저자는 기꺼이 마르타 Calatayud 아로요 (FWO 박사 친목-12N2815N) 플랑드르 연구 재단 으로부터 재정 지원을 인정 한다. 엠마 헤 르 난 데스-Sanabria 플랑드르 혁신 및 기업가 정신 (Agentschap voor Innovatie 문 Wetenschap en Technologie, IWT)에서 지 원하는 박사 후 연구원 이다.

1. 긴장 조건 문화
참고: 합성 구두 지역 사회는 일반적으로 구강 미생물3에 있는 긴장에 의해 구성 되었다.
<ol><li>미국 유형 문화 수집 (ATCC)에서 다음 종자를 얻기: Aggregatibacter actinomycetemcomitans (ATCC 43718), Fusobacterium nucleatum (ATCC 10953), Porphyromonas gingivalis (ATCC 33277), Prevotella intermedia (ATCC 25611), 연쇄 상 구 균 mutans (ATCC 25175), 연쇄 상 구 균 sobrinus (ATCC 33478),放 naeslundii (ATCC 51655), 연쇄 상 구 균 gordonii (ATCC 49818),放 viscosus (ATCC 15987), 그리고 연쇄 상 구 균 mitis (ATCC 49456).</li>
	<li>미생물의 라이프니츠 연구소 DSMZ-독일어 컬렉션 및 세포 배양 (DSM 2007), BCCM/LMG 박테리아 컬렉션 (LMG 14657)에서 구 sanguinis 에서 Veillonella parvula 취득 및 사용 연쇄 상 구 균 salivarius 변형 TOVE R9, 그리고 연쇄 상 구 균 oralis10.</li>
</ol>2. 개발 구강 미생물의 Multispecies 커뮤니티 담당자의
참고: 생체 외에서 창 자 상피에 구강 박테리아의 잠재적인 접착 능력을 시뮬레이션 하기 위해 합성 커뮤니티를 생성 합니다. 혈액 한 천 배지 에르난데스 Sanabria 외 에 설명 된 대로 5 μ g/mL hemin와 1 μ g/mL menadione, 5% 살 균 defibrinated 말 혈액 보충에 박테리아를 성장 (2017) 11. 간단히:
<ol><li>100mg 2 ml의 1 M NaOH hemin의 분해, 압력가 증류수 100 mL를 추가 합니다. 어두운 컨테이너에 저장 합니다. 0.22 μ m 필터를 통해 매체를 추가 하기 전에 소독.</li>
	<li>100mg menadione 96% 에탄올 20 mL에 용 해. 0.22 μ m 필터를 통해 매체를 추가 하기 전에 소독.</li>
	<li>혈액 한 천 매체의 1 리터를 준비 ( 재료의 표참조) 제조 업체의 지침 및 오토 클레이 브. 말 피와 보충 추가 하기 전에 식힙니다. 혼합 하 고 접시를 붓는 다.</li>
	<li>이전에 보고 된12수정된 두뇌 심 혼 주입 (BHI) 국물을 준비 합니다. 압력가 마로 소독 후 hemin의 5 μ g/mL와 menadione의 1 μ g/mL를 추가 합니다.</li>
	<li>Hungate 튜브에 매체의 9 mL를 분배 하 고 고무 마 개, 알루미늄 캡으로 닫습니다. N2/CO2 (90% / 10%)와 튜브를 플러시.</li>
	<li>혐 기성 매체의 1 mL 주사기로 검색 하 고 microcentrifuge 1.5 mL 튜브에. 각 세균성 종에의 한 식민지를 선택 하 고, 매체에서 resuspend 혐 기성 수정 된 BHI에 다시 전달. S. salivarius, 24 h에 대 한 인 큐베이 팅 해야 합니다을 제외 하 고 37 ° C에서 48 h에 품 어.</li>
	<li>
필요한 경우 가상 커뮤니티를 조립 하기 전에 문화의 순도 확인 합니다. 간단히:
	<ol>
<li>에르난데스-Sanabria 외 에서 액체 문화에서 DNA를 추출 (2010 년) 13 16S rRNA 유전자는 뇌관을 사용 하 여 증폭 27F (AGAGTTTGATYMTGGCTCAG) 및 1492R (TACGGYTACCTTGTTACGACT), 및 다음 프로그램: 95 ° C에서 5 분, 1 분 동안 95 ° C의 30 주기 55 ° C 1 분 1.5 분 동안 72 ° C 다음 최종 확장 단계 72 ° c.에 5 분의</li>
		<li>상업으로 PCR 제품을 정화 키트 ( 재료의 표참조), 제조업체의 지침에 따라.</li>
		<li>10 μ 총 볼륨의 0.5 μ를 포함 된 정제 제품의 시퀀싱 반응 수행 ( 재료의 표참조), M13f 뇌관 (CGCCAGGGTTTTCCCAGTCACGAC), 시퀀싱 버퍼, x 5와 20의 2.0 μ의 3.2 pmol 염색 ng 서식 파일의 사용 하는 상업적인 시퀀싱 시스템 키트 ( 재료의 표참조). 참고:이 절차를 상업적으로 실행 했습니다.</li>
		<li>모든 시퀀스 (http://blast.ncbi.nlm.nih.gov/Blast.cgi) 결정 하는 가장 가까운 알려진된 taxon 고 RDP 분류자 온라인 도구 (http://rdp.cme.msu.edu/)는 시 나를 사용 하 여 원래 긴장의 순서와 비교에서 폭발 검색을 수행 맞춤 서비스 (https://www.arb-silva.de/aligner/)입니다.</li>
	</ol>
</li>
	<li>에르난데스 Sanabria 외 에 설명 된 대로 cytometry 및 SYBR 녹색/Propidium 요오드 화물 얼룩을 사용 하 여 외피의 끝에 휴대폰 번호를 측정 (2017) 11. 문화-1105 셀 mL를 희석, BHI 수정 사용 하 여.</li>
	<li>혐 기성 BHI의 75 mL로 S. mitis 의 1 mL을 추가 하 고 고정 단계 (6 h)까지 품 어. 다음, 각 희석 긴장과 혐 기성 조건 하에서 혼합의 0.75 mL 수집 합니다.</li>
	<li>일단 모든 문화, 혼합 소 우주의 1 mL를 걸릴 고 BHI의 75 mL를 추가 합니다. 합성 커뮤니티 10% 이내를 품 어 CO2, 10% H2, 80% N2 48 h 37 ° C와 200 rpm ( 재료의 표참조).</li>
	<li>2.8에서 세포 밀도 측정 합니다. 전에 셀 모델을 커뮤니티 제시. 사회의 구성 양적 실시간 PCR, 뇌관을 사용 하 여 및 어 닐 링 온도 Slomka 외 의 표 1에서와 평가 될 수 있다 (2017) 10. 또한, 16S rRNA 유전자 amplicon 시퀀싱을 사용 하 여 초기 회원 현재13,14에 정보를 제공. 어느 정체성 확인 프로토콜에 대 한 템플릿으로 cDNA를 사용 하 여 적극적으로 속기 단백질, 박테리아를 나타냅니다 하 고 템플렛으로 DNA를 사용 하 여 긴장의 존재/부재를 공개.</li>
</ol>3. 일반 세포 배양 방법
주: 세포 배양의 일반적인 측면에 대 한 저자를 참조 마스터와 스테이 시 (2007 년)15. 유럽 컬렉션의 인증 셀 문화 (Caco-2 ECACC 86010202와 HT29-MTX-E12 ECACC 12040401, 공중 보건 영국, 영국)에서 사용 하는 셀 라인을 얻을. 세포 배양에 대 한 시 약을 구입할 수 있습니다 ( 테이블의 자료를 참조), 달리 지정 하지 않는 한.
<ol><li>
유지 보수 및 Caco-2와 HT29 MTX 셀 라인 뿌리고 참고: Caco-2와 HT29 MTX 셀 25 cm2 조직 배양 플라스 크 포함 하는 보충된 DMEM 매체 (표 1) 정기적으로 성장 된다. 60-70% 합류에 도달할 때 셀 trypsinized 있습니다.<ol>
<li>플라스 크에서 세포 배양 매체를 제거 합니다. /Mg Ca ++++없이 PBS의 5 mL로 두 번 세척.</li>
		<li>트립 신, 0.22 g/L 에틸렌 diamine tetraacetic 산 성 (EDTA)의 0.5 mg/L 해결책의 2 개 mL를 추가 합니다. 부드럽게 플라스 크를 이동 하 여 트립 신 솔루션을 배포 합니다. 1.5 mL의 트립 신 솔루션을 제거 하 고 10 분 동안 37 ° C에 플라스 크를 품 어.</li>
		<li>세포를 플라스 크 표면에서 분리는 현미경 아래에서 확인 하십시오. 필요한 경우 추가 5 분 동안 품 어.</li>
		<li>비활성화 된 트립 신을 플라스 크에 보충된 세포 배양의 5 mL를 추가 합니다. 균질 단일 셀 서 스 펜 션 여기저기를 피펫으로.</li>
		<li>즉시, 50 µ L 셀 서 스 펜 션의 aliquot 고 Caco-2 셀에 대 한 1:1 (v/v) 비율 또는 1:5 v/v HT29-MTX에 대 한 살 균 0.4 %Trypan 블루 솔루션 혼합. 세 실로 pipetting와 부하에 의해 혼합 ( 재료의 표참조).</li>
		<li>현미경 (흰색 밝은 셀) 가능한 셀의 개수 (제조 업체의 지침을 참조 하십시오).</li>
		<li>씨앗 1 x 104 셀/cm2, 4 × 105 셀/c m2 의 조밀도에 새로운 플라스 크에서 Caco-2, HT29-MTX, 각각. 참고: (1) Caco-2 셀 차별화 하 고 꽉 접합 한 번 도달 하는 confluency를 형성 한다. 오버-confluency trypsinization 전에 피하기 위해 매우 중요 하다. 자라 난 플라스 크에 세포의 trypsinization 또는 셀 덩어리 후 셀 분리 실패를 일으킬 수 있습니다. (2) HT29-MTX 세포는 점액을 생산 높은 신진 대사 활동16셀. 셀은 높은 밀도에서 하는 경우에 특히 이러한 기능 세포 배양의 빠른 산성화를 일으킬 수 있습니다. HEPES buffer (표 1) 7과 7.2 사이 pH를 유지 하기 위해 세포 배양에 추가할 수 있습니다. PH가 떨어지면, 매체 수 50% 미만 이다 교환 때 confluency. 그러나, 만약 confluency > 50%, 셀 문화 분할 해야 합니다.</li>
	</ol>
</li>
</ol>4. 창 자 미생물 호스트 인터페이스 시뮬레이션 Multicompartment 셀 모델의 조립
참고: 완료 스 더블 챔버 (직경 24mm, 기 공 크기 0.4 μ m; 참조 테이블의 재료) 공동 문화.
