Name: bacterial artificial chromosomes: a functional genomics tool for the study of positive-strand rna viruses
Uploaded: 2015-12-29T13:00:00.000+00:00
Duration: 12 min 20 s
Description: Watch this Scientific Journal Video about Bacterial Artificial Chromosomes: A Functional Genomics Tool for the Study of Positive-strand RNA Viruses at JoVE.com

The authors would like to acknowledge the Utah Science Technology and Research fund for support of YML and the Korea National Research Foundation grants (2009-0069679 and 2010-0010154) for support of SIY. This research was supported by the Utah Agricultural Experiment Station, Utah State University, and approved as journal paper number UAES #8753. Also, the authors thank Dr. Deborah McClellan for editorial assistance.

The authors have declared that they have no competing financial interests.

현재의 프로토콜은 성공적으로 두 개의 서로 다른 균주 (CNU / LP2 (27)와 사 (14) -14-2 28) JEV, 그 기능 cDNA를 입증했다 구축 할 본질적으로 어려울 수있는 플라 비 바이러스의과에 대한 전체 길이 감염의 cDNA 클론을 생성하는 데 사용 된 때문에 숙주 세포 독성 및 클로닝 된 cDNA의 유전 적 불안정성 전파 8,74-76을이 프로토콜은 세 개의 주요 구성 요소가 포함됩니다. 고성능 역 전사 효소를 사용하여 바이러스 RNA의 충실한의 cDNA 복사본의 합성 / 증폭을 최대화 먼저 / DNA 중합 효소; 둘째로, 마지막으로 전체 길이의 cDNA 조립 공정 초기에 서브 클로닝 된 cDNA로부터 매우 낮은 카피 수의 벡터에서 BAC (미발표 데이터) 서열을 함유하는 독성 바이러스 E-PRM 코딩 영역 74,77,78 클로닝; 그리고 세 번째, 분명히 더 큰 DNA의 INSE을 용인 120-350킬로바이트, 19-21의 평균 크기의 외래 DNA를 수용 할 수있는 클로닝 벡터의 혈중 알코올 농도를 이용하여보다 RTS는 다른 복제 벡터를 않습니다. 이 복제 방법은 다른 많은 포지티브 - 가닥 RNA 바이러스, ~ 10 내지 32 KB의 큰 RNA 게놈을 가진 특히 일반적으로 적용 가능할 것이다. 게놈은 숙주 세포 변이가 단백질로 번역되는 바이러스 성 mRNA의 작용 때문에 감염성 cDNA를 클론의 발생은, 특히 포지티브 - 가닥 RNA 바이러스에 대해, RNA 바이러스에 대한 역 유전학 시스템을 개발에서 중요한 단계이다. 따라서, 바이러스 복제는 감수성 숙주 세포에 유래하는 cDNA 게놈 길이의 RNA 분자의 도입에 의해 개시 될 수있다. 감염성 JEV의 cDNA 클론의 가용성 재조합 DNA 기술과 결합 될 때, 이러한 유전자 발현 73,79과 게놈 복제로서, 분자 수준에서 바이러스 생활주기의 다양한 양상의 이해를 증가 하였다. 63, 64이 또한, 전체 길이의 cDNA 클론 JEV 바이러스 백신은 28과 유전자 전달 벡터의 개발을위한 가치있는 도구임이 입증되었다. &lt;SUP&gt; 80, 81 모든 포지티브 - 가닥 RNA 바이러스와 같이, 고도로 감염성 RNA를는 시험 관내에서 합성 될 수있는 JEV위한 안정적인 기능의 cDNA를 구축 여러 중요한 단계가있다. 이상적으로, 전체 길이의 cDNA 클론으로부터 전사 된 RNA를 합성의 순서는 바이러스 게놈 RNA 바이러스 RNA 복제의 개시에 필요한 특히 5&#39;- 및 3&#39;- 말단의 서열과 동일해야 . 60-62 현재 프로토콜에서, 인증 된 5&#39;- 및 3&#39;- 말단 마지막 하류를 바이러스 게놈의 제 아데닌 뉴클레오티드 상류의 SP6 프로모터 서열을 배치하고 고유 인공 XbaI으로 I 제한 부위의 위치에 의해 보장 된 각각 바이러스 게놈의 티민 염기. XbaI으로 I-선형화와 MBN 처리 cDNA를 TE의 결선 전사에 의해 생산 된 정통 5 &#39;및 3&#39;끝과 합성 RNA를 출장mplate M (7) G (5 &#39;)를 준비하는 SP6 RNA 중합 효소 PPP (5&#39;) 캡 아날로그를 사용하여. 이 프로토콜은 여러 가지 방법으로 변형 될 수있다. 그것은에없는 경우 시험 관내 전사를 들어, 다른 박테리오파지 RNA 폴리머 라제 (예, T3 또는 T7)이 그것의 잘 정의 된 프로모터 서열과 함께 사용될 수있다. (27)를 결선 부위로서, 다른 제한 사이트를 이용할 수있다 선형화 된 cDNA에서 바이러스 게놈과 경우 합성 RNA는 본격적인 3 &#39;끝으로 끝납니다. 합성 RNA는 그 3 &#39;말단에 서너 바이러스 무관 뉴클레오티드를 포함하는 경우 3&#39;- 말단의 염기 서열의 중요성은 RNA 감염성의 ~ 10 배 감소에 의해 입증되었다. 시험 관내 전사 반응에 (27), 두 M (7) G (5 &#39;) PPP (5&#39;)와 M (7) G (5 &#39;) PPP (5&#39;) G 캡 아날로그 5 바이러스의 후반 장소하지만 관련이없는 여분의 G 염기 상류 잘 동일하게 사용할 수 있습니다 &#39;-end하지만추가 감염 또는 합성 RNA의 복제를 변경하지 않습니다. (27) 또한, DNase의 I 소화에 의해 RNA 전 사체로부터의 cDNA 템플릿의 제거가 RNA의 감염 테스트를 위해 필요하지 않다 cDNA를 템플릿 자체는 감염되지 않기 때문에. (27) BAC 기술은 이제 긍정적 인 가닥 RNA 바이러스, 즉, 두 JEVs, CNU / LP2 (27)와 사 (14) -14-2 28 (게놈 크기, ~ 11킬로바이트)의 소수에 대한 감염의 cDNA 클론을 구성에 적용되었습니다; 두 뎅기열 바이러스, BR / 90 (26)와 NGC 29 (11 ~ KB); 소 바이러스 성 설사 바이러스, SD1 (12 ~ KB)을 25 개의 전형적인 돼지 열 바이러스, C 및 패더 (12 ~ KB) 24 국경 질환 바이러스, Gifhorn의 (12 ~ KB) 24 돼지 생식기 및 호흡기 증후군 바이러스 , PL97-1 / LP1 (15 ~ KB) 30 전염성 위장염 바이러스, PUR46 - MAD (~ 29킬로바이트) 16 고양이 전염성 복막염 바이러스,DF-2 (~ 29킬로바이트) 32 중증 급성 호흡기 증후군 코로나 바이러스, 우르 바니 (30 ~ KB) 9 중동 호흡기 증후군 코로나 바이러스, EMC / 2012 (30 ~ KB), (17)과 인간 코로나 바이러스, OC43 (~ 31킬로바이트) 31의 cDNA 건설 BAC에 사용의 주요 이점은 대형, 1 또는 2 복사본 BAC 플라스미드의 유전 적 안정성이 높은 것이다.; 그러나, 극히 낮은 카피 수의 본질 때문에 BAC DNA의 염색체 DNA를 호스트에 대하여 BAC의 DNA의 순도가 감소 그에 매우 낮은 수율, 또한 큰 단점이다. 현재 프로토콜에서, BAC DNA의 수율은 E. 성장에 의해 극대화 대장균 DH10B는 영양이 풍부한 매체는 2xYT에 / 감염성 BAC의 PBAC와 SA (14) -14-2을 바꾸었다. 이러한 노력에도 불구하고, 평균 수율은 ~ 15 μg의는 2xYT 국물 500ml의에서 BAC의 DNA이다. 또한, BAC DNA의 순도는 정제를 위해 가장 CSCL-EtBr을 밀도 구배 원심 분리를 이용함으로써 달성된다오히려 일반적으로 사용되는 컬럼 기반의 플라스미드 분리보다. 그러나, 명심하는 것이 중요하다 BAC 변환 된 E. 이 복제 된 cDNA의 유전 적 안정성을 위태롭게 할 수 있기 때문에 대장균이 자라다하지 말아야하며, 더 높은 성장이 반드시 더 큰 수익률 또는 더 높은 순도의 BAC DNA로 이어질하지 않습니다. 여기에 설명 된 프로토콜은 JEV에 대한 BAC으로 유 전적으로 안정된 전체 길이 감염의 cDNA 클론의 건설 및 전파를위한 최적화, 효율적이며 능률적 인 방법, 절차는 한 번 실질적으로 불가능하다고 생각. 이 같은 클로닝 전략은 또한 다른 많은 양 가닥 RNA 바이러스에 적용될 수있다. 일반적으로, 감염의 cDNA 클론 바이러스 복제 및 병인에 생물학적 기능을 연구하는 바이러스 RNA 게놈에 돌연변이 (예를 들어, 삭제, 삽입, 및 점 돌연변이)의 다양성을 소개 할 수있게. 이 cDNA를 기반​​ 역 유전학 시스템으로 개발할 수있게하고 TESt 백신 및 특정 관심 포지티브 - 가닥 RNA 바이러스의 병원성 인자 (들)를 치료 표적 후보. 또한, 이러한 감염성 cDNA의 기술은 또한 생물 의학 연구에 많은 응용 관심 외래 유전자 (들)을 발현 할 수있는 바이러스 벡터로 이용 될 수있다.

