Name: induced differentiation of m cell-like cells in human stem cell-derived ileal enteroid monolayers
Uploaded: 2019-07-26T14:00:00.000+00:00
Duration: 11 min 34 s
Description: Watch this Scientific Journal Video about Induced Differentiation of M Cell-like Cells in Human Stem Cell-derived Ileal Enteroid Monolayers at JoVE.com

This work was supported by NIAID U19AI131126 to Dr. Isberg (Tufts University School of Medicine) and Dr. Kaplan (Tufts University); (JM is Project 2 leader) and NIAID R21AI128093 to JM. ACF was supported in part by NIAID T32AI007077. SEB and MKE were supported by NIAID U19AI116497-05. We thank members of the Mecsas lab, the Ng lab, and Dr. Isberg at Tufts University School of Medicine for useful discussions.&#160;<span style="font-size: 11pt; line-height: 115%; font-family: Calibri, sans-serif; color: black; background-image: initial; background-position: initial; background-size: initial; background-repeat: initial; background-attachment: initial; background-origin: initial; background-clip: initial;">The confocal imaging was performed at the Tufts Center for Neuroscience Research, P30 NS047243.

All methods described here have been approved by the Tufts University IBC and IRB.
1. Inducing M Cell Differentiation in Human Ileal Enteroid-derived Monolayers
NOTE: This protocol uses ileal enteroids derived from human tissue biopsy. Please refer to published protocols for methods on how to grow and passage these cells18,24. The following methods for developing monolayers were adapted from Zou et al.24. Methods for inducing M cells in ileal enteroid-derived cultures were adapted from previous reports21,22,23. All work is carried out in a sterile tissue culture hood and incubations are in hood or tissue culture incubator as indicated. See Table of Materials needed to prepare ileal enteroid monolayers and various medias.
<ol>
	<li>Grow ileal enteroids for 4-10 days in extracellular matrix (ECM) (see Table of Materials) (Figure 1), depending on their intrinsic growth rates, before seeding onto transwells.</li>
	<li>Coating transwell membranes
	<ol>
		<li>Place desired number of transwells in a 24-well plate creating a two-chamber system.</li>
		<li>Dilute ECM 25-fold in cold sterile phosphate-buffered saline (PBS) and add 100 &#181;L of cold diluted solution into each upper chamber onto the membrane. 
		NOTE: ECM and diluted ECM solution must be kept on ice until immediately before addition.</li>
		<li>Cover the 24-well plate with lid and place the plate into a tissue culture incubator at 37 &#176;C for 2 h to permit ECM solidification on the membrane.</li>
		<li>After 2 h, remove the plate from the incubator and place in a tissue culture hood. Using sterile tweezers, invert each transwell to gently remove remaining solution. Allow the membranes to airdry in hood with the lid open while cells are being collected (Steps 1.3.1- 1.3.11).</li>
	</ol>
	</li>
	<li>Dissociating the ileal enteroids into single cells
	<ol>
		<li>Remove the plate of ileal enteroids from the incubator and gently remove the culture media from each well by vacuum aspiration or with a pipette. 
		NOTE: One well of ileal enteroids containing approximately 100 healthy cysts is sufficient to seed 1.5-2 wells.</li>
		<li>Add 500 &#181;L of ice cold 0.5 mM ethylenediaminetetraacetic acid (EDTA) to each well containing ileal enteroids suspended in ECM to break up the ECM. Pipette up and down vigorously with a P1000 pipettor set at 500 &#181;L to break up ECM thereby releasing ileal enteroids into the solution. To improve dissolution of ECM, after pipetting, shake the plate vigorously at 4 &#176;C for 30 min.</li>
		<li>Collect the solution from each well into 15 mL conical tubes. 
		NOTE: Collect up to 10 wells per 15 mL conical tube for optimal single cell collection.</li>
		<li>Pellet the cells in a centrifuge at 140 x g and 4 &#176;C for 5 min. Pellet should be visible but can easily be dislodged, so slowly remove the supernatant by vacuum aspiration or with a pipette. 
		NOTE: If concerned about loss of pellet and cells, use a pipette and save the supernatant in a separate tube.</li>
		<li>To digest tight junction linkages and break up the ileal enteroids into single cells, resuspend the pellet in 500 &#181;L of room temperature trypsin per every 5 wells collected in step 1.3.3. Using a P1000, pipette up and down to disaggregate the clumps and incubate the tubes in a 37 &#176;C water bath for 5 min or less. 
		NOTE: Optimization is needed to determine the appropriate amount of time required to incubate the tubes so that the cells are broken up but not over-trypsinized to the point that they die. Use Trypan blue in step 1.3.9 to ensure that the cells are viable after trypsin treatment.</li>
		<li>Add 1 mL of Advanced DMEM/F12 with 10% Fetal Bovine Serum (FBS) per 500 &#181;L of trypsin to inactivate the trypsin.</li>
		<li>Pipette up and down with a P1000 set at 500 &#956;L at least 50 times against the side of the conical tube to further disaggregate remaining clumps into single cells.</li>
		<li>Place a 40 &#181;m cell strainer over a 50 mL conical and add 1 mL of Advanced DMEM/F12 with 10% FBS to wet the cell strainer. Pipette the single cell suspension from the 15 mL conical onto the strainer. Wash the strainer with 1 mL of Advanced DMEM/F12 with 10% FBS.</li>
		<li>Transfer the cells that went through the cell strainer from the 50 mL conical into a new 15 mL conical tube. During the centrifugation step 1.3.10, the cellular pellet will be more easily seen in a 15 mL conical tube. Count the cells using a hemocytometer. Use Trypan blue to verify that cells are still alive. Typically, &#62;95% viability is observed.</li>
		<li>While counting the cells, centrifuge the cells in the new 15 mL tube at 400 x g and room temperature for 5 min. Cell pellet should be visible. Carefully remove the supernatant with a pipette, again saving the supernatant in case the pellet becomes dislodged.</li>
		<li>Prepare modified complete growth media25 (MCMGF+ media) supplemented with 10 &#181;M Y-27632. Resuspend pelleted cells at 2.5 x 105 cells/200 &#956;L in MCMGF+. See remarks in discussion about optimizing cell seeding number. 
		NOTE: MCMGF+ media is Advanced DMEM/F12 with 75% L-Wnt3a conditioned media, 10% R-spondin conditioned media, 5% Noggin conditioned media, 1x B27 Supplement, 1x N2 Supplement, 1 mM N-acetylcysteine, 50 ng/mL mouse recombinant EGF, 500 nM A-8301, 10 nM [Leu15]-Gastrin I, 10 mM HEPES, 2 mM GlutaMAX, and 1x Penicillin/Streptomycin (optional).</li>
		<li>Ensure that the ECM-coated membranes prepared in step 1.2 have fully dried, as assessed by eye. Wash the upper chamber with 200 &#956;L of MCMGF+. Add 200 &#956;L of cell solution into each upper chamber.</li>
		<li>Add 700 &#956;L of MCMGF+ with 10 &#956;M Y-27632 to each lower chamber. Place the plate in a 37 &#176;C tissue culture incubator with 5% CO2.</li>
		<li>After 1 day of growth, remove the media from the upper chamber and replace with 200 &#956;L of fresh MCMGF+, to prevent growth of multiple cell layers.</li>
	</ol>
	</li>
	<li>Replacing medium
	<ol>
		<li>Once monolayers are ~80% confluent, usually between days 1-3 post-seeding, replace basolateral media with differentiation media (DM) for control wells (see step 1.4.2 for more detail) or with M cell media for M cell induction wells (see step 1.4.3 for more detail). Replace the media in upper chamber with DM for both conditions. 
		NOTE: DM is Advanced DMEM/F12 with 5% Noggin conditioned media, 1x B27 Supplement, 1x N2 Supplement, 1 mM N-acetylcysteine, 50 ng/mL mouse recombinant EGF, 500 nM A-8301, 10 nM [Leu15]-Gastrin I, 10 mM HEPES Buffer, 2 mM GlutaMAX, and 1x Penicillin/Streptomycin (optional). M cell media is DM supplemented with 200 ng/mL RANKL and 50 ng/mL TNF&#945;.</li>
		<li>For control wells that should not contain M cells, add 200 &#956;L of DM to the upper chamber and 700 &#956;L DM to the bottom chamber.</li>
		<li>To induce M cells, add 200 &#181;L of DM to the upper chamber and 700 &#181;L of M cell media to the bottom chamber.</li>
		<li>Replace the media every 2 days. For control wells, replace DM in the upper and lower chambers. For M cell wells, replace DM in the upper chamber and M cell media in the lower chamber. 
		NOTE: By day 7 post cell-seeding, M cells are fully induced in the monolayers.</li>
	</ol>
	</li>
</ol>
2. Verifying M Cell Differentiation by qRT-PCR
NOTE: Perform the following work at a sterile RNAse-free bench space. See Table of Materials for a list of preferred materials for qRT-PCR.
<ol>
	<li>Remove the media from upper and bottom chambers and wash the upper chamber 2x gently with 300 &#181;L of room temperature PBS.</li>
	<li>Add 300 &#181;L of Trizol to each upper chamber. Incubate at room temperature for 5 min. 
	CAUTION: Wear gloves and eye protection when using Trizol to avoid contact with skin as indicated in manufacturer&#8217;s instructions.</li>
	<li>Meanwhile, label microcentrifuge tubes for each well and add 700 &#181;L of Trizol to each tube.</li>
	<li>Collect cell homogenate by pipetting up and down 3x gently with a P1000 and transfer the contents into corresponding microcentrifuge tube. Vortex for 5 s to mix.</li>
	<li>Keep the samples at room temperature for an additional 3 min. Then store at -80 &#176;C for up to one month.</li>
	<li>Follow standard qRT-PCR methodology for RNA isolation, DNase treatment, Reverse Transcription and qRT-PCR reactions. Refer to primer list in Table of Materials.</li>
</ol>
3. Verifying M Cell Differentiation by Immunofluorescence
NOTE: Always keep the lower chamber of the plate filled with PBS so that the membranes remain wet. This procedure is performed on the bench. See Table of Materials for a list of preferred materials for immunofluorescence.
<ol>
	<li>Remove the media from the upper chamber and wash 2x gently with 300 &#181;L of room temperature PBS. Add 100 &#181;L of room temperature 4% PFA in PBS to the upper chamber. Cover the plate with foil and let stand for 25 min at room temperature. Remove 4% PFA. 
	CAUTION: 4% PFA should be properly disposed of as hazardous chemical waste.</li>
	<li>Wash the upper chamber 3x with 300 &#181;L of room temperature PBS. At this point, samples can remain at 4 &#176;C for up to a month prior to staining. Once stained, samples should be visualized within a week for best quality images.</li>
	<li>Incubate the monolayers with 100 &#181;L of 5% Bovine Serum Albumin (BSA) dissolved in PBS for 30 min in dark at room temperature to block the monolayers.</li>
	<li>Prepare GP2 primary antibody solution in 1% BSA in PBS at a dilution of 1:100. Add 100 &#181;L per well. Stain for 1 h at room temperature in the dark. Remove the solution. 
	NOTE: Do not permeabilize the monolayers before primary stain for GP2 occurs because optimal primary GP2 surface staining of M cells is achieved without permeabilization.</li>
	<li>Wash the upper chamber 3x times with 300 &#181;L of room temperature PBS.</li>
	<li>Prepare secondary stain solution of fluorescently tagged goat anti-mouse IgG at 1:200, phalloidin at 1:100 and DAPI in 1% BSA+ 0.1% triton in PBS. Add 100 &#181;L per well. Stain for 30 min at room temperature in the dark. 
	NOTE: Triton is added to the secondary stain solution to permeabilize the cells during this step for proper phalloidin stain.</li>
	<li>Wash 3x with 300 &#181;L PBS.</li>
	<li>Place a 5 &#181;L drop of mounting solution (Table of Materials) on a glass slide. Remove the well from the 24 well plate and invert. Carefully cut the membrane from the well using a scalpel. Place the membrane with the cells facing up onto the droplet of mounting solution on the glass slide. Add 10 &#181;L of mounting solution onto the top and center of the membrane and place a coverslip on top to seal the membrane between the glass slide and coverslip.</li>
	<li>Dry the slides at room temperature in the dark for 24 h. Stained slides should be visualized on confocal microscope within 1 week post-staining.</li>
</ol>