<ol><li>꼭대기 구획 및 2 mL에는 기저를 완전 한 세포 배양의 1.5 mL를 추가 합니다. 사전 시드 때 세포 현 탁 액의 분배를 20-30 분 동안 품 어.</li>
	<li>섹션 3에에서 설명 된 대로 Caco-2와 HT29 MTX의 세포 배양을 trypsinize. Trypsinization 절차 덩어리 없이 단일 셀 정지에서 두 셀 라인의 균일 분배를 달성 하기 위해 정확 하 게 따라야 합니다.</li>
	<li>3.1.8에 설명 된 대로 실행 가능한 세포를 계산.</li>
	<li>Caco-2/HT29-MTX 셀 90/10 비율에 104 셀/cm2 x 6.5에 셀 밀도 조정 합니다.</li>
	<li>셀 정지 균질 하 고 보충된 셀 문화 미디어와 함께 미리 채워진 살 균 컨테이너 Caco-2와 HT29 MTX 셀의 해당 볼륨을 추가 합니다. 포부에 의해 챔버의 꼭대기 쪽에서 미리 incubated 미디어를 제거 합니다.</li>
	<li>부드럽게 pipetting, 세포 현 탁 액을 혼합 하 고 챔버 삽입의 꼭대기 구획을 1.5 mL를 전송. 시드 절차 세포 현 탁 액의 일정 한 균질 세포 침전 하는 경향이 필요 합니다. 작업 속도 사용자의 경험에 따라 1-3 웰 스 분배 후 세포 현 탁 액을 혼합 해야 합니다.</li>
	<li>접시 부드럽게 뒤로 및 앞으로 이동 하 고 다음 오른쪽 왼쪽 오른쪽 (5-10 배)를 더 우물에서 세포의 확산. 인큐베이터에 전송 및 플레이트의 움직임을 반복.</li>
	<li>Caco-2/HT29-MTX 셀의 공동 문화를 유지 15 일 동안 상쾌한 꼭대기와 기저 구획 보충된 DMEM와 매 2 일. 이 시간 후, 세포 배양은 항생제/antimycotic 솔루션 없이 보충된 DMEM을 변경할 수 있습니다.</li>
	<li>20-21 일 후 매 2 일 매체를 새로 고쳐 시드까지 시스템을 유지 합니다.</li>
	<li>
분석 결과, 전기 저항 시스템을 사용 하 여 시작 하기 전에 상피 방 벽 완전성을 측정 (재료의 표 참조), 제조업체 지침에 따라.
	<ol>
<li>TEER 장비 완전히 충전 확인 (> 24 h) 측정을 시작 하기 전에.</li>
		<li>전원 공급 장치 및 플라스틱 압력솥 가방 커버에서 TEER 장비를 분리 합니다. 전극을 소개 하 고 미터에 입력된 포트에 연결 하기 위해 가방에 구멍을 확인 합니다. 70% 에탄올/물 (v/v) 흐름 캐비닛으로 TEER 장비를 도입 하기 전에 살포.</li>
		<li>전극 소독, 15 미 린스 미리 데워 진된 세포 배양에서 전극에 대 일 분 건조 공기를 허용에 대 한 70% 에탄올/물 (v/v) 솔루션에 전극 팁을 담가.</li>
		<li>인큐베이터에서 세포 고 흐름 캐비닛 내부 실내 온도에 서 세포 허용.</li>
		<li>미터는 충전기에서 분리 되 다는 것을 확인 하십시오. 옴을 차례 전원 스위치에 모드 스위치를 설정 합니다.</li>
		<li>전극 삽입에 짧은 팁 및 우물에서 더 이상 팁을 immersing 하 여 셀 저항을 측정 합니다. 플레이트 삽입을 90 ° 각도로 전극 유지.</li>
	</ol>
</li>
</ol>5. 세균 생존 체 외에서 위장 운송 조건에 따라
참고: 시뮬레이션된 소화 준비 Minekus 외 의 프로토콜에 따라 체액 (2014) 17, 아래 설명 된 수정. 초순 수와 모든 희석을 준비 합니다. 0.22 μ m 필터를 통해 모든 솔루션 필터 소독 하 고 메 마른 조건 하에서 소화 절차를 수행 합니다.
<ol><li>
구두 소화:
	<ol>
<li>세균성 지역 사회의 3 mL 50 mL 무 균 튜브에 배치, 모의 타 액 유체 (SSF), (m m o l L-1)에 포함 된 3 mL와 혼합: KCl, 15.1; KH2포4, 3.7; NaHCO3, 6.8; MgCl2(H2O)6, 0.5, (NH4) 공동3, 0.06; HCl, 1.1; CaCl2(H2O)2, 0.75. 인간 침 유형 IX A를 SSF 돼지 위 유형 II에서에서 2 g/L mucin의 α-아 밀라 제 75 U/mL를 추가 합니다.</li>
		<li>37 ° C, 및 100 rpm에서 2 분 동안 혼합물을 품 어. DNA 추출 및 흐름 cytometry 정량화 (S1) 2 mL 샘플을 수집 합니다.</li>
	</ol>
</li>
	<li>
위 소화:
	<ol>
<li>(M m o l L-1)에 포함 된 시뮬레이션된 위 액체 (SGF)의 4 개 mL를 추가: KCl, 6.9; KH2포4, 0.9; NaHCO3, 25; NaCl, 47.2; MgCl2(H2O)6, 0.1, (NH4) 공동3, 0.5; HCl, 15.6; CaCl2(H2O)2, 0.075. 또한,는 SGF 돼지 위 유형 II에서에서 mucin의 2 g/L를 포함 했다.</li>
		<li>PH를 측정 하 고 필요한 경우 3 1 M HCl로 pH를 조정 합니다. 37 ° C와 100 rpm에서 품 어. 2 mL 샘플 (S2)를 수집 합니다.</li>
	</ol>
</li>
	<li>
소장 소화:
	<ol>
<li>시뮬레이션 된 장 (SIF) 포함 하는 액체 (mmol L-1)에서 4 개 mL를 추가: KCl, 6.8; KH2포4, 0.8; NaHCO3, 85; NaCl, 38.4; MgCl2(H2O)6, 0.33; HCl, 8.4; CaCl2(H2O)2, 0.3; 소화 관.</li>
		<li>필요한 경우에 1 M NaOH로 pH 7 조정 합니다. 37 ° C와 100 rpm에서 품 어. 2 mL 샘플 (S3)를 수집 합니다.</li>
	</ol>
</li>
</ol>6. 세균성 식민지 능력 생체 외에서 위장 운송 조건에 따라
<ol><li>2 mL의 소장 소화 2650 x g에서 10 분 원심</li>
	<li>상쾌한을 제거 하 고 항생제와 antimycotic 없이 보충된 DMEM의 5 mL 세균 펠 릿 혼합.</li>
	<li>얼룩 및 교류 cytometer를 사용 하 여 그대로/손상 된 세포를 계량 (참조 테이블의 자료), 헤 르 난 데스-Sanabria 외 에 설명 된 대로 (2017) 11.</li>
	<li>항생제와 antimycotic 없이 보충된 DMEM에 희석 하 여 105 가능한 셀/mL로 세포 밀도 조정 합니다.</li>
	<li>Transwell 시스템의 꼭대기 매체를 제거 하 고 세균 현 탁 액의 1.5 mL를 추가 합니다. 공동 문화 일반 셀 문화 조건 (37 ° C, 습도 95%, 5% CO2)에서 2 시간에 대 한 시스템. 참고:이 시간까지 48 h, 필요한 실험 프로토콜에 따라 확장할 수 있습니다. 일상적인 셀 유지 관리를 위해 오염 방지 하는 데 사용 보다 다른 인큐베이터에서 공동 문화를 유지할 수 있습니다.</li>
	<li>4.11에 설명 된 대로 상피 방 벽의 무결성을 평가 하 부 화 후 TEER 값을 측정 합니다.</li>
	<li>보육 시간, 완료 되 면 꼭대기 미디어를 제거 하 고 추가 분석 (S4) 0.5 mL를 수집 합니다. 미디어의 subsample 젖 산 효소 (LDH) 분석 결과 의해 세포 생존 능력의 평가에 사용할 수 있습니다 ( 테이블의 자료를 참조), 제조업체 지침에 따라.</li>
	<li>HBSS (NAC-버퍼) HT29-MTX를 제작한 점액을 solubilize 및 준수 박테리아 복구 하에서 10 mM N acetylcysteine의 0.5 mL를 추가 합니다. 동요에서 1 h 동안 37 ° C에서 번호판을 품 어 (135 rpm 재료의 표참조).</li>
	<li>Microcentrifuge 튜브 (S5)에서 NAC HBSS 복구 하 고 1 mL DPBS 셀 두 번 씻어.</li>
	<li>0.5%의 0.5 mL을 추가 Triton X-100 (w/v) monolayers, 위에 pipetting으로 세포를 방해, 1 분 속도 세제와 세균성 세포의 손상을 방지 하려면 중요 한 액체와 소용돌이 복구.</li>
	<li>2650 x g, 5 분에 대 한 셀을 원심 하 고 상쾌한 (S6)와 펠 릿 (S7).</li>
</ol>7. 샘플 분석
참고: 분석 수집된 샘플 (S1-S7) 세균 생존 능력을 평가 하 고 잠재적인 시뮬레이션된 위장 소화 다음 창 자 세포에 접착.
<ol><li>세균성 생존: 0.45 μ m 통해 두 번 샘플 S1-s 5를 통과 하 고 계량 라이브/죽은 세포 얼룩을 사용 하 여 세균성 세포 단계 2.811에 표시 된 대로 cytometry, 흐름.</li>
	<li>
잠재적인 접착: 직렬 희석 (-1-8) S1-S6 준비 및 혈액 한 천에서 10 µ L 행진 및 BHI 접시를 수정. 24-48 h. 플레이트 undiluted S7의 같은 볼륨에 대 한 혐 기성 조건 하에서 37 ° C에서 품 어.
	<ol>
<li>준수 박테리아의 분류학 식별:<ol>
<li>문화 루프와 개별 식민지를 선택 하 고 각 nuclease 무료 물 10 µ L에 resuspend. 이 서 스 펜이 션의 4 µ L를 수집 하 고 뇌관 및 2.7.1에 설명 된 조건을 사용 하 여 16S rRNA 유전자의 PCR 증폭에 대 한 템플릿으로 사용.</li>
			<li>2.7.3, 2.7.4에 포함 된 절차를 사용 하 여 시퀀스의 유효성 검사에서 프로토콜에 따라 시퀀싱을 수행 합니다.</li>
		</ol>
</li>
	</ol>
</li>
	<li>할 등 총 DNA 추출, 정량 정량화 그리고/또한 16S rRNA amplicon 시퀀싱, RNA 추출, 원하는 대로 프로 파일링 transcriptomic 다운스트림 분석 추가. 참고: 흐름 cytometry 정량화 샘플링 후 즉시 수행 되었다. 멤브레인 permeabilized 세포에 대 한 컨트롤, 3 분 동안 70 ° C에 노출 샘플 사용 되었다. 배경 잡음 소화 액체 또는 세균 없이 셀 문화 모델에서 얻은 샘플 cytometry로 측정 하 여 평가 되었다. 모든 샘플 3 중에서 측정 했다.</li>
</ol>