RNA 바이러스 학자를 들어, 1970 년대 후반에, 재조합 DNA 기술의 출현은 가능한 다음 RNA 바이러스의 유전 적 조작을위한 박테리아 플라스미드로 전파 될 수의 cDNA 클론 내로 바이러스 RNA 게놈을 변환했다. (1) 제 RNA 바이러스로 복제 분자는 박테리오파지 Qβ, 대장균 감염 포지티브 - 가닥 RNA 바이러스이다. E.에 도입 할 때 Qβ 게놈 RNA의 전체 cDNA의 복사본을 포함하는 플라스미드 전염성 Qβ 파지 초래했다 대장균. (2) 그 후 곧,이 기술은, 소아마비 바이러스에인가 인간과 동물의 포지티브 - 가닥 RNA 바이러스 하였다. 폴리오 바이러스 게놈 RNA의 전장 cDNA 베어링 플라스미드 감염성 포유 동물 세포 내로 형질 감염성 비리 온을 생성 할 때 3, 클로닝 된 cDNA는 바이러스 RNA 복제를 개시하는 세포 내에서 전사되어야이 &quot;DNA 발사&quot;접근 방식이다.;전사가 개시되는 방법과 증명서가 올바른 바이러스 서열에 어떻게 처리되는지 그러나 불분명하다. 이러한 문제는 다른 &quot;RNA 발사&quot;의 개발을 주도하고있다 접근법, 바이러스 RNA 게놈의 완전한 cDNA의 사본 E. 인식 프로모터 하에서 복제된다 숙주 세포 내로 도입 될 때 완전한 바이러스 복제 사이클을 겪는다 정의 5 &#39;및 3&#39;말단을 가진 시험관에서 합성 RNA를, 생산 용 대장균 또는 파아지 RNA 폴리머 라제.이 방식 제 성공 브롬 모자이크 바이러스에 대해보고 된 4,5- , 6,7- 식물의 양 가닥 RNA 바이러스. 그 후, RNA 발사 접근법 caliciviruses, alphaviruses, 플라 비 바이러스, arteriviruses 및 코로나 포함한 양성 가닥 RNA 바이러스의 광범위한 개발되었다. 1,4,5,8- DNA- 및 모두에서, FUL의 구성을 역 유전학 시스템 RNA 발사~ 10 L - 길이의 cDNA 클론은 감염성 DNA 또는 포지티브 - 가닥 RNA 바이러스의 RNA를 생성하는 키이지만 바이러스 게놈 크기가 증가 상당한 기술적 도전. 특히 9-17의 큰 RNA 게놈진다 -32 KB는 전신 기능의 cDNA 클로닝에 세 가지 주요 장애물을 제시한다. RT-PCR의 정확도는 바이러스 성 RNA의 길이에 반비례하므로 18 제 어려움 복사 충실한 cDNA를 합성한다. 긴 RNA 분자는 E. 불안정 플라스미드에서의 cDNA 단편을 제조 할 수있는 예기치 않은 서열을 포함 할 가능성이 있기 때문에 두번째 장애물은 잠재적으로 독성 서열의 존재이다 대장균. 이&gt; 10 KB의 바이러스 cDNA를 삽입을 수용 할 수있는 클로닝 벡터를 발견하기 어렵 기 때문에 셋째, 가장 중요한 이슈는, 적당한 벡터의 유용성이다. 지난 3 년 동안,이 장벽은 효소 학, 방법론, 여러 진보에 의해 극복되었다D의 vectorology. 이들 중 1,4,5,8-는 가장 유망한 혁신 개발은 큰 긍정적 인 가닥 RNA 바이러스 등 전염성 세균 인공 염색체 (BAC에)의 복제입니다. BAC 벡터는 E.에 기초하여 저 복사 클로닝 플라스미드 (1-2 복사 / 셀) 인 DNA의 평균 삽입 크기를 갖는 대장균 인자 불임, ~ 19-21 120-350 KB DNA 단편은 일반 클로닝 벡터로 클로닝에 유사한 방식으로 BAC 벡터에 삽입된다.; 결과 BAC 클론 E. 많은 세대에 걸쳐 안정적 대장균. 현재까지 22, 23는, BAC 기술은 즉 세 가지 긍정적 인 가닥 RNA 바이러스 가족, 플라 비비 리다, 24 ~ 29 Arteriviridae, 30 Coronaviridae의&gt; 10 명에 대한 감염의 cDNA 클론을 만드는 데 사용되었다. 9,16,17 , 31, 32 예를 들어 일본 뇌염 바이러스 (JEV)를 사용하여, 본 연구는 일 수 상세한 절차를보고양성 가닥 RNA 바이러스의 다양한 유전자 안정된 전장 감염성 BAC를 구성하는데 사용된다. 발생 JEV가, JEV 감염이 심한 종종 치명적인 신경 질환 일본 뇌염이 발생할 수 있습니다 인간에서 동물 매개 모기 벡터에 의해 조류, 돼지, 그리고 다른 척추 동물의 호스트 사이의 자연에서 전송 플라 비 바이러스 (33). (34, 35)입니다 (JE), (36) ~ 50,000-175,000 임상 경우의 예상 연간 발병률 아시아와 서태평양, 37, 38의 부품. 39, 40 JEV의 게놈 ~ 11 KB, 단일 가닥 긍정적 인 감지 RNA 분자이며 구성 5 &#39;및 3&#39;두 개의 비 코딩 영역 (의 NCR)에 의해 형벌 단일 오픈 리딩 프레임 (ORF)이 종료된다. 41, 42 ORF가 지정된 10 개별 단백질을 생성하는 호스트 및 바이러스 성 단백질 분해 효소에 의해 분해되는 폴리를 인코딩 C, PRM, E, NS1, NS2A, NS2B, NS3, NS4A, NS4B 및 NS5 또한 C- 말단 방향에 N-있다. 34,43,44, 전자NS1 (NS1 &#39;)의 xtended 양식 코돈 NS2A의 8-9에 의해 -1 리보솜 frameshifting 표현된다. 이들 11 단백질의 45, 46, 세 개의 구조 단백질 (C, PRM, E는) 감염의 형성에 필수적인 비리, 47, 48 및 나머지 8 비 구조 단백질 (NS5에 NS1 및 NS1 &#39;)는 바이러스 성 RNA 복제, 49-51 입자 어셈블리, 52-56 및 선천성 면역 회피에 대한 중요하다. 57-59 모두 5&#39;3 &#39;의 NCR은 기본 시퀀스 및 바이러스 성 RNA 복제를 조절에 중요한 형태의 RNA 1 차 / 2 차 구조, 60-62을 보존 포함. 63, 64 이 프로토콜은 SA (14) -14-2 전체 길이 JEV의 감염 혈중 알코올 농도를 생성하기위한 도구, 방법 및 전략을 설명합니다. (28)이 기능 BAC 클론은 발기인에 포함되어 JEV 게놈 RNA의 전체 cDNA를 복사, (65)을 포함 SP6의 RNA 중합 효소에 대한 상향바이러스의 5&#39;- 말단 및 체외 런 - 오프 전사 바이러스 3&#39;- 말단의 하류 고유 XbaI으로 I 제한 사이트. 이 기술은 BAC 양성 가닥 RNA 바이러스의 배열에 대해 완전히 기능 분자의 cDNA 클론을 구축에 적용 할 수있다.