<ol>
	<li>Kraehenbuhl, J. P., Neutra, M. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epithelial+M+cells:+differentiation+and+function.">Epithelial M cells: differentiation and function.</a> Annual Review of Cell and Developmental Biology. 16, 301-332 (2000).</li><li>Neutra, M. R., Frey, A., Kraehenbuhl, J. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epithelial+M+cells:+gateways+for+mucosal+infection+and+immunization.">Epithelial M cells: gateways for mucosal infection and immunization.</a> Cell. 86 (3), 345-348 (1996).</li><li>Nakamura, Y., Kimura, S., Hase, K. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=cell-dependent+antigen+uptake+on+follicle-associated+epithelium+for+mucosal+immune+surveillance.">cell-dependent antigen uptake on follicle-associated epithelium for mucosal immune surveillance.</a> Inflammation and Regeneration. 38, 15 (2018).</li><li>Clark, M. A., Hirst, B. H., Jepson, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=M-cell+surface+beta1+integrin+expression+and+invasin-mediated+targeting+of+Yersinia+pseudotuberculosis+to+mouse+Peyer's+patch+M+cells.">M-cell surface beta1 integrin expression and invasin-mediated targeting of Yersinia pseudotuberculosis to mouse Peyer's patch M cells.</a> Infection and Immunity. 66 (3), 1237-1243 (1998).</li><li>Jensen, V. B., Harty, J. T., Jones, B. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Interactions+of+the+invasive+pathogens+Salmonella+typhimurium,+Listeria+monocytogenes,+and+Shigella+flexneri+with+M+cells+and+murine+Peyer's+patches.">Interactions of the invasive pathogens Salmonella typhimurium, Listeria monocytogenes, and Shigella flexneri with M cells and murine Peyer's patches.</a> Infection and Immunity. 66 (8), 3758-3766 (1998).</li><li>Jones, B. D., Ghori, N., Falkow, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Salmonella+typhimurium+initiates+murine+infection+by+penetrating+and+destroying+the+specialized+epithelial+M+cells+of+the+Peyer's+patches.">Salmonella typhimurium initiates murine infection by penetrating and destroying the specialized epithelial M cells of the Peyer's patches.</a> Journal of Experimental Medicine. 180 (1), 15-23 (1994).</li><li>Marra, A., Isberg, R. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Invasin-dependent+and+invasin-independent+pathways+for+translocation+of+Yersinia+pseudotuberculosis+across+the+Peyer's+patch+intestinal+epithelium.">Invasin-dependent and invasin-independent pathways for translocation of Yersinia pseudotuberculosis across the Peyer's patch intestinal epithelium.</a> Infection and Immunity. 65 (8), 3412-3421 (1997).</li><li>Ohno, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Intestinal+M+cells.">Intestinal M cells.</a> Journal of Biochemistry. 159 (2), 151-160 (2016).</li><li>Kerneis, S., Bogdanova, A., Kraehenbuhl, J. P., Pringault, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Conversion+by+Peyer's+patch+lymphocytes+of+human+enterocytes+into+M+cells+that+transport+bacteria.">Conversion by Peyer's patch lymphocytes of human enterocytes into M cells that transport bacteria.</a> Science. 277 (5328), 949-952 (1997).</li><li>Gullberg, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expression+of+specific+markers+and+particle+transport+in+a+new+human+intestinal+M-cell+model.">Expression of specific markers and particle transport in a new human intestinal M-cell model.</a> Biochemical and Biophysical Research Communications. 279 (3), 808-813 (2000).</li><li>Giannasca, P. J., Giannasca, K. T., Leichtner, A. M., Neutra, M. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+intestinal+M+cells+display+the+sialyl+Lewis+A+antigen.">Human intestinal M cells display the sialyl Lewis A antigen.</a> Infection and Immunity. 67 (2), 946-953 (1999).</li><li>Jang, M. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Intestinal+villous+M+cells:+an+antigen+entry+site+in+the+mucosal+epithelium.">Intestinal villous M cells: an antigen entry site in the mucosal epithelium.</a> Proceedings of the National Academy of Sciences of the United States of America. 101 (16), 6110-6115 (2004).</li><li>Beloqui, A., Brayden, D. J., Artursson, P., Preat, V., des Rieux, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+human+intestinal+M-cell-like+model+for+investigating+particle,+antigen+and+microorganism+translocation.">A human intestinal M-cell-like model for investigating particle, antigen and microorganism translocation.</a> Nature Protocols. 12 (7), 1387-1399 (2017).</li><li>Martinez-Argudo, I., Jepson, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Salmonella+translocates+across+an+in+vitro+M+cell+model+independently+of+SPI-1+and+SPI-2.">Salmonella translocates across an in vitro M cell model independently of SPI-1 and SPI-2.</a> Microbiology. 154 (Pt 12), 3887-3894 (2008).</li><li>Lee, J. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+analysis+of+lab-to-lab+variability+in+Caco-2+permeability+assays.">Quantitative analysis of lab-to-lab variability in Caco-2 permeability assays.</a> European Journal of Pharmaceutics and Biopharmaceutics. 114, 38-42 (2017).</li><li>Mabbott, N. A., Donaldson, D. S., Ohno, H., Williams, I. R., Mahajan, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microfold+(M)+cells:+important+immunosurveillance+posts+in+the+intestinal+epithelium.">Microfold (M) cells: important immunosurveillance posts in the intestinal epithelium.</a> Mucosal Immunology. 6 (4), 666-677 (2013).</li><li>Sato, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single+Lgr5+stem+cells+build+crypt-villus+structures+in+vitro+without+a+mesenchymal+niche.">Single Lgr5 stem cells build crypt-villus structures in vitro without a mesenchymal niche.</a> Nature. 459 (7244), 262-265 (2009).</li><li>Sato, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Long-term+expansion+of+epithelial+organoids+from+human+colon,+adenoma,+adenocarcinoma,+and+Barrett's+epithelium.">Long-term expansion of epithelial organoids from human colon, adenoma, adenocarcinoma, and Barrett's epithelium.</a> Gastroenterology. 141 (5), 1762-1772 (2011).</li><li>Knoop, K. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RANKL+is+necessary+and+sufficient+to+initiate+development+of+antigen-sampling+M+cells+in+the+intestinal+epithelium.">RANKL is necessary and sufficient to initiate development of antigen-sampling M cells in the intestinal epithelium.</a> Journal of Immunology. 183 (9), 5738-5747 (2009).</li><li>Taylor, R. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lymphotoxin-independent+expression+of+TNF-related+activation-induced+cytokine+by+stromal+cells+in+cryptopatches,+isolated+lymphoid+follicles,+and+Peyer's+patches.">Lymphotoxin-independent expression of TNF-related activation-induced cytokine by stromal cells in cryptopatches, isolated lymphoid follicles, and Peyer's patches.</a> Journal of Immunology. 178 (9), 5659-5667 (2007).</li><li>de Lau, W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Peyer's+patch+M+cells+derived+from+Lgr5(+)+stem+cells+require+SpiB+and+are+induced+by+RankL+in+cultured+&amp;#34;miniguts&amp;#34;.">Peyer's patch M cells derived from Lgr5(+) stem cells require SpiB and are induced by RankL in cultured &amp;#34;miniguts&amp;#34;.</a> Molecular and Cellular Biology. 32 (18), 3639-3647 (2012).</li><li>Rouch, J. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+of+Functional+Microfold+(M)+Cells+from+Intestinal+Stem+Cells+in+Primary+Human+Enteroids.">Development of Functional Microfold (M) Cells from Intestinal Stem Cells in Primary Human Enteroids.</a> PloS One. 11 (1), e0148216 (2016).</li><li>Wood, M. B., Rios, D., Williams, I. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TNF-alpha+augments+RANKL-dependent+intestinal+M+cell+differentiation+in+enteroid+cultures.">TNF-alpha augments RANKL-dependent intestinal M cell differentiation in enteroid cultures.</a> American Journal of Physiology: Cell Physiology. 311 (3), C498-C507 (2016).</li><li>Zou, W. Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+Intestinal+Enteroids:+New+Models+to+Study+Gastrointestinal+Virus+Infections.">Human Intestinal Enteroids: New Models to Study Gastrointestinal Virus Infections.</a> Methods in Molecular Biology. , (2017).</li><li>Kozuka, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+and+Characterization+of+a+Human+and+Mouse+Intestinal+Epithelial+Cell+Monolayer+Platform.">Development and Characterization of a Human and Mouse Intestinal Epithelial Cell Monolayer Platform.</a> Stem Cell Reports. 9 (6), 1976-1990 (2017).</li><li>Barker, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+stem+cells+in+small+intestine+and+colon+by+marker+gene+Lgr5.">Identification of stem cells in small intestine and colon by marker gene Lgr5.</a> Nature. 449 (7165), 1003-1007 (2007).</li><li>Mantis, N. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Selective+adherence+of+IgA+to+murine+Peyer's+patch+M+cells:+evidence+for+a+novel+IgA+receptor.">Selective adherence of IgA to murine Peyer's patch M cells: evidence for a novel IgA receptor.</a> Journal of Immunology. 169 (4), 1844-1851 (2002).</li><li>Rios, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Antigen+sampling+by+intestinal+M+cells+is+the+principal+pathway+initiating+mucosal+IgA+production+to+commensal+enteric+bacteria.">Antigen sampling by intestinal M cells is the principal pathway initiating mucosal IgA production to commensal enteric bacteria.</a> Mucosal Immunology. 9 (4), 907-916 (2016).</li><li>Miller, H., Zhang, J., Kuolee, R., Patel, G. B., Chen, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Intestinal+M+cells:+the+fallible+sentinels?.">Intestinal M cells: the fallible sentinels?.</a> World Journal of Gastroenterology. 13 (10), 1477-1486 (2007).</li><li>Heijmans, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ER+stress+causes+rapid+loss+of+intestinal+epithelial+stemness+through+activation+of+the+unfolded+protein+response.">ER stress causes rapid loss of intestinal epithelial stemness through activation of the unfolded protein response.</a> Cell Reports. 3 (4), 1128-1139 (2013).</li></ol>

