This work was supported by an Alfred P. Sloan Research Fellowship (to C.-F.C.) and an NIH R01 grant (5R01GM098026-05 to C.-F.C.). We thank David Crowe for access to the advanced infrared imaging system.

NOTE: EMSAs using fluorescently labeled DNA probes or other forms of labeled DNA share the same protocols for protein or cell extract preparation, protein-DNA binding reaction, and PAGE gel preparation and running (Figure 1A). The key differences are DNA labeling procedures, post-run gel processing steps, and detection methods.
1. Gel Preparation
<ol>
	<li>Prepare 5% native polyacrylamide gel containing 0.5x&#160;TBE (45 mM Tris-Borate, 1 mM EDTA) and 2.5% glycerol, using a mini protein gel system (8.3 cm width x 7.3 cm length x 0.75 mm thickness).
	<ol>
		<li>To prepare 30 mL&#160;of gel solution for 4 gels, mix 5 mL of 30% Acrylamide/Bis (37.5:1), 3 mL&#160;of 5x TBE (0.45 M Tris-Borate, 10 mM EDTA), 1.5 mL of 50% Glycerol, 300 &#181;L of 10% Ammonium Persulfate, 15 &#181;L&#160;of TEMED, and 20.2 mL of ddH2O thoroughly. 
		NOTE: Acrylamide is harmful and toxic, handle with appropriate personal protective equipment.</li>
	</ol>
	</li>
	<li>Cast the gel solution immediately. After polymerization, wrap the gels in clear plastic wrap pre-wetted with 0.5x TBE and store them at 4 &#176;C.</li>
</ol>
2. Preparation of Infrared Fluorescent Dye-labeled Probes
NOTE: Keep the infrared fluorescent dye-labeled oligonucleotides away from light as much as possible during preparation, storage, and experiments.
<ol>
	<li>Design and order oligonucleotides.
	<ol>
		<li>Design long oligonucleotide for ~51-mers. 
		NOTE: The long oligonucleotide sequence of the LIM-4/SOX-2 probe is TATCATATCTATTCTATGATTAAATACCTATTCATTTCAAAATCTTCTCCC. Long oligonucleotides do not require PAGE or HPLC purification.</li>
		<li>Design complementary short oligonucleotides for ~14-mers with infrared fluorescent dye modification at the 5&#39; terminus (5&#39;Dye) and a melting temperature above 37 &#176;C. 
		NOTE: The short oligonucleotide sequence of the LIM-4/SOX-2 probe is 5&#39;Dye-GGGAGAAGATTTTG. The minimum synthesis scale of 5&#39;Dye-labeled short oligonucleotides is 100 nM. Therefore, the oligonucleotides require HPLC purification.</li>
	</ol>
	</li>
	<li>Resuspend oligonucleotides in 1x Tris-EDTA buffer (TE: 10 mM Tris-HCl, pH 8.0; 1 mM EDTA) to final concentration of 100 &#181;M.</li>
	<li>Anneal Short (5&#39;Dye) and Long oligonucleotides.
	<ol>
		<li>Mix 0.6 &#181;L&#160;of 5&#39;Dye-Short oligo (100 &#181;M), 1.2 &#181;L&#160;of Long oligo (100 &#181;M), and 28.2 &#181;L&#160;of sodium chloride-Tris-EDTA buffer (STE: 100 mM NaCl;&#160;10 mM Tris-HCl, pH 8.0;&#160;1 mM EDTA) in a 1.5 mL&#160;tube.</li>
		<li>Place the tube in boiling water for 5 min. Turn off the heat source and let the water with the annealed oligos cool O/N in the dark.</li>
	</ol>
	</li>
	<li>Fill in the 5&#39; overhangs of annealed 5&#39;Dye-Short/Long oligos with Klenow DNA polymerase to make double stranded DNA probes.
	<ol>
		<li>Prepare the reaction by mixing 30 &#181;L&#160;of annealed short/long oligos with 5&#39;Dye tag, 8.5 &#181;L&#160;of 10x Klenow buffer, 1.7 &#181;L&#160;of 10 mM dNTPs, 1.7 &#181;L&#160;of Klenow (3&#39;-&#62;5&#39; exo-) (5 u/&#181;L), and 43.1 &#181;L&#160;of ddH2O in a 0.2 mL&#160;PCR tube.</li>
		<li>Incubate 60 min at 37 &#176;C in a PCR machine.</li>
		<li>Add 3.4 &#181;L&#160;0.5 M EDTA to stop the reaction and heat inactivate at 75 &#176;C for 20 min in a PCR machine.</li>
	</ol>
	</li>
	<li>Dilute filled-in probes (0.7 &#181;M) in STE for final concentration of 0.1 &#181;M.</li>
	<li>Store oligos at -20 &#176;C in the dark until ready to use. Oligos may be stored for up to a year in this condition. 
	NOTE: To generate DNA probes with mutant binding sites, mutant versions of long oligonucleotides are annealed with 5&#39;Dye-labeled short oligonucleotides, followed by fill-in of 5&#39; overhangs with Klenow. It has been shown that the probe with one strand labeled with an infrared fluorescent dye has only 30% intensity of the probe with both strands labeled with the dye. If signal intensity needs to be strengthened, long oligos of both strands are labeled with infrared fluorescent dyes at 5&#39; termini and annealed to make infrared fluorescent dye-labeled probes.</li>
</ol>
3. Preparation of Unlabeled/Cold Probes (Competitors)
Note: Long oligonucleotides of complementary sequences (Long and LongR) were annealed to make unlabeled probes for competition analysis with infrared fluorescent dye-labeled probes.
<ol>
	<li>Mix 20 &#181;L&#160;of 100 &#181;M Long, 20 &#181;L&#160;of 100 &#181;M LongR oligonucleotides, and 60 &#181;L&#160;of STE in a 1.5 mL&#160;tube.</li>
	<li>Place the tube in boiling water for 5 min, turn off the heat source and let the water with the annealed oligos cool overnight.</li>
</ol>
4. Binding Reaction and Electrophoresis
<ol>
	<li>Prepare 1 mL&#160;of 5x binding buffer by mixing 50 &#181;L&#160;of 1 M Tris-HCl, pH 7.5;&#160;10 &#181;L&#160;of 5 M NaCl;&#160;200 &#181;L&#160;of 1 M KCl, 5 &#181;L&#160;of 1 M MgCl2, 10 &#181;L&#160;of 0.5 M EDTA, pH 8.0;&#160;5 &#181;L&#160;of 1 M DTT;&#160;25 &#181;L&#160;of 10 mg/mL&#160;BSA, and 695 &#181;L&#160;of ddH2O. 
	NOTE: The 5x Binding Buffer can be aliquoted and stored at -20 &#176;C. Another point to consider is that different transcription factors will have different modifications to the binding buffer.</li>
	<li>Right before setting up binding reactions, pre-run the 5% native polyacrylamide gel in 0.5x TBE + 2.5% glycerol to remove all traces of ammonium persulfate at 80 V for 30&#160;- 60 min,&#160;or until the current no longer varies with time.</li>
	<li>Set up the binding reaction in final volume of 20 &#181;L.
	<ol>
		<li>Mix 4 &#181;L&#160;of 5x binding buffer, 80 - 200 ng purified protein A (in 50% glycerol, i.e., SOX-2), 1 &#181;L&#160;of 0.1 &#181;M Dye-conjugated probe (final concentration: 5 nM), and ddH2O.</li>
		<li>Optional: When cold probe competitors are required, add various concentrations (2x, 10x, 25x, 50x, 100x, etc.) of cold probes.</li>
		<li>Optional: When the interaction between proteins A and B (i.e., SOX-2 and LIM-4) is tested, add 80 - 200 ng purified protein B (in 50% glycerol,&#160;i.e., LIM-4).</li>
		<li>Optional: When nuclear extract preparation is used and specific binding of protein A is to be validated, add antibody specific to protein A (i.e., anti-6xHis, anti-FLAG, etc.).</li>
		<li>Incubate at R/T in dark for 15 min.</li>
	</ol>
	</li>
	<li>Load all of the binding reaction onto the gel and run the gel at 10 V/cm to desired distance.</li>
</ol>
5. Imaging
NOTE: The gel was scanned directly in the glass plates with an advanced infrared imaging system. Therefore, the gel can be resolved further and scanned repeatedly (Figures 1C and 2). A near-infrared fluorescent imaging system primarily for Western blots was also tested to scan the gel, but only the advanced infrared imaging system was able to scan the gel with good resolution. The methodology described is specific to a particular infrared imaging software, although other software packages may be used.
<ol>
	<li>Clean the bed of the scanner with ddH2O and dry well before scanning. Wipe dry the glass plates of the gel and place the plates containing the gel on the scanner bed.</li>
	<li>Open the infrared imaging software and go to the &#39;Acquire&#39; tab. When the thinner plate (1 mm) is placed on the scanner bed, use the settings of Channel: 700, Intensity: Auto, Resolution: 169 &#181;m, Quality: medium, and Focus offset: 1.5 mm. When the thicker plate (3 mm) is placed on the scanner bed, use the settings of Channel: 700, Intensity: Auto, Resolution: 84 &#181;m, Quality: medium, and Focus offset: 3.5 mm. Focus offset depends on the thickness of the glass plate.</li>
	<li>Select the area that the gel occupies on the scanner. Click &#39;Start&#39; to begin the scan.</li>
	<li>Repeat electrophoresis and scan additionally as necessary.</li>
</ol>

<ol>
	<li>Hellman, L. M., Fried, M. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Electrophoretic+mobility+shift+assay+(EMSA)+for+detecting+protein-nucleic+acid+interactions.">Electrophoretic mobility shift assay (EMSA) for detecting protein-nucleic acid interactions.</a> Nat Protoc. 2, 1849-1861 (2007).</li><li>Ludwig, L. B., Hughes, B. J., Schwartz, S. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Biotinylated+probes+in+the+electrophoretic+mobility+shift+assay+to+examine+specific+dsDNA,+ssDNA+or+RNA-protein+interactions.">Biotinylated probes in the electrophoretic mobility shift assay to examine specific dsDNA, ssDNA or RNA-protein interactions.</a> Nucleic Acids Res. 23, 3792-3793 (1995).</li><li>Engler-Blum, G., Meier, M., Frank, J., Muller, G. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Reduction+of+background+problems+in+nonradioactive+northern+and+Southern+blot+analyses+enables+higher+sensitivity+than+32P-based+hybridizations.">Reduction of background problems in nonradioactive northern and Southern blot analyses enables higher sensitivity than 32P-based hybridizations.</a> Anal Biochem. 210, 235-244 (1993).</li><li>Jing, D., Agnew, J., Patton, W. F., Hendrickson, J., Beechem, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+sensitive+two-color+electrophoretic+mobility+shift+assay+for+detecting+both+nucleic+acids+and+protein+in+gels.">A sensitive two-color electrophoretic mobility shift assay for detecting both nucleic acids and protein in gels.</a> Proteomics. 3, 1172-1180 (2003).</li><li>Alqadah, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Postmitotic+diversification+of+olfactory+neuron+types+is+mediated+by+differential+activities+of+the+HMG-box+transcription+factor+SOX-2.">Postmitotic diversification of olfactory neuron types is mediated by differential activities of the HMG-box transcription factor SOX-2.</a> EMBO J. 34, 2574-2589 (2015).</li><li>Jullien, N., Herman, J. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=LUEGO:+a+cost+and+time+saving+gel+shift+procedure.">LUEGO: a cost and time saving gel shift procedure.</a> Biotechniques. 51, 267-269 (2011).</li><li>Poulin-Laprade, D., Burrus, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Electrophoretic+Mobility+Shift+Assay+Using+Radiolabeled+DNA+Probes.">Electrophoretic Mobility Shift Assay Using Radiolabeled DNA Probes.</a> Methods Mol Biol. 1334, 1-15 (2015).</li><li>Ruscher, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+fluorescence+based+non-radioactive+electrophoretic+mobility+shift+assay.">A fluorescence based non-radioactive electrophoretic mobility shift assay.</a> J Biotechnol. 78, 163-170 (2000).</li><li>Pagano, J. M., Clingman, C. C., Ryder, S. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+approaches+to+monitor+protein-nucleic+acid+interactions+using+fluorescent+probes.">Quantitative approaches to monitor protein-nucleic acid interactions using fluorescent probes.</a> RNA. 17, 14-20 (2011).</li><li>Alqadah, A., Hsieh, Y. W., Chuang, C. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sox2+goes+beyond+stem+cell+biology.">Sox2 goes beyond stem cell biology.</a> Cell cycle. , (2016).</li><li>Larouche, K., Bergeron, M. J., Leclerc, S., Guerin, S. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Optimization+of+competitor+poly(dI-dC).poly(dI-dC)+levels+is+advised+in+DNA-protein+interaction+studies+involving+enriched+nuclear+proteins.">Optimization of competitor poly(dI-dC).poly(dI-dC) levels is advised in DNA-protein interaction studies involving enriched nuclear proteins.</a> Biotechniques. 20, 439-444 (1996).</li><li>Sorenson, A. E., Schaeffer, P. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In-gel+detection+of+biotin-protein+conjugates+with+a+green+fluorescent+streptavidin+probe.">In-gel detection of biotin-protein conjugates with a green fluorescent streptavidin probe.</a> Anal. Methods. 7, 2087-2092 (2015).</li><li>Onizuka, T., Endo, S., Hirano, M., Kanai, S., Akiyama, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Design+of+a+fluorescent+electrophoretic+mobility+shift+assay+improved+for+the+quantitative+and+multiple+analysis+of+protein-DNA+complexes.">Design of a fluorescent electrophoretic mobility shift assay improved for the quantitative and multiple analysis of protein-DNA complexes.</a> Biosci Biotechnol Biochem. 66, 2732-2734 (2002).</li><li>Steiner, S., Pfannschmidt, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fluorescence-based+electrophoretic+mobility+shift+assay+in+the+analysis+of+DNA-binding+proteins.">Fluorescence-based electrophoretic mobility shift assay in the analysis of DNA-binding proteins.</a> Methods Mol Biol. 479, 273-289 (2009).</li></ol>

The authors have nothing to disclose.

fEMSAs are an efficient tool to investigate protein-DNA interactions, and are an alternative to radioactive labeling of DNA. Fluorescent dyes such as infrared dyes are commercially available, and provide a safer and more environmentally friendly method compared to radioactive DNA labeling. EMSAs using infrared fluorescent dye-labeled oligonucleotides do not require postrun gel processing steps, and therefore save time and cost compared to other DNA labeling techniques. The time to detect bands using radioactive EMSAs can...

EMSAs are used to analyze interactions between DNA and proteins by using native PolyAcrylamide Gel Electrophoresis (PAGE) to resolve a mixture of a protein of interest and a labeled DNA probe containing potential target sites of the protein1. A DNA probe bound with protein will migrate slower compared with a free DNA probe, and is therefore retarded in its migration through a polyacrylamide matrix. Radiolabeling of DNA by 32P has been the predominant method for detection in EMSAs. Although the application of radiolabeling in biochemical research has been beneficial, methods of alternative DNA labeling with comparable sensitivity are being employed due to the health and safety risks associated with handling radioactivity. These alternative methods include conjugation of DNA with biotin2 or digoxigenin (DIG)3 (both of which are then detected by chemiluminescent systems), SYBR green staining of the PAGE gels4, or direct detection of DNA-fluorescent dye conjugates by scanning the gel5,6.
The resolved gels of EMSAs using radioactively labeled DNA probes require postrun processing through autoradiography films or a phosphorimager system to detect radioactive signals1,7. Gels of EMSAs using biotin-2 or DIG-conjugated3 DNA probes must also be processed and transferred onto a suitable membrane and then detected by chemiluminescence6. SYBR green staining of the gel requires postrun gel staining and a fluorescent scanner4. Since postrun gel processing steps are required for EMSAs using these DNA labeling techniques, the resolved gel can be assayed only once. In contrast, DNA probes labeled with fluorophores can be directly detected in the gel inside the glass plates by a scanner. Therefore, the DNA-protein interactions can be monitored and assayed several times at different time points during the run, which significantly reduces time and cost. The DNA-fluorescent dye conjugates that have been used for EMSAs include Cy36,8, Cy56,8, fluorescein9, and infrared fluorescent dyes4-6.
Transcriptional regulation requires protein-DNA interactions of transcription factors and their target genes. Coordination of these interactions generates diverse cell types from a common progenitor during animal development. An unbiased forward genetic screen identified a missense mutation, G73E, in the highly conserved HMG DNA-binding domain of the Caenorhabditis elegans transcription factor SOX-2. The mutation results in a cell identity transformation of AWB olfactory neurons into AWC olfactory neurons at molecular, morphological, and functional levels5,10. SOX-2 differentially regulates the terminal differentiation of AWB and AWC neurons by interacting with context-dependent partner transcription factors and respective DNA target sites5,10. SOX-2 partners with LIM-4 (LHX) in terminal AWB neuronal differentiation, while SOX-2 partners with CEH-36 (OTX/OTD) in terminal AWC neuronal differentiation. Luciferase reporter assays show that SOX-2 and mutant SOX-2G73E proteins have cooperative interactions with transcriptional cofactors LIM-4 and CEH-36 to activate a promoter expressed in AWB and AWC neurons. However, SOX-2 and mutant SOX-2G73E displayed differential activation properties of the promoter. To investigate the molecular basis of differential DNA binding activities of SOX-2 and SOX-2G73E, fEMSAs were performed with these proteins and their potential target sites.
First, a bioinformatics approach was taken to identify the biologically relevant DNA binding sequences within the 1 kb promoter region used in the luciferase assay. Since multiple potential SOX-2 binding sites were present throughout the promoter, we focused on predicted SOX-2 binding sites adjacent to putative CEH-36 or LIM-4 binding sites and evolutionarily conserved between various nematode species. These sequences were deleted or mutated, and subsequently tested in vivo for their activity to express GFP reporter transgenes in AWB or AWC neurons. Through this approach, we identified potential LIM-4/SOX-2 and CEH-36/SOX-2 adjacent target sites that are specifically required for the expression of GFP in AWB and AWC neurons, respectively5. We investigated the potential differences in the DNA binding of SOX-2 and SOX-2G73E using fEMSA with the identified LIM-4/SOX-2 and CEH-36/SOX-2 adjacent target sites. Our EMSA analysis showed that SOX-2G73E did not bind the DNA probe containing the LIM-4/SOX-2 adjacent target sites (required for gene expression in AWB) as efficiently as WT SOX-2 did. However, SOX-2 and SOX-2G73E had no difference in binding the DNA probe containing the CEH-36/SOX-2 adjacent target site (required for gene expression in AWC)5,10. Our fEMSA analyses provide mechanistic insight into the nature of the SOX-2G73E mutation in affecting specific DNA binding activity for the AWB-to-AWC cell identity transformation phenotype. Here, we describe an optimized protocol of fEMSA using purified 6xHis-SOX-2 or 6xHis-SOX-2G73E together with infrared fluorescent dye-labeled DNA probes containing the LIM-4/SOX-2 adjacent target sites as a case study to tackle an important biological question.

<table><tbody><tr><td>30% Acrylamide/Bis Solution, 37.5:1&amp;nbsp;</td><td>Bio-Rad</td><td>1610158</td><td>Acrylamide is harmful and toxic.</td></tr><tr><td>6x-His Epitope Tag Antibody (HIS.H8)</td><td>ThermoFisher</td><td>MA1-21315</td><td></td></tr><tr><td>Anti-Flag M2 antibody&amp;nbsp;</td><td>Sigma-Aldrich</td><td>F3165-.2MG</td><td></td></tr><tr><td>Bovine Serum Albumin (BSA) molecular biology grade</td><td>New England Biolabs</td><td>B9000S</td><td></td></tr><tr><td>5&#039;IRDye700-labeled DNA Oligos</td><td>Integrated DNA Technologies</td><td>Custom DNA oligo</td><td>These are referred to as &quot;5&#039;Dye-labeled or infrared fluorescent dye-labeled DNA oligos&quot; in the manuscript. The company will custom synthesize 5&#039; IRDye labeled-DNA oligonucleotides. Requires minimum 100&amp;nbsp;&amp;mu;M scale synthesis and HPLC purification.</td></tr><tr><td>Klenow Fragment (3&#039;--&gt;5&#039; exo-)</td><td>New England Biolabs</td><td>M0212S</td><td></td></tr><tr><td>LightShif Poly (dI-dC)</td><td>ThermoFisher</td><td>20148E</td><td></td></tr><tr><td>Mini-PROTEAN&amp;nbsp;Vertical Electrophoresis Cell&amp;nbsp;</td><td>Bio-Rad</td><td>1658000FC&amp;nbsp;</td><td>This is referred to as a &#039;mini protein gel system&#039; in the manuscript. Any electrophoretic system can be used as long as they are clear glass plates of less than 25 cm x 25 cm in size.</td></tr><tr><td>Odyssey CLx Infrared Imaging System</td><td>LI-COR Biotechnology</td><td>Odyssey CLx Infrared Imagng System</td><td>This is referred to as an &#039;advanced infrared imaging system&#039; in the manuscript.</td></tr><tr><td>Odyssey Fc Imaging System&amp;nbsp;</td><td>LI-COR Biotechnology</td><td>Odyssey Fc Dual-Mode Imaging System</td><td>This is referred as a &#039;near-infrared fluorescent imaging system primarily for Western blots&#039; in the manuscript.</td></tr><tr><td>Image Studio software (version 4.0)</td><td>LI-COR Biotechnology</td><td>Image Studio software&amp;nbsp;</td><td>This is referred to as a &#039;particular imaging software&#039; in the manuscript.&amp;nbsp;</td></tr><tr><td>Orange G</td><td>Sigma-Aldrich</td><td>O3756-25G</td><td></td></tr><tr><td>6x Orange loading dye</td><td></td><td></td><td>0.25% Orange G; 30% Glycerol</td></tr><tr><td>0.5x TBE</td><td></td><td></td><td>45 mM Tris-Borate; 1 mM EDTA</td></tr><tr><td>1x TE</td><td></td><td></td><td>10 mM Tris-HCl, pH 8.0; 1 mM EDTA</td></tr><tr><td>1x STE</td><td></td><td></td><td>100 mM NaCl; 10 mM Tris-HCl, pH 8.0; 1 mM EDTA</td></tr><tr><td>5x Binding Buffer</td><td></td><td></td><td>50 mM Tris-HCl, pH 7.5; 50 mM NaCl; 200 mM KCl; 5 mM MgCl&lt;sub&gt;2&lt;/sub&gt;; 5 mM EDTA, pH 8.0; 5 mM DTT; 250 &amp;#956;g/mL BSA</td></tr></tbody></table>

an optimized protocol for electrophoretic mobility shift assay using infrared fluorescent dye-labeled oligonucleotides

Electrophoretic Mobility Shift Assays (EMSA) are an instrumental tool to characterize the interactions between proteins and their target DNA sequences. Radioactivity has been the predominant method of DNA labeling in EMSAs. However, recent advances in fluorescent dyes and scanning methods have prompted the use of fluorescent tagging of DNA as an alternative to radioactivity for the advantages of easy handling, saving time, reducing cost, and improving safety. We have recently used fluorescent EMSA (fEMSA) to successfully address an important biological question. Our fEMSA analysis provides mechanistic insight into the effect of a missense mutation, G73E, in the highly conserved HMG transcription factor SOX-2 on olfactory neuron type diversification. We found that mutant SOX-2G73E protein alters specific DNA binding activity, thereby causing olfactory neuron identity transformation. Here, we present an optimized and cost-effective step-by-step protocol for fEMSA using infrared fluorescent dye-labeled oligonucleotides containing the LIM-4/SOX-2 adjacent target sites and purified SOX-2 proteins (WT and mutant SOX-2G73E proteins) as a biological example.

Orange G loading dye (6x: 0.12 g Orange G in 100 mL&#160;30% Glycerol) can be added to the binding reaction prior to loading to visualize the progress of the electrophoresis. Other loading dyes including bromophenol blue will be detected during scanning and therefore interfere with image analysis (Figure 1B).
In some instances of EMSAs, especially if nuclear extract preparation is used, poly deoxyinosinic-deoxyc...

Watch this Scientific Journal Video about An Optimized Protocol for Electrophoretic Mobility Shift Assay Using Infrared Fluorescent Dye-labeled Oligonucleotides at JoVE.com

An Optimized Protocol for Electrophoretic Mobility Shift Assay Using Infrared Fluorescent Dye-labeled Oligonucleotides

We describe here an optimized protocol of fluorescent Electrophoretic Mobility Shift Assays (fEMSA) using purified SOX-2 proteins together with infrared fluorescent dye-labeled DNA probes as a case study to tackle an important biological question.

Electrophoretic Mobility Shift Assays (EMSA) are an instrumental tool to characterize the interactions between proteins and their target DNA sequences. ...

an-optimized-protocol-for-electrophoretic-mobility-shift-assay-using

Universidad San Sebastian

Research

JoVE Journal

Biochemistry

15.5K Views.  University of Illinois at Chicago. We describe here an optimized protocol of fluorescent Electrophoretic Mobility Shift Assays (fEMSA) using purified SOX-2 proteins together with infrared fluorescent dye-labeled DNA probes as a case study to tackle an important biological question.

Video: An Optimized Protocol for Electrophoretic Mobility Shift Assay Using Infrared Fluorescent Dye-labeled Oligonucleotides

Horizontal Gel Electrophoresis for Enhanced Detection of Protein-RNA Complexes

Native polyacrylamide gel electrophoresis is a fundamental tool of molecular biology that has been used extensively for the biochemical analysis of RNA-protein interactions. These interactions have been traditionally analyzed with polyacrylamide gels generated between two glass plates and samples electrophoresed vertically. However, polyacrylamide gels cast in trays and electrophoresed horizontally offers several advantages. For example, horizontal gels used to analyze complexes between fluorescent RNA substrates and specific proteins can be imaged multiple times as electrophoresis progresses. This provides the unique opportunity to monitor RNA-protein complexes at several points during the experiment. In addition, horizontal gel electrophoresis makes it possible to analyze many samples in parallel. This can greatly facilitate time course experiments as well as analyzing multiple reactions simultaneously to compare different components and conditions. Here we provide a detailed protocol for generating and using horizontal native gel electrophoresis for analyzing RNA-Protein interactions.

Native polyacrylamide gel electrophoresis is a fundamental tool for analyzing RNA-protein interactions. Traditionally most experiments have used vertical gels. However, horizontal gels provide several advantages, such as the opportunity to monitor complexes during electrophoresis. We provide a detailed protocol for generating and using horizontal native gel electrophoresis.

Native polyacrylamide gel electrophoresis is a fundamental tool of molecular biology that has been used extensively for the biochemical analysis of ...

DNA Polymerase Activity Assay Using Near-infrared Fluorescent Labeled DNA Visualized by Acrylamide Gel Electrophoresis

For any enzyme, robust, quantitative methods are required for characterization of both native and engineered enzymes. For DNA polymerases, DNA synthesis can be characterized using an in vitro DNA synthesis assay followed by polyacrylamide gel electrophoresis. The goal of this assay is to quantify synthesis of both natural DNA and modified DNA (M-DNA). These approaches are particularly useful for resolving oligonucleotides with single nucleotide resolution, enabling observation of individual steps during enzymatic oligonucleotide synthesis. These methods have been applied to the evaluation of an array of biochemical and biophysical properties such as the measurement of steady-state rate constants of individual steps of DNA synthesis, the error rate of DNA synthesis, and DNA binding affinity. By using modified components including, but not limited to, modified nucleoside triphosphates (NTP), M-DNA, and/or mutant DNA polymerases, the relative utility of substrate-DNA polymerase pairs can be effectively evaluated. Here, we detail the assay itself, including the changes that must be made to accommodate nontraditional primer DNA labeling strategies such as near-infrared fluorescently labeled DNA. Additionally, we have detailed crucial technical steps for acrylamide gel pouring and running, which can often be technically challenging.

This protocol describes the characterization of DNA polymerase synthesis of modified DNA through observation of changes to near-infrared fluorescently labeled DNA using gel electrophoresis and gel imaging. Acrylamide gels are used for high resolution imaging of the separation of short nucleic acids, which migrate at different rates depending on size.

For any enzyme, robust, quantitative methods are required for characterization of both native and engineered enzymes. For DNA polymerases, DNA synthesis ...

DNA Electrophoresis Using Thiazole Orange Instead of Ethidium Bromide or Alternative Dyes

DNA gel electrophoresis using agarose is a common tool in molecular biology laboratories, allowing separation of DNA fragments by size. After separation, DNA is visualized by staining. This article demonstrates how to use thiazole orange to stain DNA. Thiazole orange compares favorably to common staining methods, in that it is sensitive, inexpensive, excitable with UV or blue light (to prevent sample damage), and safer than ethidium bromide. Labs already equipped to run DNA electrophoresis experiments using ethidium bromide can generally switch dyes with no additional changes to existing protocols, using UV light for detection. Blue-light detection to avoid sample damage can additionally be achieved with a blue-light source and emission filter. Labs already equipped for blue-light detection can simply switch dyes with no additional changes to existing protocols.

Here, we present a protocol to use thiazole orange for the detection of DNA in gel electrophoresis experiments. The use of thiazole orange allows elimination of ethidium bromide, and fluorescence detection can be achieved with either UV or blue light.

DNA gel electrophoresis using agarose is a common tool in molecular biology laboratories, allowing separation of DNA fragments by size. After separation, ...

Assays for DNA Enzymes Using Synthetic Oligonucleotides

Using Modified Synthetic Oligonucleotides to Assay Nucleic Acid-Metabolizing Enzymes

The availability of a range of modified synthetic oligonucleotides from commercial vendors has allowed the development of sophisticated assays to characterize diverse properties of nucleic acid metabolizing enzymes that can be run in any standard molecular biology lab. The use of fluorescent labels has made these methods accessible to researchers with standard PAGE electrophoresis equipment and a fluorescent-enabled imager, without using radioactive materials or requiring a lab designed for the storage and preparation of radioactive materials, i.e., a Hot Lab. The optional addition of standard modifications such as phosphorylation can simplify assay setup, while the specific incorporation of modified nucleotides that mimic DNA damages or intermediates can be used to probe specific aspects of enzyme behavior. Here, the design and execution of assays to interrogate several aspects of DNA processing by enzymes using commercially available synthetic oligonucleotides are demonstrated. These include the ability of ligases to join or nucleases to degrade different DNA and RNA hybrid structures, differential cofactor usage by the DNA ligase, and evaluation of the DNA-binding capacity of enzymes. Factors to consider when designing synthetic nucleotide substrates are discussed, and a basic set of oligonucleotides that can be used for a range of nucleic acid ligase, polymerase, and nuclease enzyme assays are provided.

Author Spotlight: Characterizing Novel Enzymes from Extremophiles and Common Pathogens to Understand DNA Repair and Replication

Here, a protocol for assaying nucleic acid metabolizing enzymes is presented, using examples of ligase, nuclease, and polymerase enzymes. The assay utilizes fluorescently labeled and unlabeled oligonucleotides that can be combined to form duplexes mimicking RNA and/or DNA damages or pathway intermediates, allowing for the characterization of enzyme behavior.

The availability of a range of modified synthetic oligonucleotides from commercial vendors has allowed the development of sophisticated assays to ...

Comprehensive Protocol for Cell Identification and Metabolic Analysis Using OPTIR-FISH

Optical Photothermal Infrared-Fluorescence In Situ Hybridization (OPTIR-FISH)

Understanding the metabolic activities of individual cells within complex communities is critical for unraveling their role in human disease. Here, we present a comprehensive protocol for simultaneous cell identification and metabolic analysis with the OPTIR-FISH platform by combining rRNA-tagged FISH probes and isotope-labeled substrates. Fluorescence imaging provides cell identification by the specific binding of rRNA-tagged FISH probes, while OPTIR imaging provides metabolic activities within single cells by isotope-induced red shift on OPTIR spectra. Using bacteria cultured with 13C-glucose as a test bed, the protocol outlines microbial culture with isotopic labeling, fluorescence in situ hybridization (FISH), sample preparation, optimization of the OPTIR-FISH imaging setup, and data acquisition. We also demonstrate how to perform image analysis and interpret spectral data at the single-cell level with high throughput. This protocol&#39;s standardized and detailed nature will greatly facilitate its adoption by researchers from diverse backgrounds and disciplines within the broad single-cell metabolism research community.

Author Spotlight: Integrated OPTIR-FISH for Single-Cell Metabolic and Identity Analysis in Complex Environments

Here, we present a protocol using optical photothermal infrared-fluorescence in situ hybridization (OPTIR-FISH), also known as mid-infrared photothermal-FISH (MIP-FISH), to identify individual cells and understand their metabolism. This methodology can be applied broadly for diverse applications, including mapping cellular metabolism with single-cell resolution.

Understanding the metabolic activities of individual cells within complex communities is critical for unraveling their role in human disease. Here, we ...

Bioengineering

Electrophoretic Mobility Shift Assay (EMSA) for the Study of RNA-Protein Interactions: The IRE/IRP Example

RNA/protein interactions are critical for post-transcriptional regulatory pathways. Among the best-characterized cytosolic RNA-binding proteins are iron regulatory proteins, IRP1 and IRP2. They bind to iron responsive elements (IREs) within the untranslated regions (UTRs) of several target mRNAs, thereby controlling the mRNAs translation or stability. IRE/IRP interactions have been widely studied by EMSA. Here, we describe the EMSA protocol for analyzing the IRE-binding activity of IRP1 and IRP2, which can be generalized to assess the activity of other RNA-binding proteins as well. A crude protein lysate containing an RNA-binding protein, or a purified preparation of this protein, is incubated with an excess of32 P-labeled RNA probe, allowing for complex formation. Heparin is added to preclude non-specific protein to probe binding. Subsequently, the mixture is analyzed by non-denaturing electrophoresis on a polyacrylamide gel. The free probe migrates fast, while the RNA/protein complex exhibits retarded mobility; hence, the procedure is also called &#8220;gel retardation&#8221; or &#8220;bandshift&#8221; assay. After completion of the electrophoresis, the gel is dried and RNA/protein complexes, as well as free probe, are detected by autoradiography. The overall goal of the protocol is to detect and quantify IRE/IRP and other RNA/protein interactions. Moreover, EMSA can also be used to determine specificity, binding affinity, and stoichiometry of the RNA/protein interaction under investigation.

Electrophoretic Mobility Shift Assay EMSA for the Study of RNA-Protein Interactions: The IRE/IRP Example

Here we present a protocol to analyze RNA/protein interactions. The electrophoretic mobility shift assay (EMSA) is based on the differential migration of RNA/protein complexes and free RNA during native gel electrophoresis. By using a radiolabeled RNA probe, RNA/protein complexes can be visualized by autoradiography.

RNA/protein interactions are critical for post-transcriptional regulatory pathways. Among the best-characterized cytosolic RNA-binding proteins are iron ...

Biology

Screening for Functional Non-coding Genetic Variants Using Electrophoretic Mobility Shift Assay (EMSA) and DNA-affinity Precipitation Assay (DAPA)

Population and family-based genetic studies typically result in the identification of genetic variants that are statistically associated with a clinical disease or phenotype. For many diseases and traits, most variants are non-coding, and are thus likely to act by impacting subtle, comparatively hard to predict mechanisms controlling gene expression. Here, we describe a general strategic approach to prioritize non-coding variants, and screen them for their function. This approach involves computational prioritization using functional genomic databases followed by experimental analysis of differential binding of transcription factors (TFs) to risk and non-risk alleles. For both electrophoretic mobility shift assay (EMSA) and DNA affinity precipitation assay (DAPA) analysis of genetic variants, a synthetic DNA oligonucleotide (oligo) is used to identify factors in the nuclear lysate of disease or phenotype-relevant cells. For EMSA, the oligonucleotides with or without bound nuclear factors (often TFs) are analyzed by non-denaturing electrophoresis on a tris-borate-EDTA (TBE) polyacrylamide gel. For DAPA, the oligonucleotides are bound to a magnetic column and the nuclear factors that specifically bind the DNA sequence are eluted and analyzed through mass spectrometry or with a reducing sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) followed by Western blot analysis. This general approach can be widely used to study the function of non-coding genetic variants associated with any disease, trait, or phenotype.

Screening for Functional Non-coding Genetic Variants Using Electrophoretic Mobility Shift Assay EMSA and DNA-affinity Precipitation Assay DAPA

We present a strategic plan and protocol for identifying non-coding genetic variants affecting transcription factor (TF) DNA binding. A detailed experimental protocol is provided for electrophoretic mobility shift assay (EMSA) and DNA affinity precipitation assay (DAPA) analysis of genotype-dependent TF DNA binding.

Population and family-based genetic studies typically result in the identification of genetic variants that are statistically associated with a clinical ...

Synthesis of Wavelength-shifting DNA Hybridization Probes by Using Photostable Cyanine Dyes

In this protocol, we demonstrate a method for the synthesis of 2&#39;-alkyne modified deoxyribonucleic acid (DNA) strands by automated solid phase synthesis using standard phosphoramidite chemistry. Oligonucleotides are post-synthetically labeled by two new photostable cyanine dyes using copper-catalyzed click-chemistry. The synthesis of both donor and acceptor dye is described and is performed in three consecutive steps. With the DNA as the surrounding architecture, these two dyes undergo an energy transfer when they are brought into close proximity by hybridization. Therefore, annealing of two single stranded DNA strands is visualized by a change of fluorescence color. This color change is characterized by fluorescence spectroscopy but can also be directly observed by using a handheld ultraviolet (UV) lamp. The concept of a dual fluorescence color readout makes these oligonucleotide probes excellent tools for molecular imaging especially when the described photostable dyes are used. Thereby, photobleaching of the imaging probes is prevented, and biological processes can be observed in real time for a longer time period.

Photostable cyanine dyes are attached to oligonucleotides to monitor hybridization by energy transfer.

In this protocol, we demonstrate a method for the synthesis of 2&#39;-alkyne modified deoxyribonucleic acid (DNA) strands by automated solid phase ...