<table><tbody><tr><td>&lt;strong&gt;1. Molecular Cloning&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>2xYT Broth</td><td>Sigma-Aldrich</td><td>Y2377</td><td></td></tr><tr><td>[&lt;sup&gt;3&lt;/sup&gt;H]UTP</td><td>PerkinElmer</td><td>NET380250UC</td><td>Radioactive</td></tr><tr><td>50 ml Tube</td><td>Thermo Scientific (Nalgene)</td><td>3114-0050</td><td></td></tr><tr><td>250 ml Bottle</td><td>Beckman Coulter</td><td>356011</td><td></td></tr><tr><td>Agarose</td><td>Lonza</td><td>50004</td><td></td></tr><tr><td>Agarose (Low Melting Point)</td><td>Life Technologies (Invitrogen)</td><td>16520-100</td><td></td></tr><tr><td>AvaI</td><td>New England BioLabs</td><td>R0152S</td><td></td></tr><tr><td>AvrII</td><td>New England BioLabs</td><td>R0174S</td><td></td></tr><tr><td>BamHI</td><td>New England BioLabs</td><td>R0136S</td><td></td></tr><tr><td>BsiWI</td><td>New England BioLabs</td><td>R0553S</td><td></td></tr><tr><td>BsrGI</td><td>New England BioLabs</td><td>R0575S</td><td></td></tr><tr><td>Butanol</td><td>Fisher Scientific</td><td>A399-1&amp;nbsp;</td><td></td></tr><tr><td>Cesium Chloride</td><td>Fisher Scientific</td><td>BP1595-1</td><td></td></tr><tr><td>Chloramphenicol</td><td>Sigma-Aldrich</td><td>C0378</td><td></td></tr><tr><td>Chloroform</td><td>Sigma-Aldrich</td><td>C2432</td><td>Carcinogenic</td></tr><tr><td>DE-81 Filter Paper</td><td>GE Healthcare Life Sciences</td><td>3658-023</td><td></td></tr><tr><td>dNTP mix</td><td>Life Technologies (Invitrogen)</td><td>18427-088</td><td></td></tr><tr><td>&lt;em&gt;E. coli&lt;/em&gt; DH10B&amp;nbsp;</td><td>Life Technologies (Invitrogen)</td><td>18297-010</td><td></td></tr><tr><td>EDTA</td><td>Sigma-Aldrich</td><td>E5134</td><td></td></tr><tr><td>Ethanol&amp;nbsp;</td><td>Sigma-Aldrich</td><td>E7023</td><td></td></tr><tr><td>Ethidium Bromide</td><td>Sigma-Aldrich</td><td>E7637</td><td>Toxic and highly mutagenic</td></tr><tr><td>Filter Column (Plasmid Maxiprep Kit)</td><td>Life Technologies (Invitrogen)</td><td>K2100-26</td><td></td></tr><tr><td>Glacial Acetic Acid</td><td>Sigma-Aldrich</td><td>A6283</td><td>Irritating</td></tr><tr><td>Glucose</td><td>Sigma-Aldrich</td><td>G5400</td><td></td></tr><tr><td>Glycogen&amp;nbsp;</td><td>Roche</td><td>10901393001</td><td></td></tr><tr><td>High-fidelity DNA Polymerase</td><td>New England BioLabs</td><td>M0491S</td><td></td></tr><tr><td>Isoamyl Alcohol</td><td>Sigma-Aldrich</td><td>I9392</td><td>Flammable</td></tr><tr><td>Isopropanol&amp;nbsp;</td><td>Amresco</td><td>0918</td><td>Flammable</td></tr><tr><td>LB Broth</td><td>Life Technologies (Invitrogen)</td><td>12795-027</td><td></td></tr><tr><td>Lithium Chloride</td><td>Sigma-Aldrich</td><td>L9650</td><td></td></tr><tr><td>Lysozyme</td><td>Amresco</td><td>0663</td><td></td></tr><tr><td>Magnesium Chloride</td><td>Sigma-Aldrich</td><td>M8266</td><td></td></tr><tr><td>M-MLV Reverse Transcriptase</td><td>Life Technologies (Invitrogen)</td><td>18080-044</td><td></td></tr><tr><td>Mung Bean Nuclease</td><td>New England BioLabs</td><td>M0250S</td><td></td></tr><tr><td>Needle (18G, 20G)</td><td>BD</td><td>305196, 305175</td><td>Biohazardous (Sharps waste)</td></tr><tr><td>NotI</td><td>New England BioLabs</td><td>R0189S</td><td></td></tr><tr><td>Oligonucleotide</td><td>Integrated DNA Technologies</td><td>Custom Oligonucleotide Synthesis</td><td></td></tr><tr><td>PacI</td><td>New England BioLabs</td><td>R0547S</td><td></td></tr><tr><td>pBeloBAC11</td><td>New England BioLabs</td><td>ER2420S (E4154S)</td><td></td></tr><tr><td>Phenol (Buffer-Saturated)</td><td>Life Technologies (Invitrogen)</td><td>15513-039</td><td>Toxic and highly corrosive</td></tr><tr><td>Phenol:Chloroform:Isoamyl Alcohol</td><td>Life Technologies (Invitrogen)</td><td>15593-031</td><td>Toxic and highly corrosive</td></tr><tr><td>Phenol:Guanidine Isothiocyanate</td><td>Life Technologies (Ambion)</td><td>10296-010</td><td>Toxic, corrosive, and irritating</td></tr><tr><td>Pme I</td><td>New England BioLabs</td><td>R0560S</td><td></td></tr><tr><td>Potassium Acetate</td><td>Amresco</td><td>0698</td><td></td></tr><tr><td>RNase Inhibitor</td><td>Life Technologies (Invitrogen)</td><td>10777-019</td><td></td></tr><tr><td>rNTP Set</td><td>GE Healthcare Life Sciences</td><td>27-2025-01</td><td></td></tr><tr><td>Sealable Polypropylene Tube (16 &amp;times; 76 mm)&amp;nbsp;</td><td>Beckman Coulter</td><td>342413</td><td></td></tr><tr><td>SfiI</td><td>New England BioLabs</td><td>R0123S</td><td></td></tr><tr><td>Sma I</td><td>New England BioLabs</td><td>R0141S</td><td></td></tr><tr><td>Sodium Acetate</td><td>Sigma-Aldrich</td><td>S2889</td><td></td></tr><tr><td>Sodium Dodecyl Sulfate</td><td>Amresco</td><td>0227</td><td></td></tr><tr><td>Sodium Hydroxide</td><td>Sigma-Aldrich</td><td>S5881</td><td></td></tr><tr><td>SP6 RNA Polymerase</td><td>New England BioLabs</td><td>M0207S</td><td></td></tr><tr><td>Spin Column (Plasmid Miniprep Kit)</td><td>Life Technologies (Invitrogen)</td><td>K2100-11</td><td></td></tr><tr><td>Syringe</td><td>HSW NORM-JECT</td><td>4200.000V0</td><td></td></tr><tr><td>T4 DNA Ligase</td><td>New England BioLabs</td><td>M0202S</td><td></td></tr><tr><td>Tris</td><td>Amresco</td><td>0826</td><td></td></tr><tr><td>tRNA (yeast)</td><td>Life Technologies (Invitrogen)</td><td>15401-011</td><td></td></tr><tr><td>XbaI&amp;nbsp;</td><td>New England BioLabs</td><td>R0145S</td><td></td></tr><tr><td>&lt;strong&gt;Name&lt;/strong&gt;</td><td>&lt;strong&gt;Company&lt;/strong&gt;</td><td>&lt;strong&gt;Catalog Number&lt;/strong&gt;</td><td>&lt;strong&gt;Comments&lt;/strong&gt;</td></tr><tr><td>&lt;strong&gt;2. Cell Culture&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>Alpha Minimal Essential Medium</td><td>Life Technologies (Gibco)</td><td>12561-049</td><td></td></tr><tr><td>Conical Tube (50 mL)</td><td>VWR</td><td>21008-242</td><td></td></tr><tr><td>Crystal Violet&amp;nbsp;</td><td>Sigma-Aldrich</td><td>C0775</td><td></td></tr><tr><td>Culture Dish (150 mm)&amp;nbsp;</td><td>TPP</td><td>93150&amp;nbsp;</td><td></td></tr><tr><td>Cuvette (2-mm Gap)</td><td>Harvard Apparatus</td><td>450125&amp;nbsp;</td><td></td></tr><tr><td>Fetal Bovine Serum&amp;nbsp;</td><td>Life Technologies (Gibco)</td><td>16000-044</td><td></td></tr><tr><td>Formaldehyde</td><td>Sigma-Aldrich</td><td>F1635</td><td>Toxic and carcinogenic</td></tr><tr><td>Glutamine</td><td>Life Technologies (Gibco)</td><td>25030-081</td><td></td></tr><tr><td>Minimal Essential Medium</td><td>Life Technologies (Gibco)</td><td>61100-061</td><td></td></tr><tr><td>Penicillin/Streptomycin</td><td>Life Technologies (Gibco)</td><td>15070-063</td><td></td></tr><tr><td>Potassium Chloride</td><td>Sigma-Aldrich</td><td>P3911</td><td></td></tr><tr><td>Potassium Phosphate Monobasic</td><td>Sigma-Aldrich</td><td>P9791</td><td></td></tr><tr><td>Six-Well Plate</td><td>TPP</td><td>92006</td><td></td></tr><tr><td>Sodium Chloride</td><td>Sigma-Aldrich</td><td>S3014</td><td></td></tr><tr><td>Sodium Phosphate Dibasic</td><td>Sigma-Aldrich</td><td>S3264</td><td></td></tr><tr><td>Trypsin-EDTA (0.25%)</td><td>Life Technologies (Gibco)</td><td>25200-056</td><td></td></tr><tr><td>Vitamins</td><td>Sigma-Aldrich</td><td>M6895</td><td></td></tr><tr><td>&lt;strong&gt;Name&lt;/strong&gt;</td><td>&lt;strong&gt;Company&lt;/strong&gt;</td><td>&lt;strong&gt;Catalog Number&lt;/strong&gt;</td><td>&lt;strong&gt;Comments&lt;/strong&gt;</td></tr><tr><td>&lt;strong&gt;3. Equipment&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>Agarose Gel Electrophoresis System</td><td>Mupid</td><td>MPDEXU-01</td><td></td></tr><tr><td>CO&lt;sub&gt;2&lt;/sub&gt; Incubator</td><td>Thermo Scientific</td><td>Heracell 150i</td><td></td></tr><tr><td>Desktop Centrifuge&amp;nbsp;</td><td>Thermo Scientific</td><td>ST16R</td><td></td></tr><tr><td>Electroporator</td><td>Harvard Apparatus</td><td>ECM 830</td><td></td></tr><tr><td>Longwave Ultraviolet Lamps (Handheld)</td><td>UVP</td><td>UVGL-58</td><td></td></tr><tr><td>Tabletop Centrifuge</td><td>Beckman Coulter</td><td>368826</td><td></td></tr><tr><td>Thermocycler</td><td>Life Technologies (Applied Biosystems)</td><td>GeneAmp PCR System 9700</td><td></td></tr><tr><td>Vortexer</td><td>Scientific Industries</td><td>G-560</td><td></td></tr><tr><td>Water Bath</td><td>Jeio Tech</td><td>WB-10E</td><td></td></tr></tbody></table>