The authors have nothing to disclose.

To develop monolayers that differentiate properly into the major intestinal cell types and M cells, it is critical to be aware of several factors. Ileal enteroids must be harvested from ECM cultures that are undifferentiated and have a high proportion of Lgr5+ stem cells. Visually, the majority of the ileal enteroids in the ECM cultures should not be darkened and multilobular, and LGR5 expression should be detected in these cultures by qRT-PCR analysis. Quality control of conditioned media is essential for the propagation of undifferentiated cultures over time and must be completed for each batch of conditioned media that is produced. Quality control can be completed by testing a new batch of media on some ECM cultures and comparing the morphology of the ileal enteroids to a previous batch of media over the course of a week. LGR5 expression should remain relatively similar in the ileal enteroid cultures grown in the new batch of media compared to the previous batch.
During preparation of the ileal enteroids for seeding as monolayers, it is important to vigorously pipette the cell solution after incubation with trypsin to break up the ileal enteroids into single cells. Cell clumps can lead to multi-layer formation when seeded for monolayers. In addition, it is essential to empirically determine the number of cells required to form a monolayer for each individual ileal enteroid line that is obtained. Typically, this value can range from 2.5 x 105 &#8211; 5.0 x 105 cells/well but depends on the degree of cystic to non-cystic ileal enteroids in cultures and varies for each individual ileal enteroid line. From experience, ileal enteroids grown in ECM that appear less cystic require higher cell seeding density to achieve monolayers. It is advisable to wash the upper chamber after 1 day of growth by gently pipetting the media up and down 2-3 times and replacing with fresh growth media. This process dislodges cells that have landed on top of other cells reducing the likelihood of multi-layer formation. Switching the media in the upper chamber from growth media to M cell media when the monolayers are ~80% confluent, which usually occurs at day 2 post-seeding, helps achieve good M cell differentiation. Addition of RANKL/TNF&#945; to the upper chamber during M cell induction does not lead to the development of a greater number of M cells per monolayer and therefore can be left out of the upper chamber media. Transwells of varying pore sizes can be used in this protocol without affecting M cell development; however, cell seeding density must be optimized for those with larger pore sizes. Collagen IV can be substituted for ECM as a basement membrane protein coating for transwells or well plates which may be better suited for certain applications.
Ileal enteroid-derived monolayers on transwells provide a two-chamber system that allows for the creation of defined apical and basolateral surfaces such that the 4-5 different types of epithelial intestinal cells can polarize to express surface markers on each side relative to that found in the intestine. Additional factors can be added to either side such as particles, infectious agents, or other cell types. However, to date some limitations remain. As described, this system is a static system that lacks physiological flow, intestinal contractions, and intestinal contents. In addition, the villus-crypt architecture is lost by the formation of a flat monolayer. These systems lack Peyer&#8217;s patch regions, immune cells, and stromal cells. Whether the lack of immune and stromal cells residing closely underneath M cells affects the invaginations which are not observed in this system and other physiological functioning is an important future area of investigation. This protocol can be adapted to a 96-well plate or a multi-well plate format. The procedure for coating the 96-well plate with ECM and seeding with single cells from ileal enteroids remains the same as for transwells. Titration of the cell seeding density required to obtain monolayers must be done, but typically ranges from 1.0 x 105 &#8211; 3.0 x 105 cells/well in a 96-well plate format. M cells are induced by replacing the growth media with M cell media when the monolayers are 80% confluent typically by days 1-3 depending on initial cell seeding density.
This method of differentiating M cells from ileal enteroids in vitro provides significant improvements over the Caco-2 method. The ileal enteroids are primary cells and at least 4-5 epithelial cells types are present in the system. In addition, ileal enteroid lines derived from different people can be studied to investigate how genetics or disease state influence M cell development and behavior. Additional manipulation of the ileal enteroids during M cell differentiation will allow a better understanding of M cell development including characterizing M cell precursor cells. Finally, since the molecular mechanisms of M cell phagocytosis and transcytosis are still not completely understood3,29, this model provides the opportunity to study and visualize antigen and particle uptake by M cells.