<ol>
	<li>Sender, R., Fuchs, S., Milo, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Revised+estimates+for+the+number+of+human+and+bacteria+cells+in+the+body.">Revised estimates for the number of human and bacteria cells in the body.</a> PLoS Biology. 14, e1002533 (2016).</li><li>Kelly, D., King, T., Aminov, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Importance+of+microbial+colonization+of+the+gut+in+early+life+to+the+development+of+immunity.">Importance of microbial colonization of the gut in early life to the development of immunity.</a> Mutation Research-Fundamental and Molecular Mechanisms of Mutagenesis. , 58-69 (2007).</li><li>Aas, J. A., Paster, B. J., Stokes, L. N., Olsen, I., Dewhirst, F. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Defining+the+normal+bacterial+flora+of+the+oral+cavity.">Defining the normal bacterial flora of the oral cavity.</a> Journal of Clinical Microbiology. 43, 5721-5732 (2005).</li><li>Marsh, P. D., Head, D. A., Devine, D. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dental+plaque+as+a+biofilm+and+a+microbial+community-Implications+for+treatment.">Dental plaque as a biofilm and a microbial community-Implications for treatment.</a> Journal of Oral Biosciences. 57, 185-191 (2015).</li><li>Socransky, S. S., Haffajee, A. D., Cugini, M. A., Smith, C., Kent, R. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microbial+complexes+in+subgingival+plaque.">Microbial complexes in subgingival plaque.</a> Journal of Clinical Periodontology. 25, 134-144 (1998).</li><li>Haffajee, A. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Subgingival+microbiota+in+healthy,+well-maintained+elder+and+periodontitis+subjects.">Subgingival microbiota in healthy, well-maintained elder and periodontitis subjects.</a> Journal of Clinical Periodontology. 25, 346-353 (1998).</li><li>Venema, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microbial+metabolites+produced+by+the+colonic+microbiota+as+drivers+for+immunomodulation+in+the+host.">Microbial metabolites produced by the colonic microbiota as drivers for immunomodulation in the host.</a> The FASEB Journal. 27, (2013).</li><li>Marzorati, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+HMI+(TM)+module:+A+new+tool+to+study+the+Host-Microbiota+Interaction+in+the+human+gastrointestinal+tract+in+vitro.">The HMI (TM) module: A new tool to study the Host-Microbiota Interaction in the human gastrointestinal tract in vitro.</a> BMC Microbiology. 14, 133 (2014).</li><li>Tanzer, J. M., Kurasz, A. B., Clive, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Competitive+displacement+of+mutans+streptococci+and+inhibition+of+tooth-decay+by+Streptococcus-Salivarius+Tove-R.">Competitive displacement of mutans streptococci and inhibition of tooth-decay by Streptococcus-Salivarius Tove-R.</a> Infection and Immunity. 48, 44-50 (1985).</li><li>Slomka, V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nutritional+stimulation+of+commensal+oral+bacteria+suppresses+pathogens:+the+prebiotic+concept.">Nutritional stimulation of commensal oral bacteria suppresses pathogens: the prebiotic concept.</a> Journal of Clinical Periodontology. 44, 344-352 (2017).</li><li>Hernandez-Sanabria, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vitro+increased+respiratory+activity+of+selected+oral+bacteria+may+explain+competitive+and+collaborative+interactions+in+the+oral+microbiome.">In vitro increased respiratory activity of selected oral bacteria may explain competitive and collaborative interactions in the oral microbiome.</a> Frontiers in Cellular and Infection Microbiology. 7, 235 (2017).</li><li>Alvarez, G., Gonzalez, M., Isabal, S., Blanc, V., Leon, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Method+to+quantify+live+and+dead+cells+in+multi-species+oral+biofilm+by+real-time+PCR+with+propidium+monoazide.">Method to quantify live and dead cells in multi-species oral biofilm by real-time PCR with propidium monoazide.</a> AMB Express. 3, (2013).</li><li>Ehsani, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Initial+evenness+determines+diversity+and+cell+density+dynamics+in+synthetic+microbial+ecosystems.">Initial evenness determines diversity and cell density dynamics in synthetic microbial ecosystems.</a> Scientific Reports. 8, 340 (2018).</li><li>Hernandez-Sanabria, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Correlation+of+particular+bacterial+PCR-denaturing+gradient+gel+electrophoresis+patterns+with+bovine+ruminal+fermentation+parameters+and+feed+efficiency+traits.">Correlation of particular bacterial PCR-denaturing gradient gel electrophoresis patterns with bovine ruminal fermentation parameters and feed efficiency traits.</a> Applied and Environmental Microbiology. 76, 6338-6350 (2010).</li><li>Masters, J. R., Stacey, G. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Changing+medium+and+passaging+cell+lines.">Changing medium and passaging cell lines.</a> Nature Protocols. 2, 2276-2284 (2007).</li><li>Calatayud, M., Velez, D., Devesa, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Metabolism+of+inorganic+arsenic+in+intestinal+epithelial+cell+lines.">Metabolism of inorganic arsenic in intestinal epithelial cell lines.</a> Chemical Research in Toxicology. 25, 2402-2411 (2012).</li><li>Minekus, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+standardised+static+in+vitro+digestion+method+suitable+for+food+-+an+international+consensus.">A standardised static in vitro digestion method suitable for food - an international consensus.</a> Food &amp; Function. 5, 1113-1124 (2014).</li><li>Berney, M., Hammes, F., Bosshard, F., Weilenmann, H. U., Egli, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Assessment+and+interpretation+of+bacterial+viability+by+using+the+LIVE/DEAD+BacLight+kit+in+combination+with+flow+cytometry.">Assessment and interpretation of bacterial viability by using the LIVE/DEAD BacLight kit in combination with flow cytometry.</a> Applied and Environmental Microbiology. 73, 3283-3290 (2007).</li><li>Props, R., Monsieurs, P., Mysara, M., Clement, L., Boon, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Measuring+the+biodiversity+of+microbial+communities+by+flow+cytometry.">Measuring the biodiversity of microbial communities by flow cytometry.</a> Methods in Ecology and Evolution. 7, 1376-1385 (2016).</li><li>Yamashita, Y., Takeshita, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+oral+microbiome+and+human+health.">The oral microbiome and human health.</a> Journal of Oral Science. 59, 201-206 (2017).</li><li>Wade, W. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+oral+microbiome+in+health+and+disease.">The oral microbiome in health and disease.</a> Pharmacological Research. 69, 137-143 (2013).</li><li>Yu, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+resource+for+cell+line+authentication,+annotation+and+quality+control.">A resource for cell line authentication, annotation and quality control.</a> Nature. 520, 307 (2015).</li><li>Pelaseyed, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+mucus+and+mucins+of+the+goblet+cells+and+enterocytes+provide+the+first+defense+line+of+the+gastrointestinal+tract+and+interact+with+the+immune+system.">The mucus and mucins of the goblet cells and enterocytes provide the first defense line of the gastrointestinal tract and interact with the immune system.</a> Immunological Reviews. 260, 8-20 (2014).</li><li>Bengoa, A. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Simulated+gastrointestinal+conditions+increase+adhesion+ability+of+Lactobacillus+paracasei+strains+isolated+from+kefir+to+Caco-2+cells+and+mucin.">Simulated gastrointestinal conditions increase adhesion ability of Lactobacillus paracasei strains isolated from kefir to Caco-2 cells and mucin.</a> Food Research International. 103, 462-467 (2018).</li><li>Kleiveland, C. R., et al., Verhoeckx, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> The Impact of Food Bioactives on Health: in vitro and ex vivo models. , 197-205 (2015).</li><li>Laparra, J. M., Sanz, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparison+of+in+vitro+models+to+study+bacterial+adhesion+to+the+intestinal+epithelium.">Comparison of in vitro models to study bacterial adhesion to the intestinal epithelium.</a> Letters in Applied Microbiology. 49, 695-701 (2009).</li><li>Gagnon, M., Berner, A. Z., Chervet, N., Chassard, C., Lacroix, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparison+of+the+Caco-2,+HT-29+and+the+mucus-secreting+HT29-MTX+intestinal+cell+models+to+investigate+Salmonella+adhesion+and+invasion.">Comparison of the Caco-2, HT-29 and the mucus-secreting HT29-MTX intestinal cell models to investigate Salmonella adhesion and invasion.</a> Journal of Microbiological Methods. 94, 274-279 (2013).</li><li>Gro&#223;kopf, T., Soyer, O. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Synthetic+microbial+communities.">Synthetic microbial communities.</a> Current Opinion in Microbiology. 18, 72-77 (2014).</li></ol>