bacterial artificial chromosomes: a functional genomics tool for the study of positive-strand rna viruses

Reverse genetics, an approach to rescue infectious virus entirely from a cloned cDNA, has revolutionized the field of positive-strand RNA viruses, whose genomes have the same polarity as cellular mRNA. The cDNA-based reverse genetics system is a seminal method that enables direct manipulation of the viral genomic RNA, thereby generating recombinant viruses for molecular and genetic studies of both viral RNA elements and gene products in viral replication and pathogenesis. It also provides a valuable platform that allows the development of genetically defined vaccines and viral vectors for the delivery of foreign genes. For many positive-strand RNA viruses such as Japanese encephalitis virus (JEV), however, the cloned cDNAs are unstable, posing a major obstacle to the construction and propagation of the functional cDNA. Here, the present report describes the strategic considerations in creating and amplifying a genetically stable full-length infectious JEV cDNA as a bacterial artificial chromosome (BAC) using the following general experimental procedures: viral RNA isolation, cDNA synthesis, cDNA subcloning and modification, assembly of a full-length cDNA, cDNA linearization, in vitro RNA synthesis, and virus recovery. This protocol provides a general methodology applicable to cloning full-length cDNA for a range of positive-strand RNA viruses, particularly those with a genome of &gt;10 kb in length, into a BAC vector, from which infectious RNAs can be transcribed in vitro with a bacteriophage RNA polymerase.