M (microfold) cells are specialized intestinal epithelial cells found primarily in the follicle associated epithelium (FAE) of the intestine overlying small lymphoid regions termed Peyer&#8217;s patches1. M cells have short irregular apical microvilli and are deeply invaginated on their basolateral side, which allows immune cells to reside closely to their cell body2. This unique morphology enables M cells to sample antigen from the apical lumen of the intestine and deliver it directly to the underlying immune cells2. In this way, M cells are important for immune surveillance in the intestine but can also be exploited by pathogens for entry into the lamina propria1,2,3,4,5,6,7.
The study of M cells has been hindered by several factors. First, M cells are found at a low frequency in the mouse and human intestine8. In cultured cells systems, M cell-like cells have been induced to differentiate by co-culturing a polarized adenocarcinoma cell line, Caco-2, with either B lymphocytes from mouse Peyer&#8217;s patches or the B cell lymphoma cell line, Raji B9,10. This results in a subset of Caco-2 cells that express the M cell markers Sialyl Lewis A antigen and UEA-1 in the polarized epithelium9,10. (These markers are also expressed on goblet cells in intestinal tissues, so nowadays are less frequently used as definitive M cell markers11,12.) This Caco-2-M cell system has been used to study particle uptake and bacteria translocation13,14. However, Caco-2 cells are an established cell line from a large intestinal adenocarcinoma with the confounding factor that different sources of Caco-2 cells display different phenotypes among labs15. Further, they may not fully recapitulate the transcription levels of true M cells, as they lack expression of currently known M cell markers GP2 and SpiB16. Therefore, additional and more physiologically relevant culture models are needed to be able to study M cell development and functions.
Within the past ten years, the field of enteroid-derived model systems of the intestine has rapidly been progressing forward from the initial discovery that intestinal stem cells derived from human intestinal biopsy could self-propagate and self-renew in culture17,18. Importantly, removal of stem cell promoting factors from the growth media allows these stem cell cultures to differentiate into the many cell types found in the intestine18. Furthermore, recent work suggests the importance of RANKL-RANK signaling in M cell development in the intestine19,20. The RANK receptor is a member of the TNF family of receptors that is expressed on epithelial precursor cells in the intestine19 while RANKL (the RANK receptor ligand) is released by stromal cells of the Peyer&#8217;s patches20. Since the epithelial cell types present in ileal enteroids do not produce RANKL, M cell differentiation in ileal enteroid cultures can be induced by the addition of RANKL to the culture media21,22. Inclusion of TNF&#945; in the culture media helps support M cell development in ileal enteroids23. Here, we describe the methods for inducing differentiation of M cells in intestinal monolayers derived from human ileal enteroids. Our methods are based in part on modifications from the following protocols21,22,23.

<table><tbody><tr><td>[Leu15]-Gastrin I</td><td>Sigma-Aldrich</td><td>G9145</td><td>MCMGF+ and DM ingredient&lt;br/&gt; Solvent: PBS&lt;br/&gt; Stock Concentration: 10 &amp;micro;M&lt;br/&gt; Final Concentration: 10 nM</td></tr><tr><td>0.5 M EDTA</td><td>Invitrogen</td><td>15575020</td><td>For breaking up ECM&lt;br/&gt; Solvent: PBS&lt;br/&gt; Stock Concentration: 0.5 M&lt;br/&gt; Final Concentration: 0.5 mM</td></tr><tr><td>40 &amp;micro;m cell strainer</td><td>Corning</td><td>352340</td><td>For excluding clumps from single cells&lt;br/&gt; Solvent:&lt;br/&gt; Stock Concentration:&lt;br/&gt; Final Concentration:</td></tr><tr><td>A-8301</td><td>Sigma-Aldrich</td><td>SML0788-5MG</td><td>MCMGF+ and DM ingredient&lt;br/&gt; Solvent: DMSO&lt;br/&gt; Stock Concentration: 500 &amp;micro;M&lt;br/&gt; Final Concentration: 500 nM</td></tr><tr><td>Advanced DMEM/F12</td><td>Invitrogen</td><td>12634-028</td><td>MCMGF+ and DM Basal medium&lt;br/&gt; Solvent:&lt;br/&gt; Stock Concentration:&lt;br/&gt; Final Concentration:</td></tr><tr><td>Alexa Fluor 594 goat anti-mouse IgG</td><td>Thermo Fisher</td><td>A-11005</td><td>For secondary stain&lt;br/&gt; Solvent:&lt;br/&gt; Stock Concentration:&lt;br/&gt; Final Concentration: 1:200</td></tr><tr><td>Alexa Fluor 647 Phalloidin</td><td>Invitrogen</td><td>A22287</td><td>Optional secondary stain for F-actin&lt;br/&gt; Solvent:&lt;br/&gt; Stock Concentration:&lt;br/&gt; Final Concentration: 1:100</td></tr><tr><td>B27 Supplement</td><td>Invitrogen</td><td>17504-044</td><td>MCMGF+ and DM ingredient&lt;br/&gt; Solvent:&lt;br/&gt; Stock Concentration: 50x&lt;br/&gt; Final Concentration: 1x</td></tr><tr><td>Bovine Serum Albumin</td><td>Chem-Impex</td><td>00535</td><td>5% for blocking solution&lt;br/&gt; Solvent: PBS&lt;br/&gt; Stock Concentration:&lt;br/&gt; Final Concentration: 0.01</td></tr><tr><td>Chloroform</td><td>Fisher Scientific</td><td>C298-500</td><td>For RNA isolation&lt;br/&gt; Solvent:&lt;br/&gt; Stock Concentration:&lt;br/&gt; Final Concentration:</td></tr><tr><td>Circle coverslips</td><td>Thomas Scientific</td><td>1157B50</td><td>For mounting membrane on glass slide&lt;br/&gt; Solvent:&lt;br/&gt; Stock Concentration:&lt;br/&gt; Final Concentration:</td></tr><tr><td>DAPI (4&amp;prime;,6-diamidino-2-phenylindole)</td><td>Thermo Fisher</td><td>62247</td><td>For secondary stain&lt;br/&gt; Solvent: PBS&lt;br/&gt; Stock Concentration: 100x&lt;br/&gt; Final Concentration: 1x</td></tr><tr><td>DEPC Treated RNAse free H&lt;sub&gt;2&lt;/sub&gt;O</td><td>Fisher Scientific</td><td>BP561-1</td><td>For RNA isolation&lt;br/&gt; Solvent:&lt;br/&gt; Stock Concentration:&lt;br/&gt; Final Concentration:</td></tr><tr><td>DNA Removal Kit</td><td>Invitrogen</td><td>AM1906</td><td>For RNA isolation&lt;br/&gt; Solvent:&lt;br/&gt; Stock Concentration:&lt;br/&gt; Final Concentration:</td></tr><tr><td>Ethyl Alcohol, 200 proof</td><td>Sigma Aldrich</td><td>EX0276-4</td><td>For RNA isolation&lt;br/&gt; Solvent:&lt;br/&gt; Stock Concentration:&lt;br/&gt; Final Concentration:</td></tr><tr><td>Feather Scalpels</td><td>VWR</td><td>100499-580</td><td>For cutting membrane from transwells&lt;br/&gt; Solvent:&lt;br/&gt; Stock Concentration:&lt;br/&gt; Final Concentration:</td></tr><tr><td>Fetal Bovine Serum (FBS)</td><td>Gibco</td><td>26140079</td><td>For inactivating trypsin&lt;br/&gt; Solvent: Advanced DMEM/F12&lt;br/&gt; Stock Concentration: 1&lt;br/&gt; Final Concentration: 0.1</td></tr><tr><td>Glass slides</td><td>Mercedes Scientific</td><td>MER 7200/90/WH</td><td>For mounting membrane on glass