저자 공개할 게 없다

구강 미생물은 최근에 여러 작가20,21에서 보고 하는 인간의 건강에는 핵심 요소입니다. 이전 결과 큰 중 박테리아를 포함 하는 타 액의 섭취는 작은 창 자, 면역 못쓰게에 대 한 주요 사이트 중 하나입니다의 미생물 생태계 영향을 미칠 수 좋습니다. 호스트 인터페이스는 미생물에 구성 요소는 호스트의 영향을 해명 하기 봉사 장 상피 및 점액 분 비 세포에 의해 표현 정적 위 위장 소화 모델의 조합.
생체 외에서 모델 연구, 기계 론 적인 연구를 실시 하 고 배경 지식을 줄이기 위해, 의도 달성에 대 한 허용 더 효율적이 고 더 나은 대상 vivo에서 연구 위한 기본적인 도구입니다. 이러한 이유로, 그것은 순도, 생존 능력, 그리고 합성 미생물 지역 사회를 설치 하기 전에 axenic 문화의 최적의 성장을 위해 중요 한. 생존 능력 및 분석에 편견을 피하기 위해 셀 문화에 노출 하기 전에 세균 커뮤니티의 구성 하는 것이 좋습니다. 손상 된 박테리아의 높은 수 접착을 방해 하 고 더 셀 모델의 무결성에 영향을 줄 수 있습니다. 또한, 셀 라인의 trustable 소스를 사용 하 여 셀 라인 오인, 오염, 그리고 가난한 주석, 실험의 재현성22강화를 최소화 합니다.
점액과 mucins 제공 위장23의 첫 번째 방어 라인 점액 생성 세포를 포함 하 여 작은 창 자에 닮 았을 수 있습니다. 또한, 점 막 레이어 세균성 식민, 세균성 대사 산물의 특성화 양자 전송 허용 위해 적당 하다. 또한, 시뮬레이션된 위장 조건 Caco-2, mucin24, 우리의 모델에서 소화 프로세스 통합의 관련성을 지 원하는 유산 균 paracasei 긴장의 접착 능력을 증가.
모델에서 더 개선 이전 검토25면역 호스트 구성 요소를 통합 하 소개 될 수 있습니다. 그러나, 상피와 면역 세포의 현재 공동 문화 시스템 사용 되지 않은 호스트-미생물 상호 작용 있는 응용 프로그램 (예: 식품 생리 활성 화합물 또는 probiotics의 평가), 그 시스템 부족 수 있습니다. 나타낼 수 있습니다. 재현성25.
Caco-2, HT29-MTX 또는 공동 문화 이전 연구 평가 probiotic 또는 포유류 세포26,27병원 성 긴장의 접착. 얼룩을 사용 하 여 단일 또는 몇 가지 미생물의 수 있습니다 제공 제한 개요 호스트 미생물에 상호 작용 하 고 그것은 인간의 위장의 복잡성의 대표. 자연 미생물 커뮤니티의 사용 될 수 있지만 vivo에서 시나리오의 대표, 그들은 characterise 공부 하기가 어렵습니다. 반면, 우리의 방법론은 복잡 하 고 대표 축소판을 사용 하 여 여러 호스트-미생물 상호작용 평가의 기회를 제공 합니다. 정의 된 합성 미생물 커뮤니티의 사용은 감소 된 복잡성28으로 시스템의 세대에 대 한 수 있습니다. 지역 사회에 있는 변화는 개별 실험의 맥락에서 microenvironmental 조건의 결과 수 있습니다. 따라서,이 모델의 미생물 구성 요소 확장할 수 있습니다 쉽게 위 또는 아래로 deconstructing 선택적인 힘으로 환경에 미치는 영향에 대 한. 마지막으로, 샘플링 접근성 보장 추가 인간의 세포와 관련 된 미생물 지역 사회 둘 다의 기능 활동의 특성.
지난 몇 년 동안, organoid 기술 기반 새로운 시험관에 모델 개발 되었습니다. Organoids는 대표 주 조직의 주요 기능 중 일부를 통합 하는 3 차원 세포 배양. 장 organoids는 공부 하는 성인 줄기 세포와 조직에 대 한 근처 생리 적 시스템, 비록 같은 모델은 또한 몇 가지 제한 사항이 있다. 장 organoids 사용 제한에 그들은 면역 세포 부족으로 감염이 나 약물, 선 동적인 응답을 닮은. 또한, organoids는 생존 능력, 크기, 모양, 표현 형 검사 및 표준화 복잡 한 렌더링을 방해한에 관한 이종. 생체 외에서 건강 한 조직이의 모델링에 대 한 불멸 하 게 셀 라인의 제한에도 불구 하 고 잘 특징이 고 안정적인 셀 라인의 사용 또한 장점이 반복성, 재현성, 및 낮은 비용으로 있습니다. 이러한 혜택의 여러 조건, 동시 상영에 대 한 허용 하지만 데이터의 변환 사용 논란. 1 차 셀 vivo에서 생리학;의 대표 될 수 있습니다. 그러나, 그들은 높은 간 개별 가변성, 완전히 특징 되지 않습니다, 이기종는 있고 제한 된 시간 범위. 이러한 요소는 여러 조건을 포함 한 단점이 또는 한 분석 결과에서 복제.
복잡 한 미생물 지역 사회와 세포를 결합 하는 것은 도전 대표 수 있습니다, 우리 대표까지 높은 유연성과 적응성 기본 셀 장비, 실험실에서 재현 하 고 반복 가능한 모델을 개발에 초점 모델 사용 가능 하 고 잘 특징 되었다. 우리는 상부 위 장관에 probiotic 행동 평가 및 특성화 xenobiotic 영향 용기 인터페이스에 대 한 예를 들어, multicompartment이 모델을 사용 하 여 다양 한 세균성 지역 사회 기능을 평가 했습니다. 따라서, 우리 probiotics, 마약, 또는 관련 및 정의 된 생체 외에서 생태계 내에서 식품 화합물의 광범위 한 추가 분석에 대 한 기반으로이 모델을 제안합니다.