모든 포지티브 스트랜드 RNA 바이러스에 대해, 역 유전학 시스템의 신뢰성 및 효율을 가진 시퀀스 바이러스 성 게놈 RNA의 공통 서열에 해당 클로닝 된 전장 cDNA의 유전 적 안정성에 의존한다. (27)도 1은 5- 도시 JEV SA에 대한 BAC로 전체 길이 감염의 cDNA의 건설을위한 단계 전략 14 -14-2 28 : 1 단계, JEV 감염 BHK-21 세포 (그림 1A)의 세포 배양 상층 액에서 바이러스 RNA의 정화; 2 단계, 전체 바이러스 게놈 (도 1b)에 걸친 네 중첩 된 cDNA 증폭 (F1 내지 F4)의 합성; PBAC / F4 (그림 1C)에 PBAC / F1을 만드는 3 단계, BAC 벡터에 네 개의 연속 된 cDNA 조각의 각각의 서브 클로닝; 4 단계, SP6의 RNA 중합 효소, 즉와 체외 실행 - 오프 전사 복제 된 cDNA의 수정, SP6을 배치프로모터 서열 무음 점 돌연변이를 도입하여 뉴클레오티드 9131에서 기존 내부 XbaI으로 I 사이트를 제거 바이러스 5&#39;- 말단 (PBAC / F1 SP6)의 바로 상류, 9134는 T (PBAC / F3 KO), 그리고 삽입 →을 바이러스 3&#39;- 말단 (PBAC / F4 RO) (그림 1D)의 바로 하류 새로운 인공 XbaI으로 나는 실행 오프 사이트; 그리고 5 단계, 전체 길이의 조립 SA (14) -14-2의 cDNA BAC, PBAC / SA (14) -14-2 (그림 1E). 표이 복제 과정에서 사용되는 올리고 뉴클레오티드 (1) 목록. (28) 기능적 JEV의 cDNA 건설, 제 중요한 단계는 RT-PCR을위한 주형으로 정제 된 바이러스 RNA를 이용하여 네 개의 중첩 된 cDNA 단편을 합성한다. (2)가 있었다 네 RT-PCR 제품에 대한 대표적인 결과를 제공 도표 0.8 %에 전기 영동아가 로스 젤. 이 젤은 전체 길이 JEV cDNA를 네 개의 중첩 된 cDNA 조각으로 증폭되는 것을 명확하게 보여줍니다. 때때로, RT-PCR 반응은 cDNA 합성 때문에 / 증폭시 프라이머의 어닐링 특이성, 예상되는 대부분의 제품보다 작은 하나 이상의 추가의 바이러스 특이 적 또는 비특이적 인 제품을 얻을 수있다. 한편, 거의 또는 전혀는 RT-PCR 산물 때문에 바이러스 RNA 분리 또는 부적절한 RT-PCR 성능 중에 우발적으로 RNase 오염 증폭 될 것이라고 예상. 다음으로 중요한 단계는 partial- 또는 전장 표준 재조합 DNA 기술을 사용하여 비교적 간단한 절차 BAC에 JEV의 cDNA의 클로닝 및 변형 예이다. (69)도 3을 함유하는 BAC 클론의 정제를위한 대표적인 결과를 나타낸다 CSCL-EtBr이 기울기에 밴딩으로 JEV SA (14) -14-2의 전체 길이의 cDNA.이 실험에서, 401,700 × g에서 16 시간 동안 원심 분리 후, 두 개의 별개의 대역, 즉, E. 상기 대장균 염색체 DNA 및 아래 수퍼 코일 BAC 플라스미드 DNA는, 장파 자외선 하에서 관의 중간에서 볼 수있다. 하부의 BAC DNA 밴드의 최소 부피 (~ 400 μL)을 조심스럽게 튜브의 측면에 주사기로 구멍을 파고에 의해 수집 하였다. 그 후, EtBr로는 부탄올 추출 BAC DNA로부터 추출하고 EtBr이없는 BAC DNA는 에탄올 침전에 의해 농축시켰다. 마지막 단계는 허용 세포에 RNA 형질 전환 (그림 4) 후 전체 길이 SA (14) -14-2 BAC (PBAC / SA (14) -14-2)에서 체외에서 전사 합성 RNA를 특정 감염의 결정이다. 3 &#39;단계 1에서, 전체 길이의 선형화 SA 14 -14-2의 cDNA :이 단계는 세 개의 순차적 인 단계를 포함-end 바이러스 게놈 (도 4a)의; 2 단계, 실행 - 오프 전사 (그림 4B)에 의해 선형화 된 cDNA의 합성 RNA를 생산; 그리고 3 단계의 RNA 합성 (도 4C)로 형질 BHK-21 세포에서의 재조합 바이러스의 구조. 실험적으로, PBAC / SA (14) -14-2의 두 개의 독립적 인 클론 XbaI으로 내가 소화와 선형화 및 XbaI으로 나는 분해에 의해 생성 된 네 개의 염기 5 &#39;오버행을 제거하기 위해 MBN 처리 하였다. 선형화 BAC에 에탄올 침전,이어서 페놀 - 클로로포름 추출하여 정리 하였다. 두 개의 정제 BAC에의 선형화는 0.8 % 아가 로스 젤 (그림 5A)에 증명되었다. 페놀 - 클로로포름 추출은 선형화 된 BAC에가의 RNase가없는 것을 확인하기 위해주의 깊게 수행해야합니다. 두 개의 선형 BAC에 각각 M (7) G (5 &#39;) PPP의 존재 SP6 RNA 중합 효소를 사용하여 결선 전사 cDNA를 템플릿으로 제공 (5&#39;) 캡 유사체. 합성 RNA를의 무결성을 기준 1킬로바이트의 DNA 사다리 (그림 5B)와 함께, 0.6 % 아가 로스 젤에있는 두 개의 전사 반응 혼합물의 분취 량을 실행하여 나타내었다.이 간단한 분석에서, 주요 저명한 RNA 밴드는 언제나 마이그레이션 3킬로바이트 아래의 DNA 밴드를 참조하고 날카로운 것으로 나타났다. 그러나, RNA는 동일한 겔에 도말 외관이 저하 것이다. 감염성 중심 분석은 합성 RNA는 감염성의 비를 결정하기위한 금 표준이다. 이 분석은 (3 × 105 세포 / 웰) 나이브 BHK-21 세포를 함유하는 6- 웰 플레이트에서 10 배 희석 한 일렉트로 세포의 분취 량을 시드, RNA 샘플을 BHK-21 세포를 electroporating, 아가 로스 오버레이에 의해 이루어졌다 세포 단층 상. 4 일 동안 배양 한 후, 생존 세포는 포름 알데히드로 고정하고, 크리스탈 바이올렛의 염색olution는 세포 (도 6A)에 전달되는 감염성 RNA 분자의 수에 대응 감염성 센터 (플라크)의 수를 정량화한다. 시험 관내 전사에 사용되는 cDNA의 템플릿이 아닌 감염성 것으로 입증 되었기 때문에, 전사 반응 혼합물의 분취 량 (27)은 직접적으로 전기 천공을 위해 사용 하였다. 전기는 RNA 형질에 대한 선호되는 방법입니다; 대안 적으로,이 RNA를 DEAE 덱스 트란과 양이온 성 리포좀을 사용하는 다른 방법에 의해 형질 전환 될 수있다. RNA의 전기 천공은 매우 효과적이지만, 전기 펄스의 &quot;아크&quot;를 염 전기 반응이나 전기 천공 큐벳 재사용되는 경우 존재하는 경우에 드물게 발생한다. RNA 형질 감염된 세포에서 바이러스 단백질의 발현을 방지 NS1 토끼 항혈청 (도 6b)을 사용하여 면역 형광 분석법에 의해 검사 하였다. RNA 형질 감염된 세포의 상청액에 축적 된 바이러스 입자의 제작했다플라크 분석 (그림 6C)에 의해 alyzed. 