slide&lt;br/&gt; Solvent:&lt;br/&gt; Stock Concentration:&lt;br/&gt; Final Concentration:</td></tr><tr><td>GlutaMAX</td><td>Invitrogen</td><td>35050-061</td><td>MCMGF+ and DM ingredient&lt;br/&gt; Solvent:&lt;br/&gt; Stock Concentration: 200 mM&lt;br/&gt; Final Concentration: 2 mM</td></tr><tr><td>GP2 Antibody</td><td>MBL International</td><td>D277-3</td><td>Surface stain for M cells&lt;br/&gt; Solvent:&lt;br/&gt; Stock Concentration:&lt;br/&gt; Final Concentration: 1:100</td></tr><tr><td>HEPES</td><td>Invitrogen</td><td>15630-080</td><td>MCMGF+ and DM ingredient&lt;br/&gt; Solvent:&lt;br/&gt; Stock Concentration: 1 M&lt;br/&gt; Final Concentration: 10 mM</td></tr><tr><td>Human Serum IgA</td><td>Lee BioSolutions</td><td>340-12-1</td><td>For functional analysis of M cells&lt;br/&gt; Solvent: PBS&lt;br/&gt; Stock Concentration: 1 mg/mL&lt;br/&gt; Final Concentration: 10 &amp;micro;g</td></tr><tr><td>L-Wnt3a conditioned media</td><td>Cell line from ATCC</td><td>CRL-2647</td><td>Refer to ATCC Product Sheet for L Wnt&amp;shy;3A (ATCC CRL2647) for conditioned media protocol; MCMGF+ ingredient&lt;br/&gt; Solvent:&lt;br/&gt; Stock Concentration:&lt;br/&gt; Final Concentration: 75% in MCMGF+&lt;br/&gt; 0% in DM</td></tr><tr><td>Matrigel, GFR, phenol free</td><td>Corning</td><td>356231</td><td>Extracellular Matrix (ECM)&lt;br/&gt; Solvent:&lt;br/&gt; Stock Concentration:&lt;br/&gt; Final Concentration:</td></tr><tr><td>Mouse recombinant EGF</td><td>Invitrogen</td><td>PMG8043</td><td>MCMGF+ and DM ingredient&lt;br/&gt; Solvent: PBS&lt;br/&gt; Stock Concentration: 50 &amp;micro;g/mL&lt;br/&gt; Final Concentration: 50 ng/mL</td></tr><tr><td>N2 Supplement</td><td>Invitrogen</td><td>17502-048</td><td>MCMGF+ and DM ingredient&lt;br/&gt; Solvent:&lt;br/&gt; Stock Concentration: 100x&lt;br/&gt; Final Concentration: 1x</td></tr><tr><td>N-acetylcysteine</td><td>Sigma-Aldrich</td><td>A9165-5G</td><td>MCMGF+ and DM ingredient&lt;br/&gt; Solvent: H&lt;sub&gt;2&lt;/sub&gt;O&lt;br/&gt; Stock Concentration: 500 mM&lt;br/&gt; Final Concentration: 1 mM</td></tr><tr><td>Noggin conditioned media</td><td>Cell line gift from Dr. Gijs van den Brink (University of Amsterdam)</td><td></td><td>Ref 30 for conditioned media protocol; MCMGF+ and DM Ingredient&lt;br/&gt; Solvent:&lt;br/&gt; Stock Concentration:&lt;br/&gt; Final Concentration: 5% in MCMGF+&lt;br/&gt; 5% in DM</td></tr><tr><td>Paraformaldehyde (PFA)</td><td>MP Biomedicals</td><td>2199983</td><td>For fixing monolayers&lt;br/&gt; Solvent: PBS&lt;br/&gt; Stock Concentration: 0.16&lt;br/&gt; Final Concentration: 0.04</td></tr><tr><td>PBS, -Mg, -Ca</td><td>Corning</td><td>MT21040CV</td><td>Solvent for 0.5 mM EDTA&lt;br/&gt; Solvent:&lt;br/&gt; Stock Concentration:&lt;br/&gt; Final Concentration:</td></tr><tr><td>Penicillin/Streptomycin</td><td>Invitrogen</td><td>15140-122</td><td>Optional ingredient of MCMGF+ and DM&lt;br/&gt; Solvent:&lt;br/&gt; Stock Concentration: 100x&lt;br/&gt; Final Concentration: 1x</td></tr><tr><td>Prolong Gold</td><td>Invitrogen</td><td>P36930</td><td>Antifade mounting solution&lt;br/&gt; Solvent:&lt;br/&gt; Stock Concentration:&lt;br/&gt; Final Concentration:</td></tr><tr><td>Qiagen RNeasy Kit</td><td>Qiagen</td><td>74106</td><td>For RNA isolation&lt;br/&gt; Solvent:&lt;br/&gt; Stock Concentration:&lt;br/&gt; Final Concentration:</td></tr><tr><td>Recombinant human RANKL</td><td>Peprotech</td><td>310-01</td><td>Used to induce M cells&lt;br/&gt; Solvent: H&lt;sub&gt;2&lt;/sub&gt;O&lt;br/&gt; Stock Concentration: 0.1 mg/mL&lt;br/&gt; Final Concentration: 200 ng/mL</td></tr><tr><td>Recombinant murine TNFa</td><td>Peprotech</td><td>315-01A</td><td>Used to induce M cells&lt;br/&gt; Solvent: H&lt;sub&gt;2&lt;/sub&gt;O&lt;br/&gt; Stock Concentration: 5 mg/mL&lt;br/&gt; Final Concentration: 50 ng/mL</td></tr><tr><td>R-spondin conditioned media</td><td>Cell line from Trevigen</td><td>3710-001-01</td><td>Refer to Trevigen Cultrex Rspo1 Cells product manual (HA-R-Spondin1 293T cell line) for conditioned media protocol; MCMGF+ Ingredient&lt;br/&gt; Solvent:&lt;br/&gt; Stock Concentration:&lt;br/&gt; Final Concentration: 10% in MCMGF+&lt;br/&gt; 0% in DM</td></tr><tr><td>Secondary anti-human IgA antibody</td><td>Jackson Immuno Research</td><td>109-545-011</td><td>For secondary stain&lt;br/&gt; Solvent:&lt;br/&gt; Stock Concentration:&lt;br/&gt; Final Concentration: 1:200</td></tr><tr><td>Super Script IV Reverse Transcriptase</td><td>Thermo Fisher</td><td>18091200</td><td>For conversion of RNA to DNA&lt;br/&gt; Solvent:&lt;br/&gt; Stock Concentration:&lt;br/&gt; Final Concentration:</td></tr><tr><td>Transwell inserts, 24 well-sized</td><td>Greiner Bio-One</td><td>662641</td><td>0.4 &amp;micro;m pore size&lt;br/&gt; Solvent:&lt;br/&gt; Stock Concentration:&lt;br/&gt; Final Concentration:</td></tr><tr><td>TritonX-100</td><td>Sigma-Aldrich</td><td>T8787</td><td>Not required during GP2 primary stain&lt;br/&gt; Solvent: 1% BSA&lt;br/&gt; Stock Concentration:&lt;br/&gt; Final Concentration: 0.001</td></tr><tr><td>TRIzol</td><td>Invitrogen</td><td>15596018</td><td>For RNA isolation&lt;br/&gt; Solvent:&lt;br/&gt; Stock Concentration:&lt;br/&gt; Final Concentration:</td></tr><tr><td>TrypLE Express</td><td>Invitrogen</td><td>12605010</td><td>Trypsin for breaking up enteroids into single cells&lt;br/&gt; Solvent:&lt;br/&gt; Stock Concentration:&lt;br/&gt; Final Concentration:</td></tr><tr><td>Y-27632</td><td>Sigma-Aldrich</td><td>Y-0503</td><td>MCMGF+ ingredient on day 0&lt;br/&gt; Solvent: H&lt;sub&gt;2&lt;/sub&gt;O&lt;br/&gt; Stock Concentration: 5 mM&lt;br/&gt; Final Concentration: 10 &amp;micro;M</td></tr><tr><td>GAPDH forward primer</td><td></td><td></td><td>CATGAGAAGTATGACAACAGCCT</td></tr><tr><td>GAPDH reverse primer</td><td></td><td></td><td>AGTCCTTCCACGATACCAAAGT</td></tr><tr><td>GP2 forward primer</td><td></td><td></td><td>CAATGTGCCTACCCACTGGA</td></tr><tr><td>GP2 reverse primer</td><td></td><td></td><td>ATGGCACCCACATACAGCAC</td></tr><tr><td>LYZ forward primer</td><td></td><td></td><td>CGCTACTGGTGTAATGATGG</td></tr><tr><td>LYZ reverse primer</td><td></td><td></td><td>TTTGCACAAGCTACAGCATC</td></tr><tr><td>MUC2 forward primer</td><td></td><td></td><td>ATGCCCTTGCGTCCATAACA</td></tr><tr><td>MUC2 reverse primer</td><td></td><td></td><td>AGGAGCAGTGTCCGTCAAAG</td></tr><tr><td>SI forward primer</td><td></td><td></td><td>TCCAGCTACTACTCGTGTGAC</td></tr><tr><td>SI reverse primer</td><td></td><td></td><td>CCCTCTGTTGGGAATTGTTCTG</td></tr><tr><td>SPIB forward primer</td><td></td><td></td><td>CAGCAGCCGCTTTTAGCCAC</td></tr><tr><td>SPIB reverse primer</td><td></td><td></td><td>GCATATGCCGGGGGAACC</td></tr><tr><td>LGR5 forward primer</td><td></td><td></td><td>TCAGTCAGCTGCTCCCGAAT</td></tr><tr><td>LGR5 reverse primer</td><td></td><td></td><td>CGTTTCCCGCAAGACGTAAC</td></tr></tbody></table>