인간은 인간 세포1와 동일한 수에 존재 하는 박테리아와 함께 동서. 따라서, 그것은 중요 한의 인간의 미생물에 대 한 포괄적인 이해를 얻기 위해 중요 한입니다. 그것은 나누어 여러 작은 서식 지, 따라서 박테리아와 그 다른 위치에 biofilms의 큰 다양성을 포함 하는 구강 독특한 환경입니다. 오픈 생태계를 되 고, 입에서 일부 수 종은 일시적인 방문자 수 있습니다. 그러나, 특정 미생물 식민지 탄생과 형태 구성 biofilms2후에 빨리. 이들은 gingival 틈새, subgingival 틈새, 혀, 점 막 표면 및 치과 보 철 및 충전 재3위에 치아 표면에서 발견 된다. 박테리아로 flocs 치아 운하의 루멘에 있는 planktonic 세포 괴 사 성 펄프 조직 개 및 액체 단계에서 중단에 있을 수 있습니다.
호스트 셀과 주민 microbiota4간의 활성화, 지속적인 간 이야기가 있다. 박테리아 통신 시간과 사이 종, 그리고 다른 박테리아 이러한 기본 colonizers에 연결 하는 동안 자연 식민지 개척자의 작은 비율만 조직에 고착 할 수 있다. 예를 들어, 미생물 간의-셀 바인딩 구두 biofilms에 보조 식민지 개척자를 통합 하 고 상호 작용 미생물 세포4의 복잡 한 네트워크 구축에 대 한 키입니다. 약 타 액 샘플에서 박테리아의 70%는 Porphyromonas sp., 연쇄 상 구 균 sp., Prevotella sp., Veillonella sp., 그리고 알 수 없는 Bacteroidetes에 의해 형성 된다. F. nucleatum subgingival biofilm에 늦은 colonizers P. gingivalis, T. denticola, 및 Tannerella 개나리, 염5연루와 집계는 중간 식민지 개척자입니다. 또한, 연쇄 상 구 균 mitis S. sanguinis 그리고 S. gordonii 치아3식민지 선호 점 막 및 치과 서식 지를 차지 합니다. 따라서, S. sanguinis 이다 더 낮은 앞 니와 송곳에 동안放 naeslundii 위 anteriors6에서 발견 되었습니다.
더하여, 토착 미생물2인간의 건강 유지 하는 역할을 재생 합니다. 주민 microbiota 참여 면역 교육에서 및 병원 체 확장을 방지 합니다. 이 식민 저항 표면에 부착에 적응 그리고 더 효율적으로 성장에 대 한 사용할 수 있는 영양분을 metabolising 네이티브 박테리아 더 있을 수 있습니다 때문에 발생 합니다. Probiotic 긴장 살아남을 위장 통과 하 고 활성 상태로 유지, 위장의 위 위치에서 삼 autochthonous 박테리아의 지 속성 없는 완전히 설명 하고있다. 따라서, 우리 시뮬레이션 된 위장 운송 조건 인공 커뮤니티, 대표 구두 생태계의 대상이. 세균성 세포의 생존 능력은 창 자 상피를 닮은 multicompartment 모델을 사용 하 여 평가 했다. 현재 창 시뮬레이터 luminal 미생물 커뮤니티7의 분석 측면에서 적합 한 재현성을 제공합니다. 그러나, 세균성 접착 및 호스트 미생물 상호 작용은 별도로 해결,8도전 미생물 지역 사회와 세포를 결합 하는으로. 반면, 우리는 성공적인 식민 이벤트 창 인터페이스에 보고의 잠재적인 기계 설명을 제공 하는 프레임 워크를 제시. 실제로,이 모델 사용할 수 있습니다 공동으로 정적 용기 모델 호스트 표면 신호에 미생물 커뮤니티의 영향을 평가 하기 위해.

<table><tbody><tr><td>&lt;strong&gt;STRAINS&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>&lt;em&gt;Aggregatibacter actinomycetemcomitans &lt;/em&gt;</td><td>American Type Culture Collection</td><td>ATCC 43718</td><td></td></tr><tr><td>&lt;em&gt;Fusobacterium nucleatum &lt;/em&gt;</td><td>American Type Culture Collection</td><td>ATCC 10953</td><td></td></tr><tr><td>&lt;em&gt;Porphyromonas gingivalis &lt;/em&gt;</td><td>American Type Culture Collection</td><td>ATCC 33277</td><td></td></tr><tr><td>&lt;em&gt;Prevotella intermedia &lt;/em&gt;</td><td>American Type Culture Collection</td><td>ATCC 25611</td><td></td></tr><tr><td>&lt;em&gt;Streptococcus mutans &lt;/em&gt;</td><td>American Type Culture Collection</td><td>ATCC 25175</td><td></td></tr><tr><td>&lt;em&gt;Streptococcus sobrinus &lt;/em&gt;</td><td>American Type Culture Collection</td><td>ATCC 33478</td><td></td></tr><tr><td>&lt;em&gt;Actinomyces viscosus &lt;/em&gt;</td><td>American Type Culture Collection</td><td>ATCC 15987</td><td></td></tr><tr><td>&lt;em&gt;Streptococcus salivarius&amp;nbsp; TOVE-R&lt;/em&gt;</td><td></td><td></td><td></td></tr><tr><td>&lt;em&gt;Streptococcus mitis &lt;/em&gt;</td><td>American Type Culture Collection</td><td>ATCC 49456</td><td></td></tr><tr><td>&lt;em&gt;Streptococcus sanguinis &lt;/em&gt;</td><td>BCCM/LMG Bacteria Collection</td><td>LMG 14657</td><td></td></tr><tr><td>&lt;em&gt;Veillonella parvula &lt;/em&gt;</td><td>Leibniz Institute DSMZ-German Collection of Microorganisms and Cell Cultures</td><td>DSM 2007</td><td></td></tr><tr><td>&lt;em&gt;Streptococcus gordonii &lt;/em&gt;</td><td>American Type Culture Collection</td><td>ATCC 49818</td><td></td></tr><tr><td>&lt;strong&gt;CELL LINES&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>Caco-2 cells</td><td>European Collection of Authenticated Cell Cultures</td><td>86010202</td><td></td></tr><tr><td>HT29-MTX cells</td><td>European Collection of Authenticated Cell Cultures</td><td>12040401</td><td></td></tr><tr><td>&lt;strong&gt;REAGENTS AND CONSUMABLES&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>Brain Heart Infusion (BHI) broth</td><td>Oxoid</td><td>CM1135</td><td></td></tr><tr><td>Blood Agar 2</td><td>Oxoid</td><td>CM0055</td><td>Blood Agar medium</td></tr><tr><td>Menadione</td><td>Sigma</td><td>M9429</td><td></td></tr><tr><td>Hemin</td><td>Sigma</td><td>H9039</td><td></td></tr><tr><td>5% sterile defibrinated horse blood</td><td>E&amp;amp;O Laboratories Ltd,</td><td>P030</td><td></td></tr><tr><td>InnuPREP PCRpure Kit</td><td>Analytik Jena</td><td>845-KS-5010250</td><td>PCR purification kit</td></tr><tr><td>Big Dye</td><td>Applied Biosystems</td><td>4337454</td><td>Dye for sequencing</td></tr><tr><td>ABI Prism BigDye Terminator v3.1 cycle sequencing kit</td><td>Applied Biosystems</td><td>4337456</td><td></td></tr><tr><td>SYBR&amp;nbsp;Green I</td><td>Invitrogen</td><td>S7585</td><td></td></tr><tr><td>Propidium Iodide</td><td>Invitrogen</td><td>P1304MP</td><td></td></tr><tr><td>T25 culture flasks uncoated, cell-culture treated, vented, sterile</td><td>VWR</td><td>734-2311</td><td></td></tr><tr><td>Trypsin-EDTA solution</td><td>Sigma-Aldrich</td><td>T3924-100ML</td><td></td></tr><tr><td>Trypan Blue solution&lt;br/&gt; 0.4%, liquid, sterile-filtered</td><td>Sigma-Aldrich</td><td>T8154&amp;nbsp;</td><td></td></tr><tr><td>PBS</td><td>Gibco</td><td>14190250</td><td></td></tr><tr><td>DMEM cell culture media, with GlutaMAX and Pyruvate</td><td>Life technologies</td><td>31966-047</td><td></td></tr><tr><td>Corning Transwell polyester membrane cell culture inserts</td><td>Sigma-Aldrich</td><td>CLS3450-24EA</td><td></td></tr><tr><td>Mucin from porcine stomach Type II&amp;nbsp;&amp;nbsp;</td><td>Sigma-Aldrich</td><td>M2378</td><td></td></tr><tr><td>Inactivated fetal bovine serum</td><td>Greiner Bio One</td><td>758093</td><td></td></tr><tr><td>Antibiotic-Antimycotic (100X)</td><td>Gibco</td><td>15240062</td><td></td></tr><tr><td>Triton X 100 for molecular biology</td><td>Sigma-Aldrich</td><td>T8787&amp;nbsp;</td><td></td></tr><tr><td>DPBS without calcium, magnesium</td><td>Gibco</td><td>14190-250</td><td></td></tr><tr><td>Pierce LDH Cytotoxicity Assay Kit</td><td>Thermo Fisher Scientific</td><td>88953</td><td></td></tr><tr><td>Corning HTS Transwell-24 well, pore size 0.4 &amp;micro;m</td><td>Corning Costar Corp</td><td>3450</td><td></td></tr><tr><td>Nuclease-free water</td><td>Serva Electrophoresis</td><td>28539010</td><td></td></tr><tr><td>&lt;strong&gt;EQUIPMENT&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>Neubauer counting chamber improved</td><td>Carl Roth</td><td>T729.1</td><td></td></tr><tr><td>BD Accuri C6 Flow cytometer</td><td>BD Biosciences</td><td>653118</td><td></td></tr><tr><td>PowerLyzer 24 Homogenizer</td><td>MoBio</td><td>13155</td><td></td></tr><tr><td>T100 Thermal Cycler</td><td>BioRad</td><td>186-1096</td><td></td></tr><tr><td>Flush system</td><td>Custom made</td><td>-</td><td></td></tr><tr><td>InnOva 4080 Incubator Shaker</td><td>New Brunswick Scientific</td><td>8261-30-1007</td><td>Shaker for 2.10</td></tr><tr><td>Memmert CO&lt;sub&gt;2&lt;/sub&gt; incubator</td><td>Memmert GmbH &amp;amp; Co.</td><td>ICO150med</td><td></td></tr><tr><td>Millicell ERS (Electrical Resistance System)</td><td>EMD Millipore, Merck KGaA</td><td>MERS00002</td><td></td></tr><tr><td>Millipore Milli-Q academic, ultra pure water system</td><td>Millipore, Merck KGaA</td><td>-</td><td></td></tr><tr><td>Shaker (ROCKER 3D basic)</td><td>IKA</td><td>4000000</td><td>Shaker for 6.10</td></tr></tbody></table>

assessing the viability of a synthetic bacterial consortium on the in vitro gut host-microbe interface

호스트와 microbiota 사이 상호 작용은 오랫동안 인식 하 고 광범위 하 게 설명. 입 주민 microbiota 발생 하 고 외 인 박테리아에 의해 식민을 방지, 위장의 다른 섹션와 비슷합니다. 사실, 구강에서 발견 되는 박테리아의 600 이상 종 그리고 하나의 개별 약 100 다른 언제 든 지가지고 있습니다. 구강 박테리아 상주 미생물 지역 사회, 및 호의 보이는 성장 및 생존 통합 되 고 따라서 구강 생태계에서 다양 한 틈새에 고착 하는 기능을가지고 있습니다. 그러나, 삼 키는 동안 창 자에 박테리아의 흐름은 본질적인 microbiota의 균형을 방해 제시 되었다. 사실, P. gingivalis 의 구강 관리 ileal microflora에 세균성 구성 이동. 우리 사용 합성 커뮤니티 자연 구두 생태계의 단순화 표현으로 생존 및 시뮬레이션 된 위장 운송 조건을 복종 구강 박테리아의 생존 능력을 명료 하 게. 14 종 선택, 하 체 외에 타 액, 위, 장 소화 프로세스를 받게 되었고 Caco-2와 HT29 MTX 시뮬레이션 창 자 점 막 상피 세포를 포함 하는 multicompartment 세포 모델을 제시. 이 모델 장 순환에 관련 된 세포에 삼 킨된 박테리아의 영향을 해명 하기 제공. 가상 커뮤니티를 사용 하 여 제어 및 재현성에 대 한 수 있습니다. 따라서,이 방법론 병원 체 생존 능력 및 염증 관련 된 변경, probiotic 혼합물의 식민 용량 평가에 적용할 수 있습니다 그리고 궁극적으로, 잠재적인 박테리아 presystemic 순환에 영향을 미치는.

이 프로토콜 elucidating 생존 및 시뮬레이션 된 위장 운송 조건을 복종 구강 박테리아의 생존에 적합 한 모델의 생성에 지도 한다. 개별 긴장에서 그대로 셀의 개수는 약 108 세포 mL-1 사전 커뮤니티 (의 설립 동안 실행 가능한 세포의 90% 이상 포함 된 multispecies 소 하면서 합성 공동체의 창조 그림 1A 및 1B). 라이브/죽은 부 량을 바탕으로, 세균 생존 능력 (그림 2) 각 소화 단계 후 감소 합니다. 이것의 위 통과 하는 동안 산 성 pH와 생리 적인 조건 하에서 발생으로 소장 소화 유체에 포함 된 담 즙 염의 결과 수 있습니다. 체 외에서 그리고 vivo에서 모두 위장 소화를 통해 운송 중 생존 환경 변화에 따라 달라질 수 있습니다 (예: 대 먹이 조건 금식), 또는 심지어 박테리아 보호 프로세스 (포자 형성 또는 장 용 코팅)입니다.
흐름 cytometric 조사 열 살해 박테리아 등 배경 샘플, 정확한 가능한 셀 부 량18을 수행 하기 위해 적합 한 컨트롤과 비교 해야 합니다. 위장과 소장 소화의 가혹한 조건 라이브 박테리아가 할 하지 성장 또는 분할 가능한 하지만 비 culturable 세포에 박테리아를 전환할 수 있습니다. 이러한 이유로, 접시 수 cytometry 취득 가능한 셀 계산에서 다. 예를 들어, 그림 3, 점 막 인터페이스에서 복구 가능한 셀 흐름 cytometry 플롯에 파란색에서 색깔은. 그러나, 성장이 이러한 점액 샘플 도금된 (결과 표시 되지 않음)를 했다 하는 때 관찰 되었다.
분수는 박테리아 더 높은 생존 율을 보여 세포질 파편 (S7), (그림 4)를 계산 하는 격판덮개에 의해 밝혀입니다. 식민지의 수 변수를 있을 수 있습니다 하지만 metabolically 활성 박테리아의 존재는 덜 희석된 샘플에서 발견 된다.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/57699/57699fig1.jpg"> 그림 1: 체 외에서 위장 소화의 시작 부분에 multispecies 미생물 커뮤니티를 구성 하는 박테리아의 세포. (A) 가능한 셀 수 (로그 단위) 라이브/죽음 얼룩이 지 고 교류 cytometry에 의해 계량 (평균 ± 표준 편차, n = 3). (B) 의 공동 문화 48 h 후 multispecies 미생물 커뮤니티의 대표적인 흐름 cytometry 줄거리. 녹색, 빨강, 그리고 검정 대표 가능한, 손상 및 배경 또는 박테리아 분류에서 각각 점. <a href="https://www-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/57699/57699fig1large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/57699/57699fig2.jpg"> 그림 2: 시뮬레이션된 위장 소화 후 박테리아의 생존 능력을 셀. 구강, 위, 작은 창 자의 소화 단계 후 가능한 셀 (로그 단위) 수를 나타내는 막대 (평균 ± 표준 편차, n = 3). <a href="https://www-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/57699/57699fig2large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/57699/57699fig3.jpg"> 그림 3: 가능한 세균 세포 막 interphase의 대표 작. 빨간 점을 배경 및 파란색 점을 가능한 셀을 나타냅니다. 교류 cytometry 상태 소품 외 에 따라 설립 되었다 (2016) 19. 점 막 샘플 희석된 1: 100 (v/v) 15 분, Sybr 녹색/Propidium 요오드 화물으로 얼룩진 고 FL1에서 샘플의 100 µ L를 측정 했다: 533/30 nm, FL2: 585/40 nm, FL3: > 670 nm 긴 패스, 그리고 FL4: 675/25 nm. <a href="https://www-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/57699/57699fig3large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/57699/57699fig4.jpg"> 그림 4: 콜로 니 형성 단위 (CFU)에서 세포질 파편에서 성장 BHI 판 수정. 3 생물 복제 세균성 접착 시험을 위해 사용 되었다 고 CFU 정량화에 대 한 3 개의 기술 복제 수행 했다. 두 복제 접시-1-6 셀 파편 (S7)의 희석을 포함 하는 그림에 표시 됩니다. <a href="https://www-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/57699/57699fig4large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody>
<tr>
<td>세포 배양</td>
			<td>부착 / 서 스 펜 션</td>
			<td>매체를 경작</td>
			<td>일반 보충제</td>
			<td>특정 보충 교재</td>
			<td>시간을 두 배로</td>
			<td>부 화 조건</td>
		</tr>
<tr>
<td>Caco-2 (ECACC 86010202)</td>
			<td>점착</td>
			<td rowspan="2">Dulbecco의 수정이 글 중간 (DMEM) 4.5 g/L 포도 당으로</td>
			<td rowspan="2">소 태아 혈 청 (10 %v / v)를 비활성화 페니실린 (100 U/mL) * 스 (0.1 mg/mL) * 암포 (0.0025 mg/mL) *</td>
			<td>Glutamax (4 mM) 비 필수 aminoacids (1 %v / v) Pyruvate (1 mM)</td>
			<td>65-72 h</td>
			<td rowspan="2">95% 습도 10% CO2 CO2 배양 기 ( 재료의 표참조)</td>
		</tr>
<tr>
<td>HT29-MTX (ECACC 12040401)</td>
			<td>점착</td>
			<td>HEPES (1 mM)</td>
			<td>20-24 h</td>
		</tr>
<tr>
<td colspan="7">* 항생제와 antifungals는 분석 실험을 시작 하기 전에 2 일 세포 배양에서 제거 되었습니다.</td>
		</tr>
</tbody></table>표 1: 셀 문화 유지 보수에 대 한 셀 라인 및 미디어 구성의 설명입니다.

Watch this Scientific Journal Video about Assessing the Viability of a Synthetic Bacterial Consortium on the In Vitro Gut Host-microbe Interface at JoVE.com

Assessing the Viability of a Synthetic Bacterial Consortium on the In Vitro Gut Host-microbe Interface

창 자 미생물 호스트 상호 작용은 합성 구두 커뮤니티, 생체 외에서 위장 소화, 그리고 소장 상피의 모델을 결합 하 여 새로운 접근 방식을 사용 하 여 평가 됐다. 우리 세포 침입 병원 체와 다중 종 biofilms의 평가 또는 테스트 probiotic 정립 생존 적응 될 수 있는 방법 제시.