이러한 실험의 결과는 cDNA를 합성 유래의 RNA가 재조합 바이러스의 높은 역가를 생성 허용 BHK-21 세포에 감염임을 분명히 보여준다. <table fo:keep-together.within-page="1"><tbody><tr><td> 올리고 뉴클레오티드 </td><td> 시퀀스 (5 &#39;3&#39;) </td><td> 위치 (B) </td><td> 극성 </td></tr><tr><td> 1RT </td><td> TAGGGATCTGGGCGTTTCTG GCAAAT </td><td> 2578-2603 </td><td> 안티센스 </td></tr><tr><td> 1 층 </td><td> aatcccgggAGAAGTTTATC TGTGTGAACTT </td><td> 1-22 </td><td> 감각 </td></tr><tr><td> 1R </td><td> attgcggccgcCCACGTCGT TGTGCACGAAGAT </td><td> 2532에서 2553 사이 </td><td> 안티센스 </td></tr><tr><td> 2RT </td><td> TTCTGCCTACTCTGCCCCTC CGTTGA </td><td> 5975-6000 </td><td> 개미ISENSE </td></tr><tr><td> 2 층 </td><td> aatcccgggTCAAGCTCAGT GATGTTAACAT </td><td> 1800에서 1821 사이 </td><td> 감각 </td></tr><tr><td> 2R </td><td> attgcggccgcGATGGGTTT CCGAGGATGACTC </td><td> 5929-5950 </td><td> 안티센스 </td></tr><tr><td> 3RT </td><td> ACGGTCTTTCCTTCTGCTGC AGGTCT </td><td> 9426-9451 </td><td> 안티센스 </td></tr><tr><td> 3 층 </td><td> aatcccgggGAGGATACATT GCTACCAAGGT </td><td> 5500-5521 </td><td> 감각 </td></tr><tr><td> 3R </td><td> attgcggccgcGTAAGTCAG TTCAATTATGGCT </td><td> 9380-9401 </td><td> 안티센스 </td></tr><tr><td> 4RT </td><td> AGATCCTGTGTTCTTCCTCA CCACCA </td><td> 10952-10977 </td><td> 안티센스 </td></tr><tr><td> 4 층 </td><td> aatcccgggAGTGGAAGGCT CAGGCGTCCAA </td><td> 9200-9221 </td><td> 감각 </td></tr><tr><td> 4R </td><td> attgcggccgcAGATCCTGT GTTCTTCCTCACC </td><td> 10956-10977 </td><td> 안티센스 </td></tr><tr><td> SP6F </td><td> cataccccgcgtattcccac 고마워 </td><td></td><td> 감각 </td></tr><tr><td> SP6R </td><td> ACAGATAAACTTCTctatag tgtcccctaaa </td><td> 1-14 </td><td> 안티센스 </td></tr><tr><td> F1F </td><td> aggggacactatagAGAAGT TTATCTGTGTG </td><td> 1-17 </td><td> 감각 </td></tr><tr><td> F1R </td><td> TGGATCATTGCCCATGGTAA GCTTA </td><td> 638-662 </td><td> 안티센스 </td></tr><tr><td> X1F </td><td> CGAATGGATCGCACAGTGTG GAGAG </td><td> 8403-8427 </td><td> 감각 </td></tr><tr><td> X1R </td><td> AAAGCTTCAAACTCAAGATA CCGTGCTCC </td><td> 9120-9148 </td><td> 안티센스 </td></tr><tr><td> X2F </td><td> GGAGCACGGTATCTTGAGTT TGAAGCTTT </td><td> 9120-9148 </td><td> 감각 </td></tr><tr><td> X2R </td><td> cacgtggacgagggcatgcc tgcag </td><td></td><td> 안티센스 </td></tr><tr><td> ROF </td><td> CCAGGAGGACTGGGTTACCA AAGCC </td><td> 10670-10694 </td><td> 감각 </td></tr><tr><td> ROR </td><td> agggcggccgctctagAGAT CCTGTGTTCTTCCTCACCAC </td><td> 10954-10977 </td><td> 안티센스 </td></tr><tr><td colspan="4"> JEV 시퀀스는 대문자로 표시하고, BAC 시퀀스는 소문자로 표시됩니다. B 염기 위치는 JEV SA (14) -14-2 (GenBank 액 번호 JN604986)의 전체 게놈 서열을 의미한다. </td></tr></tbody></table> 표 1 : cDNA 합성, PCR 증폭, BAC 및 돌연변이 유발을 위해 사용 된 올리고 뉴클레오티드. <img alt="그림 1" src="/files/ftp_upload/53164/53164fig1.jpg" /> 그림 1.0; 전략 BAC으로 JEV SA (14) -14-2의 전체 길이의 cDNA의 건설을위한 JEV의 입자 바이러스 RNA의 (A)를 분리.. JEV SA 14 -14-2의 게놈 RNA의 개략도가 도시. 바이러스 게놈 전체를 덮는 (B) 네 개의 중첩 된 cDNA 단편의 합성 (F1 내지 F4). PBAC / F4에 PBAC / F1 키를 생성 BAC 벡터에 네 개의 중첩 된 cDNA 조각의 (C) 서브 클로닝. 