induced differentiation of m cell-like cells in human stem cell-derived ileal enteroid monolayers

M (microfold) cells of the intestine function to transport antigen from the apical lumen to the underlying Peyer&#8217;s patches and lamina propria where immune cells reside and therefore contribute to mucosal immunity in the intestine. A complete understanding of how M cells differentiate in the intestine as well as the molecular mechanisms of antigen uptake by M cells is lacking. This is because M cells are a rare population of cells in the intestine and because in vitro models for M cells are not robust. The discovery of a self-renewing stem cell culture system of the intestine, termed enteroids, has provided new possibilities for culturing M cells. Enteroids are advantageous over standard cultured cell lines because they can be differentiated into several major cell types found in the intestine, including goblet cells, Paneth cells, enteroendocrine cells and enterocytes. The cytokine RANKL is essential in M cell development, and addition of RANKL and TNF-&#945; to culture media promotes a subset of cells from ileal enteroids to differentiate into M cells. The following protocol describes a method for the differentiation of M cells in a transwell epithelial polarized monolayer system of the intestine using human ileal enteroids. This method can be applied to the study of M cell development and function.

Ileal enteroids grown in ECM are analyzed visually and by qRT-PCR for their relative health status and differentiation states as a means of quality control for ileal enteroid cultures and for use in monolayers. Undifferentiated ileal enteroids grown in ECM appear clear and cystic in morphology, indicating the presence of many stem cells (Figure 1A). Over time, undifferentiated ileal enteroids grown in growth media may take on an intermediate phenotype where some will appear cystic and some appear opaque (Figure 1B). Frequently, our undifferentiated samples resemble those shown in Figure 1B rather than Figure 1A. These intermediate cultures contain more terminally differentiated enterocytes as measured by expression of the enterocyte marker, sucrase isomaltase (SI), and presumably extruded dead enterocytes in the lumen contribute to their dense appearance. Ileal enteroids can be used in this intermediate state for monolayer development, but it must be kept in mind that the quantity of intestinal stem cells present in the cultures may be low, and some differentiated cell types may be present (for example, see qRT-PCR levels in undifferentiated samples grown in ECM resembling Figure 1B in Figure 2). For comparison, ileal enteroids cultured with differentiation media in ECM for 5+ days will appear uniformly darkened and lobular and cultures with this morphology are not good candidates for seeding monolayers (Figure 1C).
Expression of stem cell genes and genes of intestinal cell differentiation can be analyzed by qRT-PCR as another means to assess the health status of ileal enteroids grown in ECM and their differentiation capabilities once seeded as monolayers on transwells. The expression of a stem cell gene, LGR5, an enterocyte gene, SI, a goblet cell gene, MUC2, and a Paneth cell gene, LYZ, is compared between undifferentiated ileal enteroid cultures grown in ECM and differentiated ileal enteroid monolayers in the presence or absence of RANKL/TNF&#945; (Figure 2). While the values may differ between experiments, expression of LGR5 should decrease after differentiation of monolayers18,26. LGR5 expression is usually not detected in the differentiated ileal monolayers without RANKL and TNF&#945; by day 7. Conversely, expression of markers of differentiation of specific cell types, such SI and MUC2, increase after differentiation18. Expression of LYZ generally decreases after differentiation in our cultures. If the ileal enteroid cultures used for making monolayers look more like Figure 1B than Figure 1A, increases in intestinal differentiation markers may be modest after differentiation because these initial cultures are heterogeneous in intestinal cell types and have a higher basal level of SI and MUC2. However, differentiation in monolayers still occurs as assessed by loss of LGR5 expression and microscopy (see below). Furthermore, addition of RANKL and TNF&#945; to the differentiation media reduces the loss of LGR5 expression (Figure 2). In parallel, the expression of SI and MUC2 are slightly lower than in the differentiated condition lacking RANKL and TNF&#945; although their levels increase above the undifferentiated condition.
M cell differentiation in monolayers is determined both by qRT-PCR and immunofluorescence using two M cell specific markers including cell surface glycoprotein 2 (GP2) and transcription factor SpiB21. Expression of GP2 and SPIB is upregulated in the ileal enteroid-derived monolayers in the presence of RANKL and TNF&#945; and is not detected in non-RANKL and TNF&#945; treated samples (Figure 3). Expression of these markers can also be normalized to a piece of small bowel tissue22, if available. This permits the fold change of these M cell markers to be compared to tissue that has M cells rather than to control monolayers that have no expression of these markers and allows standardization between experiments in one lab. M cells are also detected by surface expression of GP2 by immunofluorescence (Figure 4). Typically, in a confluent monolayer, 1 to 5 M cells are observed in a given microscope field at 40X magnification by days 6 through 8 post-seeding in samples treated with RANKL and TNF&#945; (Figure 4A-D). No GP2 expression is seen in the untreated samples (Figure 4E). The orthogonal view of the XZ plane overlaid with a phalloidin probe shows actin structures surrounding each cell and GP2 expression on the apical surface of M cells (Figure 4F-G). This model recapitulates the low frequency of M cells found in the human intestine1,2,8. To purify and isolate M cells for further study, M cells can be stained using GP2 surface expression and sorted using FACS for GP2+ cells.
M cells bind to and transport antigen from the intestinal lumen to the immune cells residing beneath the epithelium2. Secretory IgA produced in the intestine binds to bacteria and can bind to the apical surface of M cells to facilitate transport of the microbes27,28. To determine if the M cells developed in this model are able to bind to IgA, human serum IgA is added to the upper chamber, allowed to bind for 1 h, and then the monolayers are prepared for immunofluorescence analysis. The presence of IgA on M cells is visualized using a fluor-conjugated secondary antibody that recognizes the heavy chain of human serum IgA. M cells treated with IgA for 1 h have IgA bound to the apical surface (Figure 5A), whereas M cells in control wells that were only treated with the secondary antibody to IgA have no detectable signal (Figure 5B). Further, IgA specifically binds to the apical surface of M cells and is not found bound to any cells lacking GP2 surface stain. In addition, M cells have characteristically shorter dense actin on their apical surface2. To analyze M cell morphology in this model, ileal enteroid-derived monolayers are grown for 7 days and harvested for immunofluorescence analysis of F-actin using phalloidin. Measurements of actin pixel intensity are calculated for M cells and for non-M cells that are directly adjacent to each M cell using ImageJ software (Figure 6A). Actin intensity is reduced on GP2+ M cells in this model and a representative image is shown in Figure 6B. Overall, the M cells developed in this ileal enteroid-derived monolayer model have characteristic gene expression, morphology and some M cell functions of human intestinal M cells, such as binding to IgA.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/59894/59894fig01.jpg" /> 
Figure 1: Representative morphology of human ileal enteroids in ECM one-week post-splitting.&#160;(A) Clear and cystic undifferentiated ileal enteroids. (B) Intermediate phenotype with some cystic ileal enteroids and some opaque lobular ileal enteroids. (C) Darkened and lobular differentiated ileal enteroids. Images taken through the lens of an optical light microscope at 4x magnification using an iPhone7 camera. <a href="https://www-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/59894/59894fig01large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/59894/59894fig02.jpg" /> 
Figure 2: Relative expression of stem cell and differentiation markers of human ileal enteroids grown in ECM or differentiated as monolayers.&#160;Ileal enteroids were grown for 7 days in ECM (Undifferentiated) or grown and differentiated as monolayers without (Differentiated) or with RANKL and TNF&#945; (Differentiated +R/T). Ileal enteroid cultures or monolayers were harvested in Trizol for RNA extraction. Gene expression was determined by qRT-PCR and is expressed relative to GAPDH. Data is average of 3 independent wells of ileal enteroids or monolayers per condition. Error bars indicate SEM. ND is not detected. Statistical significance was determined on log-transformed values using one-way ANOVA with Dunnett&#39;s multiple comparisons test comparing to the Undifferentiated. ** p &#60; 0.01, *** p &#60; 0.001 <a href="https://www-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/59894/59894fig02large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/59894/59894fig03.jpg" /> 
Figure 3: Relative expression of M cell specific markers GP2 and SPIB from human ileal enteroid-derived monolayers.&#160;RANKL/TNF&#945; treated and non-treated human ileal enteroid-derived monolayers were harvested in Trizol for RNA extraction after 7 days post-seeding. Gene expression was determined by qRT-PCR and is expressed relative to GAPDH. Data is average of 6 independent monolayers per condition. Error bars indicate SEM. ND is not detected. <a href="https://www-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/59894/59894fig03large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/59894/59894fig04.jpg" /> 
Figure 4: Immunofluorescence of surface GP2 expression on M cells in human ileal enteroid-derived monolayers over time.&#160;RANKL/TNF&#945; treated and non-treated human ileal enteroid-derived monolayers were fixed in 4% PFA and stained for immunofluorescence on various indicated days post-seeding. Images were analyzed using ImageJ software. DAPI = Blue; Glycoprotein 2 (GP2) = Red. (A-D) RANKL/TNF&#945; treated monolayers at various days post-seeding. (E) Non-treated monolayer harvested at day 7 post-seeding. (F-G) Orthogonal XZ plane of monolayers at day 7 post-seeding overlaid with phalloidin probe for F-actin. Phalloidin = Cyan. <a href="https://www-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/59894/59894fig04large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 5" class="xfigimg" src="/files/ftp_upload/59894/59894fig05.jpg" /> 
Figure 5: IgA binds specifically to the apical surface of M cells.&#160;RANKL/TNF&#945;-treated human ileal enteroid-derived monolayers were grown for 7 days and then (A) treated with 10 &#956;g of human serum IgA for 1 h or (B) mock-treated with PBS only (No IgA control). After 1 h, monolayers were washed 2x in PBS, were fixed in 4% PFA, permeabilized with 0.1% TritonX-100, and stained for immunofluorescence. Images were analyzed using ImageJ software and are representative of 3 independent experiments. DAPI = Blue; Glycoprotein 2 (GP2) = Red; Antibody to human serum IgA = Green; Phalloidin = Cyan. Black arrows denote IgA bound to apical surface of M cell. <a href="https://www-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/59894/59894fig05large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 6" class="xfigimg" src="/files/ftp_upload/59894/59894fig06.jpg" /> 
Figure 6: M cells have reduced actin intensity compared to adjacent non-M cells.&#160;RANKL/TNF&#945;-treated human ileal enteroid-derived monolayers were grown for 7 days and then fixed in 4% PFA and were stained for immunofluorescence. (A) Using ImageJ, GP2+ M cells were outlined using the Freehand Selection Tool and measurements of Area and Integrated Density were taken in the Phalloidin channel. The same analysis was then completed for each adjacent non-M cell that neighbors the M cell. The Raw Integrated Density was divided by the Area of each individual cell for normalization. The average Integrated Density/Area was calculated for each adjacent non-M cells for each M cell. Images were analyzed from 3 independent experiments; each dot is an M cell or average of neighboring cells. Error bars indicate SD. Statistical significance was determined on log-transformed values using a Paired t test. *** p = 0.0001 (B) Representative image of XZ Plane from plot in A. Images were analyzed using ImageJ software. DAPI = Blue; Glycoprotein 2 (GP2) = Red; Phalloidin = Cyan. <a href="https://www-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/59894/59894fig06large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>

Watch this Scientific Journal Video about Induced Differentiation of M Cell-like Cells in Human Stem Cell-derived Ileal Enteroid Monolayers at JoVE.com

Induced Differentiation of M Cell-like Cells in Human Stem Cell-derived Ileal Enteroid Monolayers

This protocol describes how to induce the differentiation of M cells in human stem cell-derived ileal monolayers and methods to assess their development.

