrafish Embryos

The protocols described here are designed to allow researchers to study cell communication without altering the integrity of the environment in which the cells are located. Specifically, they have been developed to analyze the electrical activity of excitable cells, such as spinal neurons. In such a scenario, it is crucial to preserve the integrity of the spinal cell, but it is also important to preserve the anatomy and physiological shape of the systems involved. Indeed, the comprehension of the manner in which the nervous system-and other complex systems-works must be based on a systemic approach. For this reason, the live zebrafish embryo was chosen as a model system, and the spinal neuron membrane voltage changes were evaluated without interfering with the physiological conditions of the embryos. 
Here, an approach combining the employment of zebrafish embryos with a FRET-based biosensor is described. Zebrafish embryos are characterized by a very simplified nervous system and are particularly suited for imaging applications thanks to their transparency, allowing for the employment of fluorescence-based voltage indicators at the plasma membrane during zebrafish development. The synergy between these two components makes it possible to analyze the electrical activity of the cells in intact living organisms, without perturbing the physiological state. Finally, this non-invasive approach can co-exist with other analyses (e.g., spontaneous movement recordings, as shown here).

Protocols described here allow for the study of the electrical properties of excitable cells in the most non-invasive physiological conditions by employing zebrafish embryos in an in vivo system together with a fluorescence resonance energy transfer (FRET)-based genetically encoded voltage indicator (GEVI) selectively expressed in the cell type of interest.

Potencial de membrana de neurônio motor biossensível em embriões vivos de peixe-zebra

The protocols described here are designed to allow researchers to study cell communication without altering the integrity of the environment in which the ...

Biologia do Desenvolvimento

Live Imaging of the Zebrafish Embryonic Brain by Confocal Microscopy

In this video, we demonstrate the method our lab has developed to analyze the cell shape changes and rearrangements required to bend and fold the developing zebrafish brain (Gutzman et al, 2008). Such analysis affords a new understanding of the underlying cell biology required for development of the 3D structure of the vertebrate brain, and significantly increases our ability to study neural tube morphogenesis. The embryonic zebrafish brain is shaped beginning at 18 hours post fertilization (hpf) as the ventricles within the neuroepithelium inflate. By 24 hpf, the initial steps of neural tube morphogenesis are complete. Using the method described here, embryos at the one cell stage are injected with mRNA encoding membrane-targeted green fluorescent protein (memGFP). After injection and incubation, the embryo, now between 18 and 24 hpf, is mounted, inverted, in agarose and imaged by confocal microscopy. Notably, the zebrafish embryo is transparent making it an ideal system for fluorescent imaging. While our analyses have focused on the midbrain-hindbrain boundary and the hindbrain, this method could be extended for analysis of any region in the zebrafish to a depth of 
80-100 &mu;m.

In this video, we demonstrate a method by which to analyze the developing vertebrate brain in live zebrafish embryos at single cell resolution by confocal microscopy. This includes the method by which we inject the single-cell zebrafish embryo and subsequently mount and image the developing brain.

Vivem de imagem do cérebro Zebrafish embrionárias por microscopia confocal

In this video, we demonstrate the method our lab has developed to analyze the cell shape changes and rearrangements required to bend and fold the ...

Biologia

Forebrain Electrophysiological Recording in Larval Zebrafish

Epilepsy affects nearly 3 million people in the United States and up to 50 million people worldwide. Defined as the occurrence of spontaneous unprovoked seizures, epilepsy can be acquired as a result of an insult to the brain or a genetic mutation. Efforts to model seizures in animals have primarily utilized acquired insults (convulsant drugs, stimulation or brain injury) and genetic manipulations (antisense knockdown, homologous recombination or transgenesis) in rodents. Zebrafish are a vertebrate model system1-3 that could provide a valuable alternative to rodent-based epilepsy research. Zebrafish are used extensively in the study of vertebrate genetics or development, exhibit a high degree of genetic similarity to mammals and express homologs for ~85% of known human single-gene epilepsy mutations. Because of their small size (4-6 mm in length), zebrafish larvae can be maintained in fluid volumes as low as 100 &mu;l during early development and arrayed in multi-well plates. Reagents can be added directly to the solution in which embryos develop, simplifying drug administration and enabling rapid in vivo screening of test compounds4. Synthetic oligonucleotides (morpholinos), mutagenesis, zinc finger nuclease and transgenic approaches can be used to rapidly generate gene knockdown or mutation in zebrafish5-7. These properties afford zebrafish studies an unprecedented statistical power analysis advantage over rodents in the study of neurological disorders such as epilepsy. Because the "gold standard" for epilepsy research is to monitor and analyze the abnormal electrical discharges that originate in a central brain structure (i.e., seizures), a method to efficiently record brain activity in larval zebrafish is described here. This method is an adaptation of conventional extracellular recording techniques and allows for stable long-term monitoring of brain activity in intact zebrafish larvae. Sample recordings are shown for acute seizures induced by bath application of convulsant drugs and spontaneous seizures recorded in a genetically modified fish.

A simple method to record extracellular field potentials in the larval zebrafish forebrain is described. The method provides a robust in vivo read-out of seizure-like activity. This technique can be used with genetically modified zebrafish larvae carrying epilepsy-related genes or seizures evoked by administration of convulsant drugs.

Prosencéfalo gravação eletrofisiológico em larval Zebrafish

Epilepsy affects nearly 3 million people in the United States and up to 50 million people worldwide. Defined as the occurrence of spontaneous unprovoked ...

Live Imaging of Cell Motility and Actin Cytoskeleton of Individual Neurons and Neural Crest Cells in Zebrafish Embryos

The zebrafish is an ideal model for imaging cell behaviors during development in vivo. Zebrafish embryos are externally fertilized and thus easily accessible at all stages of development. Moreover, their optical clarity allows high resolution imaging of cell and molecular dynamics in the natural environment of the intact embryo. We are using a live imaging approach to analyze cell behaviors during neural crest cell migration and the outgrowth and guidance of neuronal axons.
Live imaging is particularly useful for understanding mechanisms that regulate cell motility processes. To visualize details of cell motility, such as protrusive activity and molecular dynamics, it is advantageous to label individual cells. In zebrafish, plasmid DNA injection yields a transient mosaic expression pattern and offers distinct benefits over other cell labeling methods. For example, transgenic lines often label entire cell populations and thus may obscure visualization of the fine protrusions (or changes in molecular distribution) in a single cell. In addition, injection of DNA at the one-cell stage is less invasive and more precise than dye injections at later stages.
Here we describe a method for labeling individual developing neurons or neural crest cells and imaging their behavior in vivo. We inject plasmid DNA into 1-cell stage embryos, which results in mosaic transgene expression. The vectors contain cell-specific promoters that drive expression of a gene of interest in a subset of sensory neurons or neural crest cells. We provide examples of cells labeled with membrane targeted GFP or with a biosensor probe that allows visualization of F-actin in living cells1.
Erica Andersen, Namrata Asuri, and Matthew Clay contributed equally to this work.

This protocol describes imaging of individual neurons or neural crest cells in living zebrafish embryos. This method is used to examine cellular behaviors and actin localization using fluorescence confocal time-lapse microscopy.

Imagens ao vivo da motilidade celular e citoesqueleto de actina de neurônios individuais e células da crista neural em embriões Zebrafish

The zebrafish is an ideal model for imaging cell behaviors during development in vivo. Zebrafish embryos are externally fertilized and thus easily ...

Visualizing the Developing Brain in Living Zebrafish using Brainbow and Time-lapse Confocal Imaging

Development of the vertebrate nervous system requires a precise coordination of complex cellular behaviors and interactions. The use of high resolution in vivo imaging techniques can provide a clear window into these processes in the living organism. For example, dividing cells and their progeny can be followed in real time as the nervous system forms. In recent years, technical advances in multicolor techniques have expanded the types of questions that can be investigated. The multicolor Brainbow approach can be used to not only distinguish among like cells, but also to color-code multiple different clones of related cells that each derive from one progenitor cell. This allows for a multiplex lineage analysis of many different clones and their behaviors simultaneously during development. Here we describe a technique for using time-lapse confocal microscopy to visualize large numbers of multicolor Brainbow-labeled cells over real time within the developing zebrafish nervous system. This is particularly useful for following cellular interactions among like cells, which are difficult to label differentially using traditional promoter-driven colors. Our approach can be used for tracking lineage relationships among multiple different clones simultaneously. The large datasets generated using this technique provide rich information that can be compared quantitatively across genetic or pharmacological manipulations. Ultimately the results generated can help to answer systematic questions about how the nervous system develops.

In vivo imaging is a powerful tool that can be used to investigate the cellular mechanisms underlying nervous system development. Here we describe a technique for using time-lapse confocal microscopy to visualize large numbers of multicolor Brainbow-labeled cells in real time within the developing zebrafish nervous system.

Visualizando o cérebro em desenvolvimento em zebrafish vivo usando Brainbow e Imagem Confocal de lapso de tempo

Development of the vertebrate nervous system requires a precise coordination of complex cellular behaviors and interactions. The use of high resolution in ...

Multicolor Time-lapse Imaging of Transgenic Zebrafish: Visualizing Retinal Stem Cells Activated by Targeted Neuronal Cell Ablation

High-resolution time-lapse imaging of living zebrafish larvae can be utilized to visualize how biological processes unfold (for review see 1). Compound transgenic fish which express different fluorescent reporters in neighboring cell types provide a means of following cellular interactions 2 and/or tissue-level responses to experimental manipulations over time. In this video, we demonstrate methods that can be used for imaging multiple transgenically labeled cell types serially in individual fish over time courses that can span from minutes to several days. The techniques described are applicable to any study seeking to correlate the "behavior" of neighboring cells types over time, including: 1) serial 'catch and release' methods for imaging a large number of fish over successive days, 2) simplified approaches for separating fluorophores with overlapping excitation/emission profiles (e.g., GFP and YFP), 3) use of hypopigmented mutant lines to extend the time window available for high-resolution imaging into late larval stages of development, 4) use of membrane targeted fluorescent reporters to reveal fine morphological detail of individual cells as well as cellular details in larger populations of cells, and 5) a previously described method for chemically-induced ablation of transgenically targeted cell types; i.e., nitroreductase (NTR) mediated conversion of prodrug substrates, such as metronidazole (MTZ), to cytotoxic derivatives 3,5.
As an example of these approaches, we will visualize the ablation and regeneration of a subtype of retinal bipolar neuron within individual fish over several days. Simultaneously we will monitor several other retinal cell types, including neighboring non-targeted bipolar cells and potential degeneration-stimulated retinal stem cells (i.e., M&#971;ller glia). This strategy is being applied in our lab to characterize cell- and tissue-level (e.g., stem cell niche) responses to the selective loss and regeneration of targeted neuronal cell types.

In this video, techniques for multicolor confocal time-lapse imaging and targeted cell ablation are provided. Time-lapse imaging is used to monitor the behavior of multiple cell types of interest in vivo. Targeted cell ablation facilitates the study neural circuit function and cell-specific neuronal regeneration paradigms.

Multicolor imagem em tempo-lapso de Transgênicos Zebrafish: Visualizando Células-Tronco da retina Ativado por Ablação célula-alvo Neuronal

High-resolution time-lapse imaging of living zebrafish larvae can be utilized to visualize how biological processes unfold (for review see 1). Compound ...

Imaging and 3D Reconstruction of Cerebrovascular Structures in Embryonic Zebrafish

Zebrafish are a powerful tool to study developmental biology and pathology in vivo. The small size and relative transparency of zebrafish embryos make them particularly useful for the visual examination of processes such as heart and vascular development. In several recent studies transgenic zebrafish that express EGFP in vascular endothelial cells were used to image and analyze complex vascular networks in the brain and retina, using confocal microscopy. Descriptions are provided to prepare, treat and image zebrafish embryos that express enhanced green fluorescent protein (EGFP), and then generate comprehensive 3D renderings of the cerebrovascular system. Protocols include the treatment of embryos, confocal imaging, and fixation protocols that preserve EGFP fluorescence. Further, useful tips on obtaining high-quality images of cerebrovascular structures, such as removal the eye without damaging nearby neural tissue are provided. Potential pitfalls with confocal imaging are discussed, along with the steps necessary to generate 3D reconstructions from confocal image stacks using freely available open source software.

Imaging of cerebrovascular development in larval zebrafish is described. Techniques to facilitate 3D imaging and modify cerebrovascular development using chemical treatments are also provided.

Imagem e Reconstrução 3D de Estruturas cerebrovasculares em Embryonic Zebrafish

Zebrafish are a powerful tool to study developmental biology and pathology in vivo.  The small size and relative transparency of zebrafish embryos make ...

Semi-automated Imaging of Tissue-specific Fluorescence in Zebrafish Embryos

Zebrafish embryos are a powerful tool for large-scale screening of small molecules. Transgenic zebrafish that express fluorescent reporter proteins are frequently used to identify chemicals that modulate gene expression. Chemical screens that assay fluorescence in live zebrafish often rely on expensive, specialized equipment for high content screening. We describe a procedure using a standard epifluorescence microscope with a motorized stage to automatically image zebrafish embryos and detect tissue-specific fluorescence. Using transgenic zebrafish that report estrogen receptor activity via expression of GFP, we developed a semi-automated procedure to screen for estrogen receptor ligands that activate the reporter in a tissue-specific manner. In this video we describe procedures for arraying zebrafish embryos at 24-48 hours post fertilization (hpf) in a 96-well plate and adding small molecules that bind estrogen receptors. At 72-96 hpf, images of each well from the entire plate are automatically collected and manually inspected for tissue-specific fluorescence. This protocol demonstrates the ability to detect estrogens that activate receptors in heart valves but not in liver.

Described here is a protocol for semi-automated imaging of tissue-specific fluorescence in zebrafish embryos.

Imagem semi-automatizada de Fluorescência de tecidos específicos em embriões Zebrafish

Zebrafish embryos are a powerful tool for large-scale screening of small molecules. Transgenic zebrafish that express fluorescent reporter proteins are ...

In vivo Imaging of Fully Active Brain Tissue in Awake Zebrafish Larvae and Juveniles by Skull and Skin Removal

Understanding the ephemeral changes that occur during brain development and maturation requires detailed high-resolution imaging in space and time at cellular and subcellular resolution. Advances in molecular and imaging technologies have allowed us to gain numerous detailed insights into cellular and molecular mechanisms of brain development in the transparent zebrafish embryo. Recently, processes of refinement of neuronal connectivity that occur at later larval stages several weeks after fertilization, which are for example control of social behavior, decision making or motivation-driven behavior, have moved into focus of research. At these stages, pigmentation of the zebrafish skin interferes with light penetration into brain tissue, and solutions for embryonic stages, e.g., pharmacological inhibition of pigmentation, are not feasible anymore.
Therefore, a minimally invasive surgical solution for microscopy access to the brain of awake zebrafish is provided that is derived from electrophysiological&#160;approaches. In teleosts, skin and soft skull cartilage can be carefully removed by micro-peeling these layers, exposing underlying neurons and axonal tracts without damage. This allows for recording neuronal morphology, including synaptic structures and their molecular contents, and the observation of physiological changes such as Ca2+ transients or intracellular transport events. In addition, interrogation of these processes by means of pharmacological inhibition or optogenetic manipulation is feasible. This brain exposure approach provides information about structural and physiological changes in neurons as well as the correlation and interdependence of these events in live brain tissue in the range of minutes or hours. The technique is suitable for in vivo brain imaging of zebrafish larvae up to 30 days post fertilization, the latest developmental stage tested so far. It, thus, provides access to such important questions as synaptic refinement and scaling, axonal and dendritic transport, synaptic targeting of cytoskeletal cargo or local activity-dependent expression. Therefore, a broad use for this mounting and imaging approach can be anticipated.

Here we present a method to image the zebrafish embryonic brain in vivo upto larval and juvenile stages. This microinvasive procedure, adapted from electrophysiological approaches, provides access to cellular and subcellular details of mature neuron and can be combined with optogenetics and neuropharmacological studies for characterizing brain function and drug intervention.

In vivo Imagem de Tecido Cerebral Totalmente Ativo em Larvas de Zebrafish Acordados e Juvenis por Remoção de Crânio e Pele

Understanding the ephemeral changes that occur during brain development and maturation requires detailed high-resolution imaging in space and time at ...