생체 외에서 직감 호스트 미생물 인터페이스에 합성 세균 컨소시엄의 생존 능력을 평가

The interplay between host and microbiota has been long recognized and extensively described. The mouth is similar to other sections of the ...

assessing-viability-synthetic-bacterial-consortium-on-vitro-gut-host

Nanyang Technological University

Research

JoVE Journal

Biochemistry

Assessing the Viability of a Synthetic Bacterial Consortium on the In Vitro Gut Host-microbe Interface

11.5K 조회수.  Ghent University. 창 자 미생물 호스트 상호 작용은 합성 구두 커뮤니티, 생체 외에서 위장 소화, 그리고 소장 상피의 모델을 결합 하 여 새로운 접근 방식을 사용 하 여 평가 됐다. 우리 세포 침입 병원 체와 다중 종 biofilms의 평가 또는 테스트 probiotic 정립 생존 적응 될 수 있는 방법 제시.

비디오: Assessing the Viability of a Synthetic Bacterial Consortium on the In Vitro Gut Host-microbe Interface

Co-culture of Living Microbiome with Microengineered Human Intestinal Villi in a Gut-on-a-Chip Microfluidic Device

Here, we describe a protocol to perform long-term co-culture of multi-species human gut microbiome with microengineered intestinal villi in a human gut-on-a-chip microphysiological device. We recapitulate the intestinal lumen-capillary tissue interface in a microfluidic device, where physiological mechanical deformations and fluid shear flow are constantly applied to mimic peristalsis. In the lumen microchannel, human intestinal epithelial Caco-2 cells are cultured to form a &#39;germ-free&#39; villus epithelium and regenerate small intestinal villi. Pre-cultured microbial cells are inoculated into the lumen side to establish a host-microbe ecosystem. After microbial cells adhere to the apical surface of the villi, fluid flow and mechanical deformations are resumed to produce a steady-state microenvironment in which fresh culture medium is constantly supplied and unbound bacteria (as well as bacterial wastes) are continuously removed. After extended co-culture from days to weeks, multiple microcolonies are found to be randomly located between the villi, and both microbial and epithelial cells remain viable and functional for at least one week in culture. Our co-culture protocol can be adapted to provide a versatile platform for other host-microbiome ecosystems that can be found in various human organs, which may facilitate in vitro study of the role of human microbiome in orchestrating health and disease.

We describe an in vitro protocol to co-culture gut microbiome and intestinal villi for an extended period using a human gut-on-a-chip microphysiological system.

에 Microengineered 인간의 장내 융모와 생활 마이크로 바이 옴의 공동 문화 창자 - 온 - 어 - 칩 미세 유체 장치

Here, we describe a protocol to perform long-term co-culture of multi-species human gut microbiome with microengineered intestinal villi in a human ...

연구

생체공학

Porphyromonas gingivalis as a Model Organism for Assessing Interaction of Anaerobic Bacteria with Host Cells

Anaerobic bacteria far outnumber aerobes in many human niches such as the gut, mouth, and vagina. Furthermore, anaerobic infections are common and frequently of indigenous origin. The ability of some anaerobic pathogens to invade human cells gives them adaptive measures to escape innate immunity as well as to modulate host cell behavior. However, ensuring that the anaerobic bacteria are live during experimental investigation of the events may pose challenges. Porphyromonas gingivalis, a Gram-negative anaerobe, is capable of invading a variety of eukaryotic non-phagocytic cells. This article outlines how to successfully culture and assess the ability of P. gingivalis to invade human umbilical vein endothelial cells (HUVECs). Two protocols were developed: one to measure bacteria that can successfully invade and survive within the host, and the other to visualize bacteria interacting with host cells. These techniques necessitate the use of an anaerobic chamber to supply P. gingivalis with an anaerobic environment for optimal growth.
The first protocol is based on the antibiotic protection assay, which is largely used to study the invasion of host cells by bacteria. However, the antibiotic protection assay is limited; only intracellular bacteria that are culturable following antibiotic treatment and host cell lysis are measured. To assess all bacteria interacting with host cells, both live and dead, we developed a protocol that uses fluorescent microscopy to examine host-pathogen interaction. Bacteria are fluorescently labeled with 2&#39;,7&#39;-Bis-(2-carboxyethyl)-5-(and-6)-carboxyfluorescein acetoxymethyl ester (BCECF-AM) and used to infect eukaryotic cells under anaerobic conditions. Following fixing with paraformaldehyde and permeabilization with 0.2% Triton X-100, host cells are labeled with TRITC phalloidin and DAPI to label the cell cytoskeleton and nucleus, respectively. Multiple images taken at different focal points (Z-stack) are obtained for temporal-spatial visualization of bacteria. Methods used in this study can be applied to any cultivable anaerobe and any eukaryotic cell type.

Porphyromonas gingivalis as a Model Organism for Assessing Interaction of Anaerobic Bacteria with Host Cells

This article presents two protocols: one to measure anaerobic bacteria that can successfully invade and survive within the host, and the other to visualize anaerobic bacteria interacting with host cells. This study can be applied to any cultivable anaerobe and any eukaryotic cell type.

숙주 세포와 혐기성 세균의 상호 작용을 평가하기위한 모델 생물로 포피 진지 발리

Anaerobic bacteria far outnumber aerobes in many human niches such as the gut, mouth, and vagina. Furthermore, anaerobic infections are common and ...

면역학 및 감염병학

Applying Advanced In Vitro Culturing Technology to Study the Human Gut Microbiota

The human gut microbiota plays a vital role in both human health and disease. Studying the gut microbiota using an in vivo model, is difficult due to its complex nature, and its diverse association with mammalian components. The goal of this protocol is to culture the gut microbiota in vitro, which allows for the study of the gut microbiota dynamics, without having to consider the contribution of the mammalian milieu. Using in vitro culturing technology, the physiological conditions of the gastro intestinal tract are simulated, including parameters such as pH, temperature, anaerobiosis, and transit time. The intestinal surface of the colon is simulated by adding mucin-coated carriers, creating a mucosal phase, and adding further dimension. The gut microbiota is introduced by inoculating with the human fecal material. Upon inoculation with this complex mixture of bacteria, specific microbes are enriched in the different longitudinal (ascending, transverse and descending colons) and transversal (luminal and mucosal) environments of the in vitro model. It is crucial to allow the system to reach a steady state, in which the community and the metabolites produced remain stable. The experimental results in this manuscript demonstrate how the inoculated gut microbiota community develops into a stable community over time. Once steady state is achieved, the system can be used to analyze bacterial interactions and community functions or to test the effects of any additives on the gut microbiota, such as food, food components, or pharmaceuticals.

Here, we present a protocol for culturing the gut microbiota of the colon in vitro, using a series of bioreactors that simulate the physiological conditions of the gastro intestinal tract.

인간의 본질적인 Microbiota 공부 기술을 경작 하는 체 외에서 고급 적용

The human gut microbiota plays a vital role in both human health and disease. Studying the gut microbiota using an in vivo model, is difficult due to its ...

An In Vitro Batch-culture Model to Estimate the Effects of Interventional Regimens on Human Fecal Microbiota

The emerging role of the gut microbiome in several human diseases demands a breakthrough of new tools, techniques and technologies. Such improvements are needed to decipher the utilization of microbiome modulators for human health benefits. However, the large-scale screening and optimization of modulators to validate microbiome modulation and predict related health benefits may be practically difficult due to the need for large number of animals and/or human subjects. To this end, in vitro or ex vivo models can facilitate preliminary screening of microbiome modulators. Herein, it is optimized and demonstrated an ex vivo fecal microbiota culture system that can be used for examining the effects of various interventions of gut microbiome modulators including probiotics, prebiotics and other food ingredients, aside from nutraceuticals and drugs, on the diversity and composition of the human gut microbiota. Inulin, one of the most widely studied prebiotic compounds and microbiome modulators, is used as an example here to examine its effect on the healthy fecal microbiota composition and its metabolic activities, such as fecal pH and the fecal levels of organic acids including lactate and short-chain fatty acids (SCFAs). The protocol may be useful for studies aimed at estimating the effects of different interventions of modulators on fecal microbiota profiles and at predicting their health impacts.

This protocol describes an in vitro batch-culture fermentation system of human fecal microbiota, using inulin (a well-known prebiotic and one of the most widely studied microbiota modulators) to demonstrate the use of this system in estimating effects of specific interventions on fecal microbiota composition and metabolic activities.

인체 배설물 미생물에 대한 중재 식이요법의 효과를 추정하는 시험관 내 배치 배양 모델

The emerging role of the gut microbiome in several human diseases demands a breakthrough of new tools, techniques and technologies. Such improvements are ...

Analysis of Interactions between Endobiotics and Human Gut Microbiota Using In Vitro Bath Fermentation Systems

Human intestinal microorganisms have recently become an important target of research in promoting human health and preventing diseases. Consequently, investigations of interactions between endobiotics (e.g., drugs and prebiotics) and gut microbiota have become an important research topic. However, in vivo experiments with human volunteers are not ideal for such studies due to bioethics and economic constraints. As a result, animal models have been used to evaluate these interactions in vivo. Nevertheless, animal model studies are still limited by bioethics considerations, in addition to differing compositions and diversities of microbiota in animals vs. humans. An alternative research strategy is the use of batch fermentation experiments that allow evaluation of the interactions between endobiotics and gut microbiota in vitro. To evaluate this strategy, bifidobacterial (Bif) exopolysaccharides (EPS) were used as a representative xenobiotic. Then, the interactions between Bif EPS and human gut microbiota were investigated using several methods such as thin-layer chromatography (TLC), bacterial community compositional analysis with 16S rRNA gene high-throughput sequencing, and gas chromatography of short-chain fatty acids (SCFAs). Presented here is a protocol to investigate the interactions between endobiotics and human gut microbiota using in vitro batch fermentation systems. Importantly, this protocol can also be modified to investigate general interactions between other endobiotics and gut microbiota.