M (microfold) cells of the intestine function to transport antigen from the apical lumen to the underlying Peyer&#8217;s patches and lamina propria where ...

induced-differentiation-m-cell-like-cells-human-stem-cell-derived

Universidad San Sebastian

Research

JoVE Journal

Immunology and Infection

8.5K Views.  Sackler School of Graduate Biomedical Sciences. This protocol describes how to induce the differentiation of M cells in human stem cell-derived ileal monolayers and methods to assess their development.

Video: Induced Differentiation of M Cell-like Cells in Human Stem Cell-derived Ileal Enteroid Monolayers

Establishment of Human Epithelial Enteroids and Colonoids from Whole Tissue and Biopsy

The epithelium of the gastrointestinal tract is constantly renewed as it turns over. This process is triggered by the proliferation of intestinal stem cells (ISCs) and progeny that progressively migrate and differentiate toward the tip of the villi. These processes, essential for gastrointestinal homeostasis, have been extensively studied using multiple approaches. Ex vivo technologies, especially primary cell cultures have proven to be promising for understanding intestinal epithelial functions. A long-term primary culture system for mouse intestinal crypts has been established to generate 3-dimensional epithelial organoids. These epithelial structures contain crypt- and villus-like domains reminiscent of normal gut epithelium. Commonly, termed &#8220;enteroids&#8221; when derived from small intestine and &#8220;colonoids&#8221; when derived from colon, they are different from organoids that also contain mesenchyme tissue. Additionally, these enteroids/colonoids continuously produce all cell types found normally within the intestinal epithelium. This in vitro organ-like culture system is rapidly becoming the new gold standard for investigation of intestinal stem cell biology and epithelial cell physiology. This technology has been recently transferred to the study of human gut. The establishment of human derived epithelial enteroids and colonoids from small intestine and colon has been possible through the utilization of specific culture media that allow their growth and maintenance over time. Here, we describe a method to establish a small intestinal and colon crypt-derived system from human whole tissue or biopsies. We emphasize the culture modalities that are essential for the successful growth and maintenance of human enteroids and colonoids.

We describe a method to establish human enteroids from small intestinal crypts and colonoids from colon crypts collected from both surgical tissue and biopsies. In this methodological article, we present the culture modalities that are essential for the successful growth and maintenance of human enteroids and colonoids.

The epithelium of the gastrointestinal tract is constantly renewed as it turns over. This process is triggered by the proliferation of intestinal stem ...

Medicine

Generation, Maintenance, and Characterization of Human Pluripotent Stem Cell-derived Intestinal and Colonic Organoids

Intestinal regional specification describes a process through which unique morphology and function are imparted to defined areas of the developing gastrointestinal (GI) tract. Regional specification in the intestine is driven by multiple developmental pathways, including the bone morphogenetic protein (BMP) pathway. Based on normal regional specification, a method to generate human colonic organoids (HCOs) from human pluripotent stem cells (hPSCs), which include human embryonic stem cells (hES) and induced pluripotent stem cells (iPSCs), was developed. A three-day induction of BMP signaling sufficiently patterns mid/hindgut tube cultures into special AT-rich sequence-binding protein 2 (SATB2)-expressing HCOs containing all of the main epithelial cell types present in human colon as well as co-developing mesenchymal cells. Omission of BMP (or addition of the BMP inhibitor NOGGIN) during this critical patterning period resulted in the formation of human intestinal organoids (HIOs). HIOs and HCOs morphologically and molecularly resemble human developing small intestine and colon, respectively. Despite the utility of HIOs and HCOs for studying human intestinal development, the generation of HIOs and HCOs is challenging. This paper presents methods for generating, maintaining, and characterizing HIOs and HCOs. In addition, the critical steps in the protocol and troubleshooting recommendations are provided.

Here, detailed methods for generating, maintaining, and characterizing human pluripotent stem cell-derived small intestinal and colonic organoids are described. These methods are designed to improve reproducibility, expand scalability, and decrease the working time required for plating and passaging of organoids.

Intestinal regional specification describes a process through which unique morphology and function are imparted to defined areas of the developing ...

Developmental Biology

Human Colonoid Monolayers to Study Interactions Between Pathogens, Commensals, and Host Intestinal Epithelium

Human 3-dimensional (3D) enteroid or colonoid cultures derived from crypt base stem cells are currently the most advanced ex vivo model of the intestinal epithelium. Due to their closed structures and significant supporting extracellular matrix, 3D cultures are not ideal for host-pathogen studies. Enteroids or colonoids can be grown as epithelial monolayers on permeable tissue culture membranes to allow manipulation of both luminal and basolateral cell surfaces and accompanying fluids. This enhanced luminal surface accessibility facilitates modeling bacterial-host epithelial interactions such as the mucus-degrading ability of enterohemorrhagic E. coli (EHEC) on colonic epithelium. A method for 3D culture fragmentation, monolayer seeding, and transepithelial electrical resistance (TER) measurements to monitor the progress towards confluency and differentiation are described. Colonoid monolayer differentiation yields secreted mucus that can be studied by the immunofluorescence or immunoblotting techniques. More generally, enteroid or colonoid monolayers enable a physiologically-relevant platform to evaluate specific cell populations that may be targeted by pathogenic or commensal microbiota.

Here, we present a protocol to culture human enteroid or colonoid monolayers that have intact barrier function to study host epithelial-microbiota interactions at the cellular and biochemical level.

Human 3-dimensional (3D) enteroid or colonoid cultures derived from crypt base stem cells are currently the most advanced ex vivo model of the intestinal ...

Co-Culture of Murine Small Intestine Epithelial Organoids with Innate Lymphoid Cells

Complex co-cultures of organoids with immune cells provide a versatile tool for interrogating the bi-directional interactions that underpin the delicate balance of mucosal homeostasis. These 3D, multi-cellular systems offer a reductionist model for addressing multi-factorial diseases and resolving technical difficulties that arise when studying rare cell types such as tissue-resident innate lymphoid cells (ILCs). This article describes a murine system that combines small intestine organoids and small intestine lamina propria derived helper-like type-1 ILCs (ILC1s), which can be readily extended to other ILC or immune populations. ILCs are a tissue-resident population that is particularly enriched in the mucosa, where they promote homeostasis and rapidly respond to damage or infection. Organoid co-cultures with ILCs have already begun shedding light on new epithelial-immune signaling modules in the gut, revealing how different ILC subsets impact intestinal epithelial barrier integrity and regeneration. This protocol will enable further investigations into reciprocal interactions between epithelial and immune cells, which hold the potential to provide new insights into the mechanisms of mucosal homeostasis and inflammation.

This protocol offers detailed instructions for establishing murine small intestine organoids, isolating type-1 innate lymphoid cells from the murine small intestine lamina propria, and establishing 3-dimensional (3D) co-cultures between both cell types to study bi-directional interactions between intestinal epithelial cells and type-1 innate lymphoid cells.

Complex co-cultures of organoids with immune cells provide a versatile tool for interrogating the bi-directional interactions that underpin the delicate ...

Establishment of a 2D Monolayer from 3D Bovine Ileal Enteroid Culture

Generation of a Bovine Primary Enteroid-Derived Two-Dimensional Monolayer Culture System for Applications in Translational Biomedical Research

Organoid cell culture systems can recapitulate the complexity observed in tissues, making them useful in studying host-pathogen interactions, evaluating drug efficacy and toxicity, and tissue bioengineering. However, applying these models for the described reasons may be limited because of the three-dimensional (3D) nature of these models. For example, using 3D enteroid culture systems to study digestive diseases is challenging due to the inaccessibility of the intestinal lumen and its secreted substances. Indeed, stimulation of 3D organoids with pathogens requires either luminal microinjection, mechanical disruption of the 3D structure, or generation of apical-out enteroids. Moreover, these organoids cannot be co-cultured with immune and stromal cells, limiting in-depth mechanistic analysis into pathophysiological dynamics. To circumvent this, we optimized a bovine primary cell two-dimensional (2D) enteroid-derived monolayer culture system, allowing co-culture with other relevant cell types. Ileal crypts isolated from healthy adult cattle were cultured to generate 3D organoids that were cryopreserved for future use. A 2D monolayer was created using revived 3D enteroids that were passaged and disrupted to yield single cells, which were seeded on basement membrane extract-coated transwell cell culture inserts, thereby exposing their apical surface. The intestinal monolayer polarity, cellular differentiation, and barrier function were characterized using immunofluorescence microscopy and measuring transepithelial electrical resistance. Stimulation of the apical surface of the monolayer revealed the expected functionality of the monolayer, as demonstrated by cytokine secretion from both apical and basal compartments. The described 2D enteroid-derived monolayer model holds great promise in investigating host-pathogen interactions and intestinal physiology, drug development, and regenerative medicine.

Author Spotlight: Advanced Enteroid Model for Studying Host-Pathogen Interactions 

Enteroids are emerging as a novel model for studying tissue physiology and pathophysiology, drug development, and regenerative medicine. Here, we describe a bovine primary cell 2D enteroid-derived culture system that permits co-culture with relevant tissue cell types. This model offers a translational advantage for gastrointestinal research modeling.

Organoid cell culture systems can recapitulate the complexity observed in tissues, making them useful in studying host-pathogen interactions, evaluating ...

Organoid-Derived Epithelial Monolayer: A Clinically Relevant In Vitro Model for Intestinal Barrier Function

In the past, intestinal epithelial model systems were limited to transformed cell lines and primary tissue. These model systems have inherent limitations as the former do not faithfully represent original tissue physiology, and the availability of the latter is limited. Hence, their application hampers fundamental and drug development research. Adult stem-cell-based organoids (henceforth referred to as organoids) are miniatures of normal or diseased epithelial tissue from which they are derived. They can be established very efficiently from different gastrointestinal (GI) tract regions, have long-term expandability, and simulate tissue- and patient-specific responses to treatments in vitro. Here, the establishment of intestinal organoid-derived epithelial monolayers has been demonstrated along with methods to measure epithelial barrier integrity, permeability and transport,&#160;antimicrobial protein secretion, as well as histology. Moreover, intestinal organoid-derived monolayers can be enriched with proliferating stem and transit-amplifying cells as well as with key differentiated epithelial cells. Therefore, they represent a model system that can be tailored to study the effects of compounds on target cells and their mode of action. Although organoid cultures are technically more demanding than cell lines, once established, they can reduce failures in the later stages of drug development as they truly represent in vivo epithelium complexity and interpatient heterogeneity.

Here, we describe the preparation of human organoid-derived intestinal epithelial monolayers for studying intestinal barrier function, permeability, and transport. As organoids represent original epithelial tissue response to external stimuli, these models combine the advantages of expandability of cell lines and the relevance and complexity of primary tissue.

In the past, intestinal epithelial model systems were limited to transformed cell lines and primary tissue. These model systems have inherent limitations ...

Biology

Generation of Murine Primary Colon Epithelial Monolayers from Intestinal Crypts

The intestinal epithelium is comprised of a single layer of cells that act as a barrier between the gut lumen and the interior of the body. Disruption in the continuity of this barrier can result in inflammatory disorders such as inflammatory bowel disease. One of the limitations in the study of intestinal epithelial biology has been the lack of primary cell culture models, which has obliged researchers to use model cell lines derived from carcinomas. The advent of three dimensional (3D) enteroids has given epithelial biologists a powerful tool to generate primary cell cultures, nevertheless, these structures are embedded in extracellular matrix and lack the maturity characteristic of differentiated intestinal epithelial cells. Several techniques to generate intestinal epithelial monolayers have been published, but most are derived from established 3D enteroids making the process laborious and expensive. Here we describe a protocol to generate primary epithelial colon monolayers directly from murine intestinal crypts. We also detail experimental approaches that can be used with this model such as the generation of confluent cultures on permeable filters, confluent monolayer for scratch wound healing studies and sparse and confluent monolayers for immunofluorescence analysis.

In this protocol, we describe how to generate murine primary epithelial colon monolayers directly from intestinal crypts. We provide experimental approaches to generate confluent monolayers on permeable filters, confluent monolayers for scratch wound healing and biochemical studies, and sparse and confluent monolayers for immunofluorescence analysis.

The intestinal epithelium is comprised of a single layer of cells that act as a barrier between the gut lumen and the interior of the body. Disruption in ...

Epithelial Effects of Intestinal Inflammation on Established Murine Colonoids

Studying the Epithelial Effects of Intestinal Inflammation In Vitro on Established Murine Colonoids

The intestinal epithelium plays an essential role in human health, providing a barrier between the host and the external environment. This highly dynamic cell layer provides the first line of defense between microbial and immune populations and helps to modulate the intestinal immune response. Disruption of the epithelial barrier is a hallmark of inflammatory bowel disease (IBD) and is of interest for therapeutic targeting. The 3-dimensional colonoid culture system is an extremely useful in vitro model for studying intestinal stem cell dynamics and epithelial cell physiology in IBD pathogenesis. Ideally, establishing colonoids from the inflamed epithelial tissue of animals would be most beneficial in assessing the genetic and molecular influences on disease. However, we have shown that in vivo epithelial changes are not necessarily retained in colonoids established from mice with acute inflammation. To address this limitation, we have developed a protocol to treat colonoids with a cocktail of inflammatory mediators that are typically elevated during IBD. While this system can be applied ubiquitously to various culture conditions, this protocol emphasizes treatment on both differentiated colonoids and 2-dimensional monolayers derived from established colonoids. In a traditional culture setting, colonoids are enriched with intestinal stem cells, providing an ideal environment to study the stem cell niche. However, this system does not allow for an analysis of the features of intestinal physiology, such as barrier function. Further, traditional colonoids do not offer the opportunity to study the cellular response of terminally differentiated epithelial cells to proinflammatory stimuli. The methods presented here provide an alternative experimental framework to address these limitations. The 2-dimensional monolayer culture system also offers an opportunity for therapeutic drug screening ex vivo. This polarized layer of cells can be treated with inflammatory mediators on the basal side of the cell and concomitantly with putative therapeutics apically to determine their utility in IBD treatment.

Author Spotlight: Studying the Epithelial Effects of Intestinal Inflammation In Vitro on Established Murine Colonoids  

We describe a protocol detailing the isolation of murine colonic crypts for the development of 3-dimensional colonoids. The established colonoids can then be terminally differentiated to reflect the cellular composition of the host epithelium prior to receiving an inflammatory challenge or being directed to establish an epithelial monolayer.

The intestinal epithelium plays an essential role in human health, providing a barrier between the host and the external environment. This highly dynamic ...

Generation of hiPSC-Derived Intestinal Organoids for Developmental and Disease Modelling Applications

hiPSC-derived intestinal organoids are epithelial structures that self-assemble from differentiated cells into complex 3D structures, representative of the human intestinal epithelium, in which they exhibit crypt/villus-like structures. Here, we describe the generation of hiPSC-derived intestinal organoids by the stepwise differentiation of hiPSCs into definitive endoderm, which is then posteriorized to form hindgut epithelium before being transferred into 3D culture conditions. The 3D culture environment consists of extracellular matrix (ECM) (e.g., Matrigel or other compatible ECM) supplemented with SB202190, A83-01, Gastrin, Noggin, EGF, R-spondin-1 and CHIR99021. Organoids undergo passaging every 7 days, where they are mechanically disrupted before transfer to fresh extracellular matrix and allowed to expand. QPCR and immunocytochemistry confirm that hiPSC-derived intestinal organoids contain mature intestinal epithelial cell types including goblet cells, Paneth cells and enterocytes. Additionally, organoids show evidence of polarization by expression of villin localized on the apical surface of epithelial cells.
The resulting organoids can be used to model human intestinal development as well as numerous human intestinal diseases including inflammatory bowel disease. To model intestinal inflammation, organoids can be exposed to inflammatory mediators such as TNF-&#945;, TGF-&#946;, and bacterial LPS. Organoids exposed to proinflammatory cytokines display an inflammatory and fibrotic phenotype in response. Pairing of healthy versus hiPSCs derived from patients with IBD may be useful in understanding mechanisms driving IBD. This may reveal novel therapeutic targets and novel biomarkers to assist in early disease diagnosis.

This protocol allows for the differentiation of human pluripotent cells into intestinal organoids. The protocol mimics normal human development by differentiating cells into a population of definitive endoderm, hindgut endoderm and then intestinal epithelium. This makes the protocol suitable for studying both intestinal development as well as disease modelling applications.

hiPSC-derived intestinal organoids are epithelial structures that self-assemble from differentiated cells into complex 3D structures, representative of ...

Two-dimensional Porcine Intestinal Organoids Reflecting the Physiological Properties of Native Gut

The gastrointestinal tract (GIT) serves both in the digestion of food and the uptake of nutrients but also as a protective barrier against pathogens. Traditionally, research in this area has relied on animal experiments, but there's a growing demand for alternative methods that adhere to the 3R principles-replace, reduce, and refine. Porcine organoids have emerged as a promising tool, offering a more accurate in vitro replication of the in vivo conditions than traditional cell models. One major challenge with intestinal organoids is their inward-facing apical surface and outward-facing basolateral surface. This limitation can be overcome by creating two-dimensional (2D) organoid layers on transwell inserts (from here on referred to as insert(s)), providing access to both surfaces. In this study, we successfully developed two-dimensional cultures of porcine jejunum and colon organoids. The cultivation process involves two key phases: First, the formation of a cellular monolayer, followed by the differentiation of the cells using tailored media. Cellular growth is tracked by measuring transepithelial electrical resistance, which stabilizes by day 8 for colon organoids and day 16 for jejunum organoids. After a 2-day differentiation phase, the epithelium is ready for analysis. To quantify and track active electrogenic transport processes, such as chloride secretion, we employ the Ussing chamber technique. This method allows for real-time measurement and detailed characterization of epithelial transport processes. This innovative in vitro model, combined with established techniques like the Ussing chamber, provides a robust platform for physiologically characterizing the porcine GIT within the 3R framework. It also opens opportunities for investigating pathophysiological mechanisms and developing potential therapeutic strategies.

This study outlines a protocol for generating 2D monolayers of porcine organoids derived from the small and large intestines. The growth of these monolayers is marked by increasing TEER values, indicating robust epithelial integrity. Additionally, these monolayers exhibit physiological secretory responses in Ussing chamber experiments following the application of forskolin.

The gastrointestinal tract (GIT) serves both in the digestion of food and the uptake of nutrients but also as a protective barrier against pathogens. ...