체외에서 결선 전사 복제 된 cDNA의 (D) 수정. PBAC / F1 SP6는 바이러스의 5&#39;- 말단의 상류 SP6 프로모터 서열을 포함 PBAC / F1의 유도체이다. PBAC / F3 KO로 자동 점 돌연변이 (T → 9134, 별표)를 포함 PBAC / F3의 유도체이다. PBAC / F4 소유주는 바이러스 3&#39;- 말단의 하류 인공 XbaI으로 나는 실행 오프 사이트를 포함 PBAC / F4의 유도체이다. (E </<html> 강한&gt;) 전체 길이 SA (14) -14-2 BAC 조립 (PBAC / SA (14) -14-2). <a href="https://www-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/53164/53164fig1large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> <img alt="그림 2" src="/files/ftp_upload/53164/53164fig2.jpg" /> JEV SA 14 -14-2의 전체 길이 게놈 RNA 걸친도 네 중첩 된 cDNA 단편의 합성 2 (F1 내지 F4). 네 개의 RT-PCR 산물은 0.8 % 아가 로스 겔에서 전기 영동에 의해 평가된다. M, 1킬로바이트의 DNA 사다리. 네의 cDNA 조각의 예상 크기는 젤 이미지의 맨 아래에 표시됩니다. <a href="https://www-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/53164/53164fig2large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> /ftp_upload/53164/53164fig3.jpg &quot;/&gt; JEV의 전장 cDNA SA 14 -14-2 함유 BAC도 3의 정제. BAC 플라스미드는 E.로부터 단리 SDS-알칼리 용 균법에 의해 대장균 DH10B은 더욱 협동 학습-EtBr이 구배 밴딩 그래피. 16 × 76mm 밀봉 폴리 프로필렌 튜브를 사용하여 협동 학습 - EtBr이 경사의 예는 것입니다 발표. <a href="https://www-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/53164/53164fig3large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> <img alt="그림 4" src="/files/ftp_upload/53164/53164fig4.jpg" /> JEV SA (14) -14-2 cDNA를 BAC 조립 전체 길이에서 감염성 바이러스의 회복 그림 4. 개요. cDNA를 템플릿 () 선형화. JEV 혈중 알코올 농도가 절단되는 전체 길이XBA I 및 MBN로 처리 하였다. RNA 전 사체의 (B)를 합성. 선형화 된 cDNA를 m 7 G (5 &#39;) PPP (5&#39;)의 캡 유사체의 존재하에 SP6 RNA 중합 효소로 전사된다. 합성 JEVs의 (C) 복구. 시험 관내 전사의 RNA를 합성 바이러스의 높은 역가를 생성하는 전기에 의해 BHK-21 세포로 형질 전환된다. <a href="https://www-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/53164/53164fig4large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> <img alt="그림 5" src="/files/ftp_upload/53164/53164fig5.jpg" /> cDNA를 템플릿으로 전체 길이 JEV의 혈중 알코올 농도를 사용하여 시험 관내 전사에 의해 그림의 RNA 5. 합성을. 선형화 된 전체 길이 JEV BAC, PBAC / SA (14) -14-2의 (A) 세대. PBAC의 두 개의 독립적 클론/ SA (14) -14-2 (Cl.1과 c12에)는 MBN과 XbaI으로 내가와 소화 및 후속 처리로 선형화된다. 선형화의 BAC는 0.8 % 아가로 스겔 전기 영동에 의해 검사된다. 결선 전사에 의해 합성 RNA를 (나) 생산. 두 개의 선형 BAC에 각각 SP6의 RNA 중합 효소 실행 - 오프 전사의 템플릿으로 사용됩니다. 두 전사 반응의 분취 량은 0.6 % 아가 로스 젤에서 실행됩니다. M은 1킬로바이트 DNA 사다리. <a href="https://www-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/53164/53164fig5large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> <img alt="그림 6" src="/files/ftp_upload/53164/53164fig6.jpg" /> 전체 길이 JEV의 BAC 및 합성 바이러스의 회복 전사 합성 RNA를 그림 6. 특정 감염. BHK-21 세포 FR 유래 RNA 전 사체와 (모의) 일렉트로 - 모의 또는 일렉트로 있습니다전장 JEV의 BAC (Cl.1 및 c12에)의 두 개의 독립적 인 클론의 각 OM. (A) RNA의 감염. 세포는 아가로 오스와 겹쳐 및 사후 형질 사일에 크리스탈 바이올렛으로 염색된다. 감염성 RNA는 세포 (좌측 패널)에 전기 천공 감염성 RNA의 양을 추정하기 위해 감염성 센터 세이에 의해 결정된다. 또한, 전염성 센터의 대표 이미지 (오른쪽 패널) 표시됩니다. (B) 단백질 발현. 세포 4- 웰 챔버 슬라이드에 배양했다. 20 시간 후 - 형질 감염 (HPT)에서 RNA-일렉트로 세포에서 바이러스 성 단백질 발현은 일차 항 NS1 토끼 항혈청과 이차 Cy3가 접합 된 염소 항 - 토끼의 IgG (적색)를 이용하여 면역 형광 분석법에 의해 분석된다. 핵은 4 &#39;, 6-diamidino -2- 페닐 인돌 (파란색)으로 대조된다. 면역 형광 이미지는 해당 미분 간섭 콘트라스트 이미지 상에 오버레이된다. (C) 바이러스 수율. 세포를 배양하고 1 아르50mm 배양 접시. 22, 40 HPT에서 RNA-일렉트로 세포의 배양 상층 액에 축적 감염성 비리의 생산은 플라크 분석에 의해 조사한다. <a href="https://www-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/53164/53164fig6large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a>

Watch this Scientific Journal Video about Bacterial Artificial Chromosomes: A Functional Genomics Tool for the Study of Positive-strand RNA Viruses at JoVE.com

Bacterial Artificial Chromosomes: A Functional Genomics Tool for the Study of Positive-strand RNA Viruses

Here, a protocol is presented for creating an infectious bacterial artificial chromosome containing a full-length cDNA of the positive-strand genomic RNA of Japanese encephalitis virus. This protocol can be used to construct a functional cDNA of other positive-strand RNA viruses, making it a powerful genomic tool for studying virus biology.

세균 인공 염색체 : RNA 바이러스 양성 가닥의 연구에 대한 기능 유전체학 도구

Reverse genetics, an approach to rescue infectious virus entirely from a cloned cDNA, has revolutionized the field of positive-strand RNA viruses, whose ...

bacterial-artificial-chromosomes-functional-genomics-tool-for-study

Universidad San Sebastian

Research

JoVE Journal

Immunology and Infection

21.3K 조회수.  Utah State University. Here, a protocol is presented for creating an infectious bacterial artificial chromosome containing a full-length cDNA of the positive-strand genomic RNA of Japanese encephalitis virus. This protocol can be used to construct a functional cDNA of other positive-strand RNA viruses, making it a powerful genomic tool for studying virus biology.

비디오: Bacterial Artificial Chromosomes: A Functional Genomics Tool for the Study of Positive-strand RNA Viruses

Simple and Robust in vivo and in vitro Approach for Studying Virus Assembly

In viruses with positive-sense RNA genomes pathogenic to humans, animals and plants, progeny encapsidation into mature and stable virions is a cardinal phase during establishment of infection in a given host. Consequently, study of encapsidation deciphers the information regarding the know-how of the mechanism regulating virus assembly to form infectious virions. Such information is vital in formulating novel methods of curbing virus spread and disease control. Virus encapsidation can be studied in vivo and in vitro. Genome encapsidation in vivo is a highly regulated selective process involving macromolecular interactions and subcellular compartmentalization. Therefore, study leading to dissect events encompassing virus encapsidation in vivo would provide basic knowledge to understand how viruses proliferate and assemble. Recently in vitro encapsidation has been exploited for the research in the area of biomedical imaging and therapeutic applications. Non-enveloped plant viruses stand far ahead in the venture of in vitro encapsidation of the negatively charged foreign material. