Name: constructing mutants in serotype 1 streptococcus pneumoniae strain 519/43
Uploaded: 2020-09-11T14:00:00.000+00:00
Duration: 6 min 6 s
Description: Watch this Scientific Journal Video about Constructing Mutants in Serotype 1 Streptococcus pneumoniae strain 519/43 at JoVE.com

이 작업에 자금을 제공 한 수막염 신탁과 MRC에 감사드립니다.

1. SOE-PCR23 에 의한 돌연변이 앰플리콘의 생성 및 스펙티노마이신 카세트의 증폭
<ol><li>균주 519/43에서 플라이 유전자의 측면 영역의 상동성 팔(각각 ply 5'(488bp) 및 ply3'(715bp))의 증폭을 위해 PCR을 수행하는 것으로 시작합니다. 프라이머 plyFw1_NOTI(TTT GCGGCCGCCAGTAAATGACTTTATACTAGCTATG), ply5'R1_BamHI(CGAAATATAGACCAAAGGACGCGGATCC AGAACCAAACTTGACCTTGA), ply3'F1_BamHI(TCAAGGTCAAGTTTGGTTCT GGATCCCCTTTGGTCTATATTTCG) 및 plyRv2_NotI(TTTGCGGCCGCCATTTTCTACCTTATCCTCTACC)를 사용합니다.</li>
	<li>ply5'에 대해 다음 PCR 조건을 사용하십시오: 94°C에서 60초 동안 변성, 2단계: 94°C에서 30초 동안 변성, 3단계: 58°C에서 30초 동안 어닐링, 4단계: 72°C에서 30초 동안 연장, 5단계: 2단계로 돌아가서 35주기 동안 반복, 6단계: 72°C에서 30초 동안 최종 확장.<ol><li>3초여야 하는 4단계와 6단계의 연장 시간을 제외하고 ply60'에 대해 동일한 PCR 조건을 사용합니다.</li>
	</ol></li>
	<li>겔 전기영동으로 PCR 산물을 분석하고 겔에서 앰플리콘을 절제합니다.</li>
	<li>PCR 정제amp제조업체의 지침(재료 표)에 설명된 프로토콜에 따라 licons.</li>
	<li>SOE-PCR에서 두 상동성 암의 등몰량을 템플릿으로 사용합니다. 프라이머 plyFw1_ NOTI(TTT GCGGCCGCCAGTAAATGACTTTATACTAGCTATG) 및 plyRv2_NotI(TTTGCGGCCGCCATTTTCTACCTTATCCTCTACC)를 사용하여 두 앰플리콘을 융합합니다.</li>
	<li>다음 SOE-PCR 조건을 사용합니다(1단계: 94°C에서 2분 동안 변성, 2단계: 94°C에서 30초 동안 변성, 3단계: 58°C에서 30초 동안 어닐링, 4단계: 68°C에서 60초 동안 연장, 5단계: 2단계로 돌아가서 25주기 반복, 6단계: 68°C에서 90초 동안 최종 확장).</li>
	<li>겔 전기영동으로 SOE-PCR 산물을 분석합니다. 젤 추출 키트를 사용하여 젤에서 절제하고 제공된 지침을 따르십시오.</li>
	<li>다음 PCR 조건을 사용하여 플라스미드 pR412로부터 스펙티노마이신 카세트를 증폭한다: 단계 1: 94°C에서 60초 동안 변성, 단계 2: 94°C에서 30초 동안 변성, 단계 3: 55°C에서 30초 동안 어닐링, 단계 4: 68°C에서 60초 동안 연장, 5단계: 단계 2로 돌아가서 25사이클 동안 반복하고, 6단계: 68°C에서 60초 동안 최종 연장.<ol><li>프라이머 BamHI_SP2F2(GGATCC, CTA, GAA, CTA, GTG, GAT, CCC, CC) 및 BamHI_SP2R2(GGATCC, AA, TCT, GCA, GAT, TTT, AC, ATG, ATC)를 사용합니다. 플라스미드 pR412는 Marc PrudHomme 박사(CNRS-Universite Paul Sabatier Toulouse France)로부터 입수하였다.</li>
	</ol></li>
	<li>겔 전기영동으로 PCR 앰플리콘을 분석합니다. 생성된 PCR 앰플리콘을 상기와 같이 소비하고 정제한다.</li>
</ol>2. 플라스미드 pSD1의 생성 및 대장균 Dh5α의 화학적 형질전환
<ol><li>pGEMT-easy 시스템 I 제조업체 지침(재료 표)에 따라 결찰을 수행합니다. 미세 원심분리기 튜브에서 5μL의 2x 결찰 완충액, 1μL의 pGEMTeasy, 2μL의 ply_SOE 생성물, 1μL의 T4 DNA 리가제 및 물을 총 부피 20μL에 추가합니다. 4°C에서 하룻밤 동안 배양합니다. 이것은 플라스미드 pSD1을 생성한다.</li>
	<li>화학적으로 유능한 대장균 Dh5α를 pSD1로 변형시킵니다. 얼음에서 15분 동안 화학적으로 유능한 대장균 Dh5α 50μL와 pSD1 결찰 반응 3μL을 배양하는 것으로 시작합니다. 그런 다음 세포를 열 충격(42°C, 30초)에 노출시켜 계속합니다. 세포를 얼음 위에 2분 동안 두십시오.</li>
	<li>얼음에서 세포를 제거하고 350 μL의 S.O.C 배지를 추가합니다. 배양액을 37°C, 120 rpm에서 2시간 동안 배양한다.</li>
	<li>0.4mM IPTG, 청색/백색 선택을 위한 0.24mg/mL X-Gal 및 100μg/mL 암피실린이 보충된 Luria Bertani Agar(LBA)에서 형질전환을 플레이트하여 플레이트에서 성장하는 모든 콜로니가 플라스미드 골격을 갖도록 합니다. 백색 콜로니는 pSD1을 함유한다.</li>
	<li>3개의 흰색 콜로니를 선택하고 100μg/mL 암피실린이 보충된 10mL의 LB에서 하룻밤 동안 성장하도록 설정합니다. 진탕과 함께 37°C에서 하룻밤 동안 배양물을 배양한다.</li>
	<li>다음날 배양물을 3,082 x g 에서 원심분리하고 플라스미드 추출을 위해 펠릿을 사용합니다.</li>
</ol>3. 플라스미드 DNA 추출, pSD1 및 스펙티노마이신 유전자의 제한 소화 및 pSD2 조립
<ol><li>상용 키트(Table of Materials)와 함께 제공된 지침에 따라 플라스미드 DNA를 추출합니다.</li>
	<li>pSD1 플라스미드와 이전에 증폭 및 정제된 스펙티노마이신 카세트 모두에 대해 BamHI 제한 분해를 설정합니다. 표 1에 설명된 다음 조건 및 수량을 사용하십시오.</li>
	<li>제한 소화 반응 및 대조군을 37°C에서 3시간 동안 배양합니다.</li>
	<li>전기영동에 의해 제한 소화를 분석하고, 밴드를 절제하고, 상용 키트와 함께 제공된 지침에 따라 정제합니다(재료 표).</li>
	<li>다음에, BamHI-분해된 pSD1 및 스펙티노마이신(단계 3.2로부터)을 사용하여 제조사 지침(Table of Materials)에 따라 결찰 반응을 준비한다. 미세 원심분리 튜브에 다음 반응 성분을 첨가하십시오: 5 μL의 2x 결찰 완충액, 2 μL pSD1, 2 μL의 스펙티노마이신 카세트, 1 μL의 T4 DNA 리가아제를 첨가하고 4°C에서 밤새 배양합니다. 이것은 플라스미드 pSD2를 생성한다.</li>
	<li>플라스미드 pSD2를 단계 2.2에 기재된 바와 같이 화학적으로 유능한 대장균 Dh5α로 형질전환시킨다.</li>
	<li>100μg/mL의 스펙티노마이신 및 암피실린이 보충된 LBA에서 성장하는 능력에 따라 플라스미드 pSD2를 운반하는 형질전환체를 선택합니다.</li>
	<li>플라스미드 DNA 추출(pSD2)을 상기와 같이 수행하고 제조업체의 지침(μL)에 따라 수행합니다.</li>
</ol>4. S. pneumoniae 균주의 변형 519/43
<ol><li>BHI에서 S. pneumoniae 519/43의 하룻밤 배양액을 준비하고 37°C, 5%CO2에서 정적으로 성장하도록 합니다.</li>
	<li>다음날 배양물을 1:50 및 1:100의 신선한 BHI 브로스 10mL에 희석합니다. OD595nm 가 0.05 내지 0.1 사이가 될 때까지 37°C에서 정적으로 배양물을 배양한다(0.1 OD에 가까운 DNA의 최적 획득).</li>
	<li>OD가 0.1에 도달하면 860 μL를 취하여 미세 원심 분리기 튜브로 옮깁니다. 동일한 미세 원심분리 튜브에 100μL의 100mM NaOH, 10μL의 20%(w/v) BSA, 10μL의 100mM CaCl2, 2μL의 50ng/mL CSP124 및 500ng의pSD2를 추가합니다.</li>
	<li>반응을 37°C에서 3시간 동안 정적으로 배양합니다.</li>
	<li>330 μL를 100 μg/mL 스펙티노마이신이 보충된 5% 혈액 한천 플레이트(BA)에 3시간 동안 매시간 플레이트합니다.</li>
	<li>플레이트를 37°C, 5%CO2에서 밤새 인큐베이션한다. 스펙티노마이신 내성 콜로니를 100μg/mL 스펙티노마이신이 보충된 다른 BA 플레이트와 100μg/mL의 암피실린이 보충된 BA 플레이트에 패치합니다. 위에 명시된 조건에서 두 세트의 플레이트를 하룻밤 동안 배양하십시오. 암피실린 플레이트는 플라스미드 골격의 존재를 시험하기 위한 것이다.</li>
	<li>프라이머 plyFw1_ NOTI(TTT GCGGCCGCCAGTAAATGACTTTATACTAGCTATG) 및 SPEC_REV(TAATTCCTCTAAGTCATAATTTCCG)를 사용하여 PCR로 스펙티노마이신 카세트의 존재를 확인합니다. 돌연변이 부위 외부에 부착되는 프라이머 plySCN1(CCAATGGAAATCGCTAGGCAAGAGATAA)과 plySCN2(ATTACTTAGTCCAACCACGGCTGAT)를 이용하여 PCR로 돌연변이를 확인한다.</li>
	<li>프라이머 plySCN1(CCAATGGAAATCGCTAGGCAAGAGATAA), plySCN2(ATTACTTAGTCCAACCACGGCTGAT) 및 스펙티노마이신 카세트 sqr1(CCTGATCCAAACATGTAAGTACCACC), sqf2(CGTAGTTATCTTGGAGAGAATA) spec_sqf1(GGTACTTACATGTTTGGATCAGG) 및 spec_sqr2 TATTCTCTCCAAGATAACTACG에 결합 부위가 있는 프라이머를 사용하여 시퀀싱하여 게놈의 올바른 위치에 통합을 확인합니다.</li>
</ol>

<ol>
	<li>Bentley, S. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+Analysis+of+the+Capsular+Biosynthetic+Locus+from+All+90+Pneumococcal+Serotypes.">Genetic Analysis of the Capsular Biosynthetic Locus from All 90 Pneumococcal Serotypes.</a> PLoS Genetics. 2 (3), 31 (2006).</li><li>Calix, J. J., Nahm, M. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+new+pneumococcal+serotype,+11E,+has+a+variably+inactivated+wcjE+gene.">A new pneumococcal serotype, 11E, has a variably inactivated wcjE gene.</a> The Journal of Infectious Diseases. 202 (1), 29-38 (2010).</li><li>Park, I. H., Pritchard, D. G., Cartee, R., Brandao, A., Brandileone, M. C. C., Nahm, M. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Discovery+of+a+New+Capsular+Serotype+(6C)+within+Serogroup+6+of+Streptococcus+pneumoniae.">Discovery of a New Capsular Serotype (6C) within Serogroup 6 of Streptococcus pneumoniae.</a> Journal of Clinical Microbiology. 45 (4), 1225-1233 (2007).</li><li>Jin, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=First+Report+of+Putative+Streptococcus+pneumoniae+Serotype+6D+among+Nasopharyngeal+Isolates+from+Fijian+Children.">First Report of Putative Streptococcus pneumoniae Serotype 6D among Nasopharyngeal Isolates from Fijian Children.</a> The Journal of Infectious Diseases. 200 (9), 1375-1380 (2009).</li><li>Oliver, M. B., vander Linden, M. P. G., K&#252;ntzel, S. A., Saad, J. S., Nahm, M. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Discovery+of+Streptococcus+pneumoniae+Serotype+6+Variants+with+Glycosyltransferases+Synthesizing+Two+Differing+Repeating+Units.">Discovery of Streptococcus pneumoniae Serotype 6 Variants with Glycosyltransferases Synthesizing Two Differing Repeating Units.</a> Journal of Biological Chemistry. 288 (36), 25976-25985 (2013).</li><li>Calix, J. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Serological+Characterization+of+Two+Capsule+Subtypes+among+Streptococcus+pneumoniae+Serotype+20+Strains.">Serological Characterization of Two Capsule Subtypes among Streptococcus pneumoniae Serotype 20 Strains.</a> Journal of Biological Chemistry. 287 (33), 27885-27894 (2012).</li><li>Park, I. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=and+Serological+Characterization+of+a+New+Pneumococcal+Serotype,+6H,+and+Generation+of+a+Pneumococcal+Strain+Producing+Three+Different+Capsular+Repeat+Units.">and Serological Characterization of a New Pneumococcal Serotype, 6H, and Generation of a Pneumococcal Strain Producing Three Different Capsular Repeat Units.</a> Clinical and Vaccine Immunology. 22 (3), 313-318 (2015).</li><li>O'Brien, K. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Burden+of+disease+caused+by+Streptococcus+pneumoniae+in+children+younger+than+5+years:+global+estimates.">Burden of disease caused by Streptococcus pneumoniae in children younger than 5 years: global estimates.</a> The Lancet. 374 (9693), 893-902 (2009).</li><li>Henriques-Normark, B., Tuomanen, E. I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Pneumococcus:+Epidemiology,+Microbiology,+and+Pathogenesis.">The Pneumococcus: Epidemiology, Microbiology, and Pathogenesis.</a> Cold Spring Harbor Perspectives in Medicine. 3 (7), 010215 (2013).</li><li>Leimkugel, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+Outbreak+of+Serotype+1+Streptococcus+pneumoniae+Meningitis+in+Northern+Ghana+with+Features+That+Are+Characteristic+of+Neisseria+meningitidis+Meningitis+Epidemics.">An Outbreak of Serotype 1 Streptococcus pneumoniae Meningitis in Northern Ghana with Features That Are Characteristic of Neisseria meningitidis Meningitis Epidemics.</a> The Journal of Infectious Diseases. 192 (2), 192-199 (2005).</li><li>Yaro, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epidemiological+and+Molecular+Characteristics+of+a+Highly+Lethal+Pneumococcal+Meningitis+Epidemic+in+Burkina+Faso.">Epidemiological and Molecular Characteristics of a Highly Lethal Pneumococcal Meningitis Epidemic in Burkina Faso.</a> Clinical Infectious Diseases. 43 (6), 693-700 (2006).</li><li>Antonio, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+epidemiology+of+pneumococci+obtained+from+Gambian+children+aged+2-29+months+with+invasive+pneumococcal+disease+during+a+trial+of+a+9-valent+pneumococcal+conjugate+vaccine.">Molecular epidemiology of pneumococci obtained from Gambian children aged 2-29 months with invasive pneumococcal disease during a trial of a 9-valent pneumococcal conjugate vaccine.</a> BMC Infectious Diseases. 8 (1), 81 (2008).</li><li>Kwambana-Adams, B. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+outbreak+of+pneumococcal+meningitis+among+older+children+(&#8805;5+years)+and+adults+after+the+implementation+of+an+infant+vaccination+programme+with+the+13-valent+pneumococcal+conjugate+vaccine+in+Ghana.">An outbreak of pneumococcal meningitis among older children (&#8805;5 years) and adults after the implementation of an infant vaccination programme with the 13-valent pneumococcal conjugate vaccine in Ghana.</a> BMC Infectious Diseases. 16 (1), 575 (2016).</li><li>Antonio, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Seasonality+and+outbreak+of+a+predominant+Streptococcus+pneumoniae+serotype+1+clone+from+The+Gambia:+Expansion+of+ST217+hypervirulent+clonal+complex+in+West+Africa.">Seasonality and outbreak of a predominant Streptococcus pneumoniae serotype 1 clone from The Gambia: Expansion of ST217 hypervirulent clonal complex in West Africa.</a> BMC Microbiology. 8 (1), 198 (2008).</li><li>Staples, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+characterization+of+an+Australian+serotype+1+Streptococcus+pneumoniae+outbreak.">Molecular characterization of an Australian serotype 1 Streptococcus pneumoniae outbreak.</a> Epidemiology and Infection. 143 (2), 325-333 (2015).</li><li>Gessner, B. D., Mueller, J. E., Yaro, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=African+meningitis+belt+pneumococcal+disease+epidemiology+indicates+a+need+for+an+effective+serotype+1+containing+vaccine,+including+for+older+children+and+adults.">African meningitis belt pneumococcal disease epidemiology indicates a need for an effective serotype 1 containing vaccine, including for older children and adults.</a> BMC Infectious Diseases. 10 (1), 22 (2010).</li><li>Hill, P. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nasopharyngeal+carriage+of+Streptococcus+pneumoniae+in+Gambian+infants:+a+longitudinal+study.">Nasopharyngeal carriage of Streptococcus pneumoniae in Gambian infants: a longitudinal study.</a> Clinical Infectious Diseases. 46 (6), 807-814 (2008).</li><li>Ebruke, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Temporal+changes+in+nasopharyngeal+carriage+of+Streptococcus+pneumoniae+serotype+1+genotypes+in+healthy+Gambians+before+and+after+the+7-valent+pneumococcal+conjugate+vaccine.">Temporal changes in nasopharyngeal carriage of Streptococcus pneumoniae serotype 1 genotypes in healthy Gambians before and after the 7-valent pneumococcal conjugate vaccine.</a> PeerJ. 3, 90 (2015).</li><li>Adegbola, R. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Serotype+and+antimicrobial+susceptibility+patterns+of+isolates+of+Streptococcus+pneumoniae+causing+invasive+disease+in+The+Gambia+1996-2003.">Serotype and antimicrobial susceptibility patterns of isolates of Streptococcus pneumoniae causing invasive disease in The Gambia 1996-2003.</a> Tropical Medicine and International Health. 11 (7), 1128-1135 (2006).</li><li>Marks, L. R., Reddinger, R. M., Hakansson, A. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High+Levels+of+Genetic+Recombination+during+Nasopharyngeal+Carriage+and+Biofilm+Formation+in+Streptococcus+pneumoniae.">High Levels of Genetic Recombination during Nasopharyngeal Carriage and Biofilm Formation in Streptococcus pneumoniae.</a> mBio. 3 (5), (2012).</li><li>Ritchie, N. D., Mitchell, T. J., Evans, T. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=What+is+different+about+serotype+1+pneumococci.">What is different about serotype 1 pneumococci.</a> Future Microbiology. 7 (1), 33-46 (2012).</li><li>Harvey, R. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+variable+region+of+pneumococcal+pathogenicity+island+1+is+responsible+for+unusually+high+virulence+of+a+serotype+1+isolate.">The variable region of pneumococcal pathogenicity island 1 is responsible for unusually high virulence of a serotype 1 isolate.</a> Infection and Immunity. 84 (3), 822-832 (2016).</li><li>Horton, R. M., Cai, Z. L., Ho, S. N., Pease, L. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+splicing+by+overlap+extension:+tailor-made+genes+using+the+polymerase+chain+reaction.">Gene splicing by overlap extension: tailor-made genes using the polymerase chain reaction.</a> BioTechniques. 8 (5), 528-535 (1990).</li><li>Alioing, G., Granadel, C., Morrison, D. A., Claverys, J. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Competence+pheromone,+oligopeptide+permease,+and+induction+of+competence+in+Streptococcus+pneumoniae.">Competence pheromone, oligopeptide permease, and induction of competence in Streptococcus pneumoniae.</a> Molecular Microbiology. 21 (3), 471-478 (1996).</li><li>Lund, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Enumeration and description of the strains belonging to the State Serum Institute, Copenhagen Denmark. , (1951).</li><li>Barany, F., Tomasz, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+transformation+of+Streptococcus+pneumoniae+by+heterologous+plasmid+deoxyribonucleic+acid.">Genetic transformation of Streptococcus pneumoniae by heterologous plasmid deoxyribonucleic acid.</a> Journal of Bacteriology. 144 (2), 698-709 (1980).</li><li>Terra, V. S., Homer, K. A., Rao, S. G., Andrew, P. W., Yesilkaya, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+novel+&#946;-galactosidase+activity+that+contributes+to+glycoprotein+degradation+and+virulence+in+Streptococcus+pneumoniae.">Characterization of novel &#946;-galactosidase activity that contributes to glycoprotein degradation and virulence in Streptococcus pneumoniae.</a> Infection and Immunity. 78 (1), (2010).</li><li>Terra, V. S., Zhi, X., Kahya, H. F., Andrew, P. W., Yesilkaya, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pneumococcal+6-phospho-&#946;-glucosidase+(BglA3)+is+involved+in+virulence+and+nutrient+metabolism.">Pneumococcal 6-phospho-&#946;-glucosidase (BglA3) is involved in virulence and nutrient metabolism.</a> Infection and Immunity. 84 (1), (2015).</li><li>Harvey, R. M., Ogunniyi, A. D., Chen, A. Y., Paton, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pneumolysin+with+Low+Hemolytic+Activity+Confers+an+Early+Growth+Advantage+to+Streptococcus+pneumoniae+in+the+Blood.">Pneumolysin with Low Hemolytic Activity Confers an Early Growth Advantage to Streptococcus pneumoniae in the Blood.</a> Infection and Immunity. 79 (10), 4122 (2011).</li><li>Terra, V. S., Plumptre, C. D., Wall, E. C., Brown, J. S., Wren, B. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Construction+of+a+pneumolysin+deficient+mutant+in+Streptococcus+pneumoniae+serotype+1+strain+519/43+and+phenotypic+characterisation.">Construction of a pneumolysin deficient mutant in Streptococcus pneumoniae serotype 1 strain 519/43 and phenotypic characterisation.</a> Microbial Pathogenesis. 141, 103999 (2020).</li></ol>