Described here is a protocol to investigate the interactions between endobiotics and human gut microbiota using in vitro batch fermentation systems.

체외 목욕 발효 시스템을 사용하여 내분비병제와 인간 장내 미생물 간의 상호 작용 분석

Human intestinal microorganisms have recently become an important target of research in promoting human health and preventing diseases. Consequently, ...

High Throughput Co-culture Assays for the Investigation of Microbial Interactions

The study of interactions between microorganisms has led to numerous discoveries, from novel antimicrobials to insights in microbial ecology. Many approaches used for the study of microbial interactions require specialized equipment and are expensive and time intensive. This paper presents a protocol for co-culture interaction assays that are inexpensive, scalable to large sample numbers, and easily adaptable to numerous experimental designs. Microorganisms are cultured together, with each well representing one pairwise combination of microorganisms. A test organism is cultured on one side of each well and first incubated in monoculture. Subsequently, target organisms are simultaneously inoculated onto the opposite side of each well using a 3D-printed inoculation stamp. After co-culture, the completed assays are scored for visual phenotypes, such as growth or inhibition. These assays can be used to confirm phenotypes or identify patterns among isolates of interest. Using this simple and effective method, users can analyze combinations of microorganisms rapidly and efficiently. This co-culture approach is applicable to antibiotic discovery as well as culture-based microbiome research and has already been successfully applied to both applications.

The co-culture interaction assays presented in this protocol are inexpensive, high throughput, and simple. These assays can be used to observe microbial interactions in co-culture, identify interaction patterns, and characterize the inhibitory potential of a microbial strain of interest against human and environmental pathogens.

미생물 상호 작용의 조사를 위한 높은 처리량 공동 문화 애세서

The study of interactions between microorganisms has led to numerous discoveries, from novel antimicrobials to insights in microbial ecology. Many ...

An Intestinal Gut Organ Culture System for Analyzing Host-Microbiota Interactions

The structure of the gut tissue facilitates close and mutualistic interactions between the host and the gut microbiota. These cross-talks are crucial for maintaining local and systemic homeostasis; changes to gut microbiota composition (dysbiosis) associate with a wide array of human diseases. Methods for dissecting host-microbiota interactions encompass an inherent tradeoff among preservation of physiological tissue structure (when using in vivo animal models) and the level of control over the experiment factors (as in simple in vitro cell culture systems). To address this tradeoff, Yissachar et al. recently developed an intestinal organ culture system. The system preserves a naive colon tissue construction and cellular mechanisms and it also permits tight experimental control, facilitating experimentations that cannot be readily performed in vivo. It is optimal for dissecting short-term responses of various gut components (such as epithelial, immunological and neuronal elements) to luminal perturbations (including anaerobic or aerobic microbes, whole microbiota samples from mice or humans, drugs and metabolites). Here, we present a detailed description of an optimized protocol for organ culture of multiple gut fragments using a custom-made gut culture device. Host responses to luminal perturbations can be visualized by immunofluorescence staining of tissue sections or whole-mount tissue fragments, fluorescence in-situ hybridization (FISH), or time-lapse imaging. This system supports a wide array of readouts, including next-generation sequencing, flow cytometry, and various cellular and biochemical assays. Overall, this three-dimensional organ culture system supports the culture of large, intact intestinal tissues and has broad applications for high-resolution analysis and visualization of host-microbiota interactions in the local gut environment.

This article presents a unique method for analyzing host-microbiome interactions using a novel gut organ culture system for ex vivo experiments.

호스트-미생물군유병 상호 분석을 위한 장 내 장관 장기 배양 시스템

The structure of the gut tissue facilitates close and mutualistic interactions between the host and the gut microbiota. These cross-talks are crucial for ...

Bioreactor Assembly for Continuous Culture of Complex Fecal Communities

The microbiota, especially bacteria, respond to various environmental exposures such as micro and macronutrients, pharmacological compounds, and inflammatory mediators, which dynamically alter community composition and microbial metabolic output. Understanding how physiological culture conditions affect microbial communities and diversity and their metabolic capacity will contribute important knowledge of their impact on health and diseases. Here, we present a protocol adapted from the template published by Auchtung et al. to create mini-bioreactor arrays that can cultivate complex fecal communities, define bacterial consortiums or single strains under precise conditions, including nutrient availability, temperature, flow rate, pH, and oxygen content. We describe the process for building the mini-bioreactor system, including adaptations to improve limitations in the published protocol. We also discuss the setup of the mini-bioreactor system under anaerobic conditions with the use of MEGA media (adapted from Han et al.), which is a rich media supporting the growth of diverse bacteria. We describe the inoculation of gut humanized mouse fecal samples into the mini-bioreactor system, followed by the establishment of complex community cultures within the mini-bioreactor system, which can be grown under continuous flow with aseptic sampling to monitor community composition. This system is adaptable to dietary changes and other cultural modifications. The techniques described here allow for the characterization of diverse, fastidious fecal communities under dynamic conditions or in response to perturbation in isolation from host-derived factors.

This protocol details the assembly of mini-bioreactor arrays to be utilized for continuous flow culture of complex fecal communities under anaerobic conditions. We also discuss the methods for assembly, inoculation, and sampling of the reactors for further analysis.

The microbiota, especially bacteria, respond to various environmental exposures such as micro and macronutrients, pharmacological compounds, and ...

A Method to Assess Bacteriocin Effects on the Gut Microbiota of Mice

Very intriguing questions arise with our advancing knowledge on gut microbiota composition and the relationship with health, particularly relating to the factors that contribute to maintaining the population balance. However, there are limited available methodologies to evaluate these factors. Bacteriocins are antimicrobial peptides produced by many bacteria that may confer a competitive advantage for food acquisition and/or niche establishment. Many probiotic lactic acid bacteria (LAB) strains have great potential to promote human and animal health by preventing the growth of pathogens. They can also be used for immuno-modulation, as they produce bacteriocins. However, the antagonistic activity of bacteriocins is normally determined by laboratory bioassays under well-defined but over-simplified conditions compared to the complex gut environment in humans and animals, where bacteria face multifactorial influences from the host and hundreds of microbial species sharing the same niche. This work describes a complete and efficient procedure to assess the effect of a variety of bacteriocins with different target specificities in a murine system. Changes in the microbiota composition during the bacteriocin treatment are monitored using compositional 16S rDNA sequencing. Our approach uses both the bacteriocin producers and their isogenic non-bacteriocin-producing mutants, the latter giving the ability to distinguish bacteriocin-related from non-bacteriocin-related modifications of the microbiota. The fecal DNA extraction and 16S rDNA sequencing methods are consistent and, together with the bioinformatics, constitute a powerful procedure to find faint changes in the bacterial profiles and to establish correlations, in terms of cholesterol and triglyceride concentration, between bacterial populations and health markers. Our protocol is generic and can thus be used to study other compounds or nutrients with the potential to alter the host microbiota composition, either when studying toxicity or beneficial effects.

Bacteriocins are believed to play a key role in defining microbial diversity in different ecological niches. Here, we describe an efficient procedure to assess how bacteriocins affect gut microbiota composition in an animal model.

마우스의 장내 미생물에 대한 박테리오신 효과 평가 방법

Very intriguing questions arise with our advancing knowledge on gut microbiota composition and the relationship with health, particularly relating to the ...

생물학

Rhizosphere 토양에서 Synergistic Multispecies Biofilms 개발

An Approach to Constructing Multispecies Biofilm Communities from Rhizosphere Soil

The multispecies biofilm is a naturally occurring and dominant lifestyle of bacteria in nature, including in rhizosphere soil, although the current understanding of it is limited. Here, we provide an approach to rapidly establish synergistic multispecies biofilm communities. The first step is to extract cells from rhizosphere soil using the differential centrifugation method. Afterward, these soil cells are inoculated into the culture medium to form pellicle biofilm. After 36 h of incubation, the bacterial composition of the biofilm and the solution underneath are determined using the 16S rRNA gene amplicon sequencing method. Meanwhile, high-throughput bacterial isolation from pellicle biofilm is conducted using the limiting dilution method. Then, the top 5 bacterial taxa are selected with the highest abundance in the 16S rRNA gene amplicon sequencing data (pellicle biofilm samples) for further use in constructing multispecies biofilm communities. All combinations of the 5 bacterial taxa were quickly established using a 24-well plate, selected for the strongest biofilm formation ability by the crystal violet staining assay, and quantified by qPCR. Finally, the most robust synthetic bacterial multispecies biofilm communities were obtained through the methods above. This methodology provides informative guidance for conducting research on rhizosphere multispecies biofilm and identifying representative communities for studying the principles governing interactions among these species.

저자 스포트라이트: 2세대 바이오 비료 생성을 위한 합성 미생물 군집 개발

A rapid and standardized procedure for establishing synergistic multispecies biofilm communities from various rhizosphere soils is presented here. It is a unique protocol designed to probe and simulate the complex rhizosphere soil microbiota.

Rhizosphere 토양에서 Multispecies Biofilm Communities를 구축하는 접근 방식

The multispecies biofilm is a naturally occurring and dominant lifestyle of bacteria in nature, including in rhizosphere soil, although the current ...