Electrophoretic Mobility Shift Assay (EMSA)

The electrophoretic mobility shift assay (EMSA) is a biochemical procedure used to elucidate binding between proteins and nucleic acids. In this assay a radiolabeled nucleic acid and test protein are mixed. Binding is determined via gel electrophoresis which separates components based on mass, charge, and conformation.
This video shows the concepts of EMSA and a general procedure, including gel and protein preparation, binding, electrophoresis, and detection. Applications covered in this video include the analysis of chromatin-remodeling enzymes, a modified EMSA that incorporates biontinylation, and the study of binding sites of bacterial response regulators.
<div class="chapter_text" id="script_0">
EMSA, the electrophoretic mobility shift assay, also known as the gel shift assay, is a versatile and sensitive biochemical procedure. EMSA elucidates binding between proteins and nucleic acids by detecting a shift in bands in gel electrophoresis.
This video describes the principles of EMSA, provides a general procedure, and discusses some applications.
</div>
<div class="chapter_text" id="script_1">
DNA replication, transcription, and repair, as well as RNA processing are all critical biochemical processes. They all involve binding between proteins and nucleic acids. Many serious diseases and disorders are associated with modifications in this binding. EMSA is a technique for qualitatively determining whether a specific protein binds to a specific nucleic acid. First, the nucleic acid is labeled, usually with radioactive phosphorus-32, to create a probe. Then the test protein and nucleic acid probe are mixed. When a protein binds to a nucleic acid probe, the resulting complex has greater mass and a different conformation than the nucleic acid alone.
Once bound, the complexes are analyzed with&#160;gel electrophoresis. In this technique, an electric field forces macromolecules to migrate through a gel matrix. The components separate based on mass, charge, and conformation. Electrophoresis can separate protein-DNA complexes from unbound probes. Since they have different masses and conformations, they will migrate through the gel at different rates and separate. The separation is easily detected, thanks to the presence of the radioactive phosphorus, and proves the protein successfully binds to the given nucleic acid. To verify the identification of the protein, a &#34;supershift assay&#34; uses an antibody with a known affinity to the protein. This has the added benefit of further shifting the complex, increasing resolution.
Now that we&#39;ve seen the principles, let&#39;s see it in the lab.
</div>
<div class="chapter_text" id="script_2">
To begin the procedure, the protein must be isolated. To do this, molecular biology techniques are used to express the protein in cells, and then purify.
The nucleic acid is amplified and labeled to create a probe. Labeling is done through incubation for 10 min with dCTP containing radioactive phosphorus-32. A radiation-safe workbench and protective equipment are required.
The gel is then prepared. The gel needs to be non-denaturing, to prevent the protein from altering conformation and potentially unbinding from the probe during electrophoresis. Polyacrylamide gels have pore sizes of 5 to 20 nm and are useful for short probes up to 100 base pairs in length. Agarose gels have pore sizes of 70-700 nm and are useful for larger probes.
</div>
<div class="chapter_text" id="script_3">
With the protein and nucleic acid probe now prepared, we proceed to binding. A TRIS buffer solution is prepared and the protein and probe are added. The pH should be similar to physiological conditions, and salt concentration sufficient to prevent the protein from forming weak bonds with non-target nucleic acids. The reaction proceeds for 20-30 min at 4 &#176;C.
The next step is electrophoresis. A buffer of low ionic strength and a pH similar to that used in the binding reaction is utilized. It yields a &#34;caging effect&#34; that stabilizes complexes, increases mobility, and reduces heat generation. After electrophoresis, the components of the gel are transferred onto filter paper. In a dark room, the filter paper is then exposed to film. If the protein binds to the probe, two distinct labeled regions will be visible in the transfer. One representing the complex, and a separate one representing the unbound probe. The separation demonstrates that the protein successfully bound to the nucleic acid.
</div>
<div class="chapter_text" id="script_4">
Now that we&#39;ve seen the basic procedure, let&#39;s look at some applications.
Chromatin is the tightly packed complex of DNA and proteins found eukaryotic cells. Chromatin-remodeling enzymes modify the structure to open the DNA to transcription. As this changes the mobility of the complex, EMSA can be used to explore the binding activity of the enzyme.
An alternate approach to labeling takes advantage of the interaction between DNA and the methyltransferase enzyme. A cofactor can be modified to bind permanently to DNA via methyltransferase. Rather than labeling with phosphorus-32, the cofactor is conjugated to biotin, which is advantageous because it&#39;s not radioactive.&#160;Because the cofactor is site-specific in its attachment, it&#8217;s relevant to genotyping, methylation detection, and gene delivery. The biotinilated nucleic acids are detected through ultraviolet fluorescence.
When environmental stimuli activate histidine kinases, a &#8220;response regulator&#8221; is phosphorylated. This in turn binds to DNA, affecting transcription, which can be studied by EMSA.&#160;For instance, a response regulator in Desulfovibrio vulgaris was demonstrated to bind to the gene of interest. EMSA was used to verify that the binding took place.
</div>
<div class="chapter_text" id="script_5">
You&#39;ve just watched JoVE&#39;s video on the electrophoretic mobility shift assay. You should now understand its principles of operation, the steps in its procedure, and its major operating parameters.
Thanks for watching!
</div>

Electrophoretic Mobility Shift Assay EMSA

The electrophoretic mobility shift assay (EMSA) is a biochemical procedure used to elucidate binding between proteins and nucleic acids. In this assay a ...

Education

JoVE Science Education

Chemistry

Electrophoretic Mobility Shift Assay for Detection of Transcription Factor-DNA Complexes

Source: Hsieh, Y. W. et al., <a href="https://app-jove-com.bdigitaluss.remotexs.co/v/54863">An Optimized Protocol for Electrophoretic Mobility Shift Assay Using Infrared Fluorescent Dye-labeled Oligonucleotides.</a> J. Vis. Exp. (2016)
In this video, we demonstrate the electrophoretic mobility shift assay to detect protein-DNA interactions using infrared fluorescent-labeled DNA probes. When the protein binds to the DNA probe, it forms a large complex that migrates slowly on and appears as a shifted band on the gel.

Test przesunięcia ruchliwości elektroforetycznej do wykrywania kompleksów czynnik transkrypcyjny-DNA

Source: Hsieh, Y. W. et al., An Optimized Protocol for Electrophoretic Mobility Shift Assay Using Infrared Fluorescent Dye-labeled Oligonucleotides. J. ...