저자는 공개 할 것이 없습니다.

폐렴 연쇄상 구균, 특히 혈청형 1은 침습성 폐렴구균 질환 및 수막염을 유발하는 세계적인 위협이 되고 있습니다. 혈청형 1을 예방해야 하는 다양한 백신이 도입되었음에도 불구하고, 아프리카에서는 이 혈청형이 여전히 높은 이환율과 사망률을 초래하는 발병을 일으킬 수 있다13. 이 혈청형을 유전적으로 조작하는 능력은 임상적 관련성 때문에 매우 중요합니다. 이 연구에 설명된 방법은 이 혈청형 내에서 대표적인 균주의 유전자 조작을 허용합니다. 침습성 균주 519/43(ST5316), 덴마크의 수막염 환자로부터 임상적으로 분리된 균주25.
여기에 제시된 방법론은 대부분 외인성 DNA를 획득할 수 있기 때문에 선택된 균주로 인해 성공적이었지만 S. pneumoniae 형질전환에 사용되는 기존 프로토콜의 변경으로 인해 당사의 형질전환 프로토콜에 대한 일반적인 성공률은 약 70%입니다.
이 방법론에서는 일반적인 선형 DNA 대신 자살 플라스미드를 사용하는 것이 가장 중요합니다. 통상적으로, 선형 DNA26,27,28이 사용되었을 것이다; 그러나이 형태로 외인성 DNA를 사용하려는 모든 시도는 성공하지 못했습니다. 또한, 낮은 흡광도에서 S. pneumoniae 519/43의 자연적 능력을 이용하려는 시도는 성공적이지 못했습니다. 문제 해결은 OD595가 0.1일 때 균주 519/43에 대한 자연 능력이 더 높았으며, 이는 매우 낮은 OD24에서 가장 높은 자연 능력이 관찰된 S. pneumoniae의 다른 혈청형에 대해 관찰된 데이터와 다르다는 것을 보여주었습니다.
이 방법을 검증하기 위해, 뉴몰리신 돌연변이체는 따르기 쉬운 표현형을 나타내기 때문에 구성되었습니다. 그러나 이 방법이 이 균주 내의 모든 유전자에 적용될 수 있음을 증명하기 위해 다른 유전자를 성공적으로 표적화했습니다(준비 중인 원고). 그람 양성 호환 기원이 없는 자살 벡터를 사용하는 이러한 방법은 인접 유전자를 상동성 영역으로 사용하여 염색체 보완, 관심 유전자의 과발현 및 리포터 시스템 도입에도 사용할 수 있습니다.
S. pneumoniae 혈청형 1, 균주 519/43에 대한 유전적 도구의 확장은 이제 대표 균주를 직접 유전적으로 조작할 수 있기 때문에 중요합니다. 균주 519/43은 유전적으로 유연하고 수막염 환자로부터 분리되었기 때문에 병원성이며 그 조작은 수막염의 발병 및 확립을 더 잘 이해할 수 있는 단서를 제공할 것이기 때문에 흥미롭습니다. 이전에는 종 내의 특정 결정 요인을 이해하는 것이 D39 (혈청 형 2)와 같은 S. pneumoniae의 매우 잘 특성화 된 균주 중 하나에 문제의 유전자를 삽입함으로써 수행되었습니다. 이러한 접근법은 혈청형 129에 대한 돌연변이 유발의 어려움으로 인해 Paton et al.에 의해 사용되었습니다. 519/43 ∆ply에 비해 혈청형 1겹의 덜 용혈성 대립유전자를 운반하는 D39에 대해 보고한 결과는 원래 균주 배경 내에서 유전자를 돌연변이시킬 수 있는 것의 중요성을 강조하는 우리30이 제시한 것과 다릅니다. 나중에, 같은 그룹은 비계통 A 혈청형 1 균주22를 돌연변이시킬 수 있었다. 흥미롭게도, 그들의 프로토콜은 혈청형 2 균주에서 먼저 돌연변이를 수행한 다음 혈청형 1 균주에서 형질전환될 주형으로 사용되는 2단계 접근 방식이기 때문에 우리와 상당히 다릅니다.
현재 제시된 방법에는 한 가지 한계가 있습니다. 현재 이 방법은 519/43 대표 변형에 대해서만 작동합니다. 다른 균주, 즉 ST3081 및 ST303의 임상 분리주에서도 동일한 정확한 프로토콜이 시도되었지만 성공하지 못했습니다. 또한, 외인성 DNA를 세포에 전달하는 방법으로서의 전기천공법도 세 가지 서열 유형 모두에서 시도되었으며 519/43에 대해서만 양성 결과가 관찰되었습니다. 모든 혈청형 1 균주에 대한 방법론을 확장하고 표준화하는 것은 그룹 전체에 엄청난 변동성이 있기 때문에 가장 중요합니다. 현재 혈청형 1 내의 모든 균주에 대한 방법의 적용 가능성을 확대하기 위한 연구가 진행 중입니다.

폐렴 연쇄상 구균 (S. pneumoniae, 폐렴 구균)은 전 세계적으로 이환율과 사망률의 주요 원인 중 하나입니다. 최근까지 100개에 가까운 S. pneumoniae의 혈청형이 발견되었다 1,2,3,4,5,6,7. 매년 침습성 폐렴구균성 질환(IPD)으로 인해 약 700,000명이 사망하고 5세 미만 어린이가사망한다 8. S. pneumoniae는 전 세계적으로 세균성 폐렴, 중이염, 수막염 및 패혈증의 주요 원인이다9.
아프리카 수막염 벨트에서 혈청형 1은 수막염 발병의 원인이 되며, 여기서 매우 독성이 강한 서열형인 서열형(ST) ST217이 우세합니다 10,11,12,13,14,15. 수막염 병리학에서의 중요성은 아프리카 수막염 벨트의 Neisseria meningitidis의 중요성에 비유되었습니다16. 혈청형 1은 종종 IPD의 주요 원인입니다. 그러나 마차에서는 거의 발견되지 않습니다. 사실, 감비아에서는 이 혈청형이 모든 침습성 질환의 20%를 차지하지만 건강한 보균자의 0.5%에서만 발견되었습니다14,17,18,19. 유능한 폐렴구균에서의 유전자 교환 및 재조합은 일반적으로 침습성 질환보다는 보균에서 발생한다20. 또한, 혈청형 1은 폐렴구균 중에서 가장 짧은 보균률(단 9일) 중 하나인 것으로 나타났습니다. 그러므로, 이 혈청형은 다른 혈청형보다 훨씬 낮은 재조합률을 가질 수 있다고 제안되었다21.
혈청형 1 균주의 낮은 운반률의 이유와 사하라 사막 이남 아프리카의 침습성 질병에서의 중요성을 이해하기 위해서는 심층 연구가 필요합니다.
여기에서 우리는 특정 혈청형 1 균주, 519/43의 게놈 전체 돌연변이 유발을 허용하는 프로토콜을 보고합니다. 이 균주는 새로운 DNA를 쉽게 획득하여 게놈으로 재결합할 수 있습니다. 이 방법은 아직 변형되지 않았지만 519/43 배경에서 수행될 때 매우 효율적입니다(다른 표적은 돌연변이가 발생했으며 원고는 준비 중입니다). 단순히 519/43 균주를 사용하고 그 타고난 능력을 활용하고 외인성 DNA가 제공되는 방식을 대체함으로써 우리는 이 혈청형 1 균주에서 뉴몰리신 유전자(ply)를 돌연변이시킬 수 있었습니다. 이 방법은 Harvey et al.22 가 제시한 방법에 대한 개선을 나타내며, 다른 혈청형을 통해 DNA를 통과시킬 필요 없이 한 단계로 수행됩니다. 그럼에도 불구하고, 균주 간 가변성으로 인해, 모든 균주에 대해 표준화된 방법은 없다. 특정 유전자를 돌연변이시키고 그 효과를 관찰하는 능력은 혈청형 1 S. pneumoniae 균주에 대한 심오한 이해를 가능하게 할 것이며 사하라 사막 이남 아프리카의 수막염에서 이러한 균주의 역할에 대한 답을 제공할 것입니다.

<table><tbody><tr><td>AccuPrime &lt;em&gt;Pfx&lt;/em&gt; DNA polymerase</td><td>Invitrogen</td><td>12344024</td><td>Used for amplification of the fragments</td></tr><tr><td>Ampicillin sodium salt</td><td>Sigma Aldrich</td><td>A9518</td><td>Used for bacterial selection on stage 1(pSD1)</td></tr><tr><td>Blood Agar Base</td><td>Oxoid</td><td>CM0055</td><td>Used to plate &lt;em&gt;S. pneumoniae&lt;/em&gt; transformants</td></tr><tr><td>Bovine Serum Albumine</td><td>sigma</td><td>55470</td><td>used for &lt;em&gt;S. pneumoniae&lt;/em&gt; Transformation</td></tr><tr><td>Brain Heart Infusion</td><td>Oxoid</td><td>CM1135</td><td>used to grow &lt;em&gt;S. pneumoniae&lt;/em&gt; cells</td></tr><tr><td>Calcium Chloride Cacl&lt;sub&gt;2&lt;/sub&gt;</td><td>Sigma</td><td>449709</td><td>used for &lt;em&gt;S. pneumoniae&lt;/em&gt; Transformation</td></tr><tr><td>Competence stimulating peptide 1</td><td>AnaSpec</td><td>AS-63779</td><td>used for &lt;em&gt;S. pneumoniae&lt;/em&gt; Transformation</td></tr><tr><td>Luria Broth Agar</td><td>Gibco</td><td>22700025</td><td>used for plating and selection of pSD1 and pSD2</td></tr><tr><td>Luria Broth Base (Miller&#039;s formulation)</td><td>Gibco</td><td>12795027</td><td>used for plating and selection of pSD1 and pSD2</td></tr><tr><td>Monarch Gel Extraction Kit</td><td>NEB</td><td>T1020S</td><td>Used to extract the bands from the DNA gel</td></tr><tr><td>Monarch Plasmid Miniprep Kit</td><td>NEB</td><td>T1010S</td><td>Used to extract plasmid from the cells</td></tr><tr><td>pGEM T-easy</td><td>Promega</td><td>A1360</td><td>used as suicide plasmid</td></tr><tr><td>S.O.C.</td><td>Invitrogen</td><td>15544034</td><td>used for recovery of cells after transformation</td></tr><tr><td>Sodium Hydroxide (NaOH)</td><td>Sigma</td><td>S0899</td><td>used for &lt;em&gt;S.pneumoniae&lt;/em&gt; Transformation</td></tr><tr><td>Spectinomycin Hydrochloride</td><td>SigmaAldrich</td><td>PHR1426</td><td>Used for bacterial selection</td></tr><tr><td>Subcloning Efficiency DH5&amp;alpha; Competent Cells</td><td>Invitrogen</td><td>18265017</td><td>used for the creation of pSD1 and pSD2</td></tr></tbody></table>

constructing mutants in serotype 1 streptococcus pneumoniae strain 519/43

Streptococcus pneumoniae 혈청형 1은 저소득 및 중간 소득 국가, 특히 사하라 사막 이남 아프리카에서 여전히 큰 문제로 남아 있습니다. 그 중요성에도 불구하고, 이 혈청형에 대한 연구는 그것을 변형시키는 유전적 도구의 부족으로 인해 방해를 받았습니다. 이 연구에서 우리는 혈청형 1 임상 분리주(균주 519/43)를 유전적으로 변형시키는 방법을 설명합니다. 흥미롭게도 이것은 자연적으로 DNA를 획득하는 폐렴 구균의 능력을 이용하여 달성되었습니다. 그러나 대부분의 폐렴 구균과 달리 선형 DNA의 사용은 성공적이지 못했습니다. 이 중요한 균주를 돌연변이시키기 위해서는 자살 플라스미드를 사용해야 했습니다. 이 방법론은 생물학과 병원성 측면에서 이 파악하기 어려운 혈청형을 더 깊이 이해할 수 있는 수단을 제공했습니다. 이 방법을 검증하기 위해 알려진 주요 폐렴구균 독소인 뉴몰리신은 잘 알려져 있고 따르기 쉬운 표현형을 가지고 있기 때문에 돌연변이되었습니다. 우리는 예상대로 돌연변이가 적혈구를 용해시키는 능력을 상실했음을 보여주었습니다. 관심 혈청형에서 중요한 유전자를 돌연변이시킬 수 있게 됨으로써, 우리는 복강내 및 비강내 감염 시 기능 상실 돌연변이에 대해 다른 혈청형에 대해 관찰된 표현형과 다른 표현형을 관찰할 수 있었습니다. 요약하면, 이 연구는 균주 519/43(혈청형 1)이 유전자 변형될 수 있음을 증명합니다.

여기에 설명된 프로토콜은 PCR을 사용하여 왼쪽 및 오른쪽 상동성 아암을 증폭하는 동시에 플라이 유전자의 중간 영역에서 191bp를 삭제하는 것으로 시작합니다. PCR을 수행하는 동안 BamHI 부위는 왼쪽 상동성 암의 3'와 오른쪽 상동성 암의 5' 말단에 도입됩니다(그림 1A). 그 다음에는 왼쪽 및 오른쪽 상동성 암이 하나의 앰플리콘으로 융합되는 PCR-SOE가 이어집니다(그림 1B). 그런 다음 이 SOE-PCR 앰플리콘을 TA 클로닝을 사용하여 pGEMTeasy에 클로닝하여 플라스미드 pSD1을 생성합니다(그림 1C). 성공적인 형질전환은 암피실린에 내성이 있는 백색 집락을 생성할 것입니다. 임의의 청색 콜로니는 빈 pGEMTeasy 플라스미드를 함유하는 형질전환체일 것이다. 그런 다음 pSD1은 SOE-PCR 시 도입된 BamHI 부위에서 소화되고(그림 1D) 스펙티노마이신 카세트에 결찰됩니다(또한 호환 가능한 말단을 위해 분해된 BamHI). 새로운 플라스미드는 pSD2라고 합니다(그림 1E). pSD2의 올바른 조립은 제한 소화에 의해 확인됩니다(그림 2A). 그람 양성 호환 복제 기점을 포함하지 않기 때문에 자살 플라스미드로 작동하는 pSD2는 519/43WT(이전에 유능하도록 준비됨)를 변형시키는 데 사용되었습니다. 양성 형질전환체는 하룻밤 배양 후 100μg/mL 스펙티노마이신에서 성장하는 콜로니입니다. 모든 콜로니는 100μg/mL 스펙티노마이신이 보충된 새로 신선한 혈액 한천 베이스 플레이트와 100μg/mL의 암피실린이 보충된 혈액 한천 베이스에 패치됩니다. 스펙티노마이신이 보충된 두 번째 하룻밤 플레이트에서 자라는 모든 집락은 양성일 수 있습니다. 암피실린 플레이트에서 자라는 모든 콜로니는 전체 플라스미드의 통합 또는 게놈의 다른 곳에서 암피실린 카세트의 재조합을 나타냅니다. 지금까지 균주 519/43을 사용하여 암피실린이 보충된 판에서 콜로니가 자라지 않았습니다. PCR에 의해 양성인 모든 콜로니는 삽입 위치를 평가하고 확인하기 위해 시퀀싱(그림 2C)에 의해 확인되어야 합니다. 이를 위해, 프라이머는 상동성 영역 외부에 그의 결합 부위를 가져야 한다(도 2C). 선택된 표적은 매우 뚜렷한 표현형(적혈구(RBC)의 용혈)을 가지므로 돌연변이도 표현형으로 확인할 수 있습니다(그림 2B). 돌연변이는 RBC를 용해하는 능력을 잃었습니다.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td>구성 요소</td>
			<td>반응물 (μL)</td>
			<td>대조군 (μL)</td>
			<td>반응물 (μL)</td>
			<td>대조군 (μL)</td>
		</tr><tr><td>완충기</td>
			<td>2</td>
			<td>2</td>
			<td>2</td>
			<td>2</td>
		</tr><tr><td>pSD1</td>
			<td>4</td>
			<td>4</td>
			<td></td>
			<td>-</td>
		</tr><tr><td>Spectinomycin 카세트</td>
			<td>-</td>
			<td>-</td>
			<td>6</td>
			<td>6</td>
		</tr><tr><td>밤하이-HF</td>
			<td>1</td>
			<td>-</td>
			<td>1</td>
			<td>-</td>
		</tr><tr><td>물</td>
			<td>13</td>
			<td>14</td>
			<td>11</td>
			<td>12</td>
		</tr><tr><td>총 볼륨</td>
			<td>20</td>
			<td>20</td>
			<td>20</td>
			<td>20</td>
		</tr></tbody></table>표 1: pSD1 및 스펙티노마이신 카세트에 대한 제한 소화 반응 성분.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/61594/61594fig01.jpg"> 그림 1: 돌연변이 유발 전략의 개요. a) 상동성 암의 증폭 (Ply3' 및 Ply5' (레인 2에서 5까지); 및 중첩 확장 PCR(레인 6 및 7)에 의한 스플라이싱. L-hyperladder I (Bioline), 레인 1-반응에 대한 음성 대조군, 레인 2 및 3-상동성 아암 Ply5' (488 bp) 및 Ply3' (715 bp) 상동성 아암 D39 gDNA로부터 증폭된, 레인 4 및 5-상동성 암 519/43 gDNA로부터 증폭된 ply5' (488 bp) 및 ply3' (715 bp). 우측 레인 6-D39 SOE PCR 산물, 레인 7-519/43 SOE PCR 산물(1235bp). B) 얻어진 최종 SOE-PCR 구축물을 묘사한 개략도(ply_SOE); 화살표로 표시된 프라이머는 두 상동성 암 사이의 상동성 영역과 선택한 제한 소화를 얻는 데 사용됩니다. C) 플라스미드 pSD1, ply_SOE의 클로닝을 묘사하는 단계; D) pSD1 및 스펙티노마이신 카세트의 제한 소화. E) 최종 작제물 pSD2는 S. pneumoniae를 형질전환시키기 위한 자살 플라스미드로서 사용된다. <a href="https://www-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/61594/61594fig01large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/61594/61594fig02.jpg"> 그림 2: A) pSD2에서 스펙티노마이신 카세트의 존재 확인. L-과사다리 1kb (바이오린); 1- pSD1은 BamHI로 분해되었습니다. BamHI로 소화된 2-pSD2; L hyperladder 1 kb (바이오라인); 3-pR412로부터 증폭된 스펙티노마이신 카세트, 4-BamHI로 분해된 스펙티노마이신 카세트; B) D39, 519/43WT 및 돌연변이 519/43Δply에 대한 용혈 활성의 결정에 의한 뉴몰리신 돌연변이의 표현형 확인. 이를 0.5% 사포닌에 의한 적혈구의 용혈과 비교하였다. 사포닌 유래 용혈은 100%로 간주되며 이에 대해 519/43Wt 및 519/43Δply에 대한 비율을 계산했습니다. 각 데이터 포인트는 5개의 기술적 반복실험과 3개의 생물학적 반복실험의 평균입니다. C) 뉴몰리신이 중단된 돌연변이 게놈 영역에 매핑된 시퀀싱 데이터. 프라이머는 화살표와 이름으로 표시됩니다. PLYSCN1 및 PLYSCN2는 상동성 암 외부에 결합합니다. 프라이머 PLYSCN1 및 2로부터 얻은 시퀀싱은 스펙티노마이신 카세트까지 상동성 영역 외부의 인접 영역에서 중단 없는 서열이 있음을 보여주었고, 이는 게놈에 삽입됨을 입증합니다. <a href="https://www-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/61594/61594fig02large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a>

Watch this Scientific Journal Video about Constructing Mutants in Serotype 1 Streptococcus pneumoniae strain 519/43 at JoVE.com

Constructing Mutants in Serotype 1 Streptococcus pneumoniae strain 519/43

여기에서 우리는 DNA와 자살 플라스미드를 자연적으로 획득하는 능력을 사용하여 유전자 변형될 수 있는 S. pneumoniae 혈청형 1 균주 519/43에 대해 설명합니다. 원리의 증거로서, pneumolysin (ply) 유전자의 동종 돌연변이가 만들어졌다.

혈청형 1 Streptococcus pneumoniae 균주 519/43에서 돌연변이 구성

Streptococcus pneumoniae serotype 1 remains a huge problem in low-and-middle income countries, particularly in sub-Saharan Africa. Despite its importance, ...

constructing-mutants-serotype-1-streptococcus-pneumoniae-strain

Universidad San Sebastian

Research

JoVE Journal

Immunology and Infection

Constructing Mutants in Serotype 1 Streptococcus pneumoniae strain 519/43

1.6K 조회수.  London School of Hygiene and Tropical Medicine. 여기에서 우리는 DNA와 자살 플라스미드를 자연적으로 획득하는 능력을 사용하여 유전자 변형될 수 있는 S. pneumoniae 혈청형 1 균주 519/43에 대해 설명합니다. 원리의 증거로서, pneumolysin (ply) 유전자의 동종 돌연변이가 만들어졌다.

비디오: Constructing Mutants in Serotype 1 Streptococcus pneumoniae strain 519/43

Generation of a Gene-disrupted Streptococcus mutans Strain Without Gene Cloning

Typical methods for the elucidation of the function of a particular gene involve comparative phenotypic analyses of the wild-type strain and a strain in which the gene of interest has been disrupted. A gene-disruption DNA construct containing a suitable antibiotic resistance marker gene is useful for the generation of gene-disrupted strains in bacteria. However, conventional construction methods, which require gene cloning steps, involve complex and time-consuming protocols. Here, a relatively facile, rapid, and cost-effective method for targeted gene disruption in Streptococcus mutans is described. The method utilizes a 2-step fusion polymerase chain reaction (PCR) to generate the disruption construct and electroporation for genetic transformation. This method does not require an enzymatic reaction, other than PCR, and additionally offers greater flexibility in terms of the design of the disruption construct. Employment of electroporation facilitates the preparation of competent cells and improves the transformation efficiency. The present method may be adapted for the generation of gene-disrupted strains of various species.

Generation of a Gene-disrupted Streptococcus mutans Strain Without Gene Cloning

We describe a facile, rapid, and relatively inexpensive method for the generation of gene-disrupted Streptococcus mutans strains; this technique may be adapted for the generation of gene-disrupted strains of various species.

유전자 교란 mutans 연쇄 상 구 균 긴장 없이 유전자 복제의 생성

Typical methods for the elucidation of the function of a particular gene involve comparative phenotypic analyses of the wild-type strain and a strain in ...

연구

유전학

Characterization of Inflammatory Responses During Intranasal Colonization with Streptococcus pneumoniae

Nasopharyngeal colonization by Streptococcus pneumoniae is a prerequisite to invasion to the lungs or bloodstream1. This organism is capable of colonizing the mucosal surface of the nasopharynx, where it can reside, multiply and eventually overcome host defences to invade to other tissues of the host. Establishment of an infection in the normally lower respiratory tract results in pneumonia. Alternatively, the bacteria can disseminate into the bloodstream causing bacteraemia, which is associated with high mortality rates2, or else lead directly to the development of pneumococcal meningitis. Understanding the kinetics of, and immune responses to, nasopharyngeal colonization is an important aspect of S. pneumoniae infection models.
Our mouse model of intranasal colonization is adapted from human models3 and has been used by multiple research groups in the study of host-pathogen responses in the nasopharynx4-7. In the first part of the model, we use a clinical isolate of S. pneumoniae to establish a self-limiting bacterial colonization that is similar to carriage events in human adults. The procedure detailed herein involves preparation of a bacterial inoculum, followed by the establishment of a colonization event through delivery of the inoculum via an intranasal route of administration. Resident macrophages are the predominant cell type in the nasopharynx during the steady state. Typically, there are few lymphocytes present in uninfected mice8, however mucosal colonization will lead to low- to high-grade inflammation (depending on the virulence of the bacterial species and strain) that will result in an immune response and the subsequent recruitment of host immune cells. These cells can be isolated by a lavage of the tracheal contents through the nares, and correlated to the density of colonization bacteria to better understand the kinetics of the infection.

Characterization of Inflammatory Responses During Intranasal Colonization with Streptococcus pneumoniae

Colonization of the murine nasopharynx with Streptococcus pneumoniae and the subsequent extraction of adherent or recruited cells is described. This technique involves flushing the nasopharynx and collection of the fluid through the nares and is adaptable for various readouts, including differential cell quantification and analysis of mRNA expression in situ.

연쇄상 구균 폐렴으로 비강 내 식민지 화 중 염증 반응의 특성화

Nasopharyngeal colonization by Streptococcus pneumoniae is a prerequisite to invasion to the lungs or bloodstream1. This organism is capable of colonizing ...

면역학 및 감염병학

Following in Real Time the Impact of Pneumococcal Virulence Factors in an Acute Mouse Pneumonia Model Using Bioluminescent Bacteria

Pneumonia is one of the major health care problems in developing and industrialized countries and is associated with considerable morbidity and mortality. Despite advances in knowledge of this illness, the availability of intensive care units (ICU), and the use of potent antimicrobial agents and effective vaccines, the mortality rates remain high1. Streptococcus pneumoniae is the leading pathogen of community-acquired pneumonia (CAP) and one of the most common causes of bacteremia in humans. This pathogen is equipped with an armamentarium of surface-exposed adhesins and virulence factors contributing to pneumonia and invasive pneumococcal disease (IPD). The assessment of the in vivo role of bacterial fitness or virulence factors is of utmost importance to unravel S. pneumoniae pathogenicity mechanisms. Murine models of pneumonia, bacteremia, and meningitis are being used to determine the impact of pneumococcal factors at different stages of the infection. Here we describe a protocol to monitor in real-time pneumococcal dissemination in mice after intranasal or intraperitoneal infections with bioluminescent bacteria. The results show the multiplication and dissemination of pneumococci in the lower respiratory tract and blood, which can be visualized and evaluated using an imaging system and the accompanying analysis software.

Streptococcus pneumoniae is the leading pathogen causing severe community-acquired pneumonia and responsible for over 2&#160;million deaths worldwide. The impact of bacterial factors implicated in fitness or virulence can be monitored in real-time in an acute mouse pneumonia or bacteremia model using bioluminescent bacteria.

생물 발광 박테리아를 사용하여 실시간으로 급성 폐렴 마우스 모델에서 폐렴 구균 독성 요인의 영향에 따라

Pneumonia is one of the major health care problems in developing and industrialized countries and is associated with considerable morbidity and mortality. ...

Capsular Serotyping of Streptococcus pneumoniae Using the Quellung Reaction

There are over 90 different capsular serotypes of Streptococcus pneumoniae (the pneumococcus). As well as being a tool for understanding pneumococcal epidemiology, capsular serotyping can provide useful information for vaccine efficacy and impact studies.&#160;The Quellung reaction is the gold standard method for pneumococcal capsular serotyping. The method involves testing a pneumococcal cell suspension with pooled and specific antisera directed against the capsular polysaccharide. The antigen-antibody reactions are observed microscopically. The protocol has three main steps: 1) preparation of a bacterial cell suspension, 2) mixing of cells and antisera on a glass slide, and 3) reading the Quellung reaction using a microscope. The Quellung reaction is reasonably simple to perform and can be applied wherever a suitable microscope and antisera are available.

Capsular Serotyping of Streptococcus pneumoniae Using the Quellung Reaction

The Quellung reaction is the gold standard technique for serotyping Streptococcus pneumoniae. This technique utilizes a microscope and specific pneumococcal antisera and is commonly used in reference and research laboratories worldwide.

의 캡슐 혈청 형<em&gt; 폐렴 구균</em&gt; Quellung 반응을 이용하여

There are over 90 different capsular serotypes of Streptococcus pneumoniae (the pneumococcus). As well as being a tool for understanding pneumococcal ...

Visualization of Streptococcus pneumoniae within Cardiac Microlesions and Subsequent Cardiac Remodeling

During bacteremia Streptococcus pneumoniae can translocate across the vascular endothelium into the myocardium and form discrete bacteria-filled microscopic lesions (microlesions) that are remarkable due to the absence of infiltrating immune cells. Due to their release of cardiotoxic products, S. pneumoniae within microlesions are thought to contribute to the heart failure that is frequently observed during fulminate invasive pneumococcal disease in adults. Herein is demonstrated a protocol for experimental mouse infection that leads to reproducible cardiac microlesion formation within 30 hr. Instruction is provided on microlesion identification in hematoxylin &#38; eosin stained heart sections and the morphological distinctions between early and late microlesions are highlighted. Instruction is provided on a protocol for verification of S. pneumoniae within microlesions using antibodies against pneumococcal capsular polysaccharide and immunofluorescent microscopy. Last, a protocol for antibiotic intervention that rescues infected mice and for the detection and assessment of scar formation in the hearts of convalescent mice is provided. Together, these protocols will facilitate the investigation of the molecular mechanisms underlying pneumococcal cardiac invasion, cardiomyocyte death, cardiac remodeling as a result of exposure to S. pneumoniae, and the immune response to the pneumococci in the heart.

Visualization of Streptococcus pneumoniae within Cardiac Microlesions and Subsequent Cardiac Remodeling

Streptococcus pneumoniae forms discrete non-purulent microscopic lesions in the heart. Outlined is the protocol for a murine model of cardiac microlesion formation. Instruction is provided on microlesion visualization using microscopy, discrimination between early and late microlesions, and methods to detect cardiac remodeling in hearts of convalescent animals.

시각화<em&gt; 폐렴 구균</em&gt; 심장 Microlesions 및 후속 심장 리모델링 내

During bacteremia Streptococcus pneumoniae can translocate across the vascular endothelium into the myocardium and form discrete bacteria-filled ...

의학

Replication of the Ordered, Nonredundant Library of Pseudomonas aeruginosa strain PA14 Transposon Insertion Mutants

Pseudomonas aeruginosa is a phenotypically and genotypically diverse and adaptable Gram-negative bacterium ubiquitous in human environments. P. aeruginosa is able to form biofilms, develop antibiotic resistance, produce virulence factors, and rapidly evolve in the course of a chronic infection. Thus P. aeruginosa can cause both acute and chronic, difficult to treat infections, resulting in significant morbidity in certain patient populations. P. aeruginosa strain PA14 is a human clinical isolate with a conserved genome structure that infects a variety of mammalian and nonvertebrate hosts making PA14 an attractive strain for studying this pathogen. In 2006, a nonredundant transposon insertion mutant library containing 5,459 mutants corresponding to 4,596 predicted PA14 genes was generated. Since then, distribution of the PA14 library has allowed the research community to better understand the function of individual genes and complex pathways of P. aeruginosa. Maintenance of library integrity through the replication process requires proper handling and precise techniques. To that end, this manuscript presents protocols that describe in detail the steps involved in library replication, library quality control and proper storage of individual mutants.

Replication of the Ordered, Nonredundant Library of Pseudomonas aeruginosa strain PA14 Transposon Insertion Mutants

Pseudomonas aeruginosa infection causes significant morbidity in vulnerable hosts. The nonredundant transposon insertion mutant library of P. aeruginosa strain PA14, designated as PA14NR Set, facilitates analysis of gene functionality in numerous processes. Presented here is a protocol to generate high-quality copies of the PA14NR Set mutant library.

주문, 녹 농 균 스트레인 PA14 Transposon 삽입 돌연변이의 비중복 라이브러리의 복제

Pseudomonas aeruginosa is a phenotypically and genotypically diverse and adaptable Gram-negative bacterium ubiquitous in human environments. P. aeruginosa ...

Homogeneous Glycoconjugate Produced by Combined Unnatural Amino Acid Incorporation and Click-Chemistry for Vaccine Purposes

Genetic code expansion is a powerful tool to introduce unnatural amino acids (UAAs) into proteins to modify their characteristics, to study or create new protein functions or to have access to protein conjugates. Stop codon suppression, in particular amber codon suppression, has emerged as the most popular method to genetically introduce UAAs at defined positions. This methodology is herein applied to the preparation of a carrier protein containing an UAA harboring a bioorthogonal functional group. This reactive handle can next be used to specifically and efficiently graft a synthetic oligosaccharide hapten to provide a homogeneous glycoconjugate vaccine. The protocol is limited to the synthesis of glycoconjugates in a 1:1 carbohydrate hapten/carrier protein ratio but amenable to numerous pairs of biorthogonal functional groups. Glycococonjugate vaccine homogeneity is an important criterion to ensure complete physico-chemical characterization, thereby, satisfying more and more demanding drug regulatory agency recommendations, a criterion which is unmet by classical conjugation strategies. Moreover, this protocol makes it possible to finely tune the structure of the actual conjugate vaccine, giving rise to tools to address structure-immunogenicity relationships.

Genetic code expansion is applied for the introduction of an unnatural amino acid bearing a biorthogonal functional group on a carrier protein at a defined site. The biorthogonal function is further used for the site-selective coupling of a carbohydrate antigen to provide a homogeneous glycoconjugate vaccine.

백신 목적을 위해 결합된 부자연스러운 아미노산 통합 및 클릭 화학에 의해 생성된 균일한 글리코콘주게이트

Genetic code expansion is a powerful tool to introduce unnatural amino acids (UAAs) into proteins to modify their characteristics, to study or create new ...

생체공학

Purification of a High Molecular Mass Protein in Streptococcus mutans

Elucidation of a gene&#39;s function typically involves comparison of phenotypic traits of wild-type strains and strains in which the gene of interest has been disrupted. Loss of function following gene disruption is subsequently restored by exogenous addition of the product of the disrupted gene. This helps to determine the function of the gene. A method previously described involves generating a gtfC gene-disrupted Streptococcus mutans strain. Here, an undemanding method is described for purifying the gtfC gene product from the newly generated S. mutans strain following the gene disruption. It involves the addition of a polyhistidine-coding sequence at the 3&#8242; end of the gene of interest, which allows simple purification of the gene product using immobilized metal affinity chromatography. No enzymatic reactions other than PCR are required for the genetic modification in this method. The restoration of the gene product by exogenous addition after gene disruption is an efficient method for determining gene function, which may also be adapted to different species.

Purification of a High Molecular Mass Protein in Streptococcus mutans

Described here is a simple method for the purification of a gene product in Streptococcus mutans. This technique may be advantageous in the purification of proteins, especially membrane proteins and high molecular mass proteins, and can be used with various other bacterial species.

연쇄상 구균 뮤탄에서 높은 분자 질량 단백질의 정화

Elucidation of a gene&#39;s function typically involves comparison of phenotypic traits of wild-type strains and strains in which the gene of interest has ...

Inducing Meningococcal Meningitis Serogroup C in Mice via Intracisternal Delivery

Neisseria meningitidis (meningococcus) is a narrow-host-range microorganism, globally recognized as the leading cause of bacterial meningitis. Meningococcus is a transient colonizer of human nasopharynx of approximately 10% of healthy subject. In particular circumstances, it acquires an invasive ability to penetrate the mucosal barrier and invades the bloodstream causing septicaemia. In the latest case, fulminating sepsis could arise even without the consequent development of meningitis. Conversely, bacteria could poorly multiply in the bloodstream, cross the blood brain barrier, reach the central nervous system, leading to fulminant meningitis. The murine models of bacterial meningitis represent a useful tool to investigate the host-pathogen interactions and to analyze the pathogenetic mechanisms responsible for this lethal disease. Although, several experimental model systems have been evaluated over the last decades, none of these were able to reproduce the characteristic pathological events of meningococcal disease. In this experimental protocol, we describe a detailed procedure for the induction of meningococcal meningitis in a mouse model based on the intracisternal inoculation of bacteria. The peculiar signs of human meningitis were recorded in the murine host through the assessment of clinical parameters (e.g., temperature, body weight), evaluation of survival rate, microbiological analysis and histological examination of brain injury. When using intracisternal (i.cist.) inoculum, meningococci complete delivery directly into cisterna magna, leading to a very efficient meningococcal replication in the brain tissue. A 1,000-fold increase of viable count of bacteria is observed in about 18 h. Moreover, meningococci are also found in the spleen, and liver of infected mice, suggesting that the liver may represent a target organ for meningococcal replication.

Here, we describe a method to induce meningococcal meningitis through an intracisternal route of infection in adult mice. We present a step by step protocol of meningococcal infection from the preparation of inoculum to the intracisternal infection; then record the animal survival and evaluate the bacterial loads in murine tissues.

인트스타스타스테어링 전달을 통해 마우스에서 수막구균 수막염 혈청계S C유도

Neisseria meningitidis (meningococcus) is a narrow-host-range microorganism, globally recognized as the leading cause of bacterial meningitis. ...

Generation of In-Frame Gene Deletion Mutants in Pseudomonas aeruginosa and Testing for Virulence Attenuation in a Simple Mouse Model of Infection

Microorganisms are genetically versatile and diverse and have become a major source of many commercial products and biopharmaceuticals. Though some of these products are naturally produced by the organisms, other products require genetic engineering of the organism to increase the yields of production. Avirulent strains of Escherichia coli have traditionally been the preferred bacterial species for producing biopharmaceuticals; however, some products are difficult for E. coli to produce. Thus, avirulent strains of other bacterial species could provide useful alternatives for production of some commercial products. Pseudomonas aeruginosa is a common and well-studied Gram-negative bacterium that could provide a suitable alternative to E. coli. However, P. aeruginosa is an opportunistic human pathogen. Here, we detail a procedure that can be used to generate nonpathogenic strains of P. aeruginosa through sequential genomic deletions using the pEX100T-NotI plasmid. The main advantage of this method is to produce a marker-free strain. This method may be used to generate highly attenuated P. aeruginosa strains for the production of commercial products, or to design strains for other specific uses. We also describe a simple and reproducible mouse model of bacterial systemic infection via intraperitoneal injection of validated test strains to test the attenuation of the genetically engineered strain in comparison to the FDA-approved BL21 strain of E. coli.

Generation of In-Frame Gene Deletion Mutants in Pseudomonas aeruginosa and Testing for Virulence Attenuation in a Simple Mouse Model of Infection

Here, we describe a simple and reproducible protocol of mouse model of infection to evaluate the attenuation of the genetically modified strains of Pseudomonas aeruginosa in comparison to the United States Food and Drug Administration (FDA)-approved Escherichia coli for commercial applications.

감염의 간단한 마우스 모델에서 녹농균 및 독성 감쇠에 대한 테스트에서 프레임 내 유전자 삭제 돌연변이의 생성

Microorganisms are genetically versatile and diverse and have become a major source of many commercial products and biopharmaceuticals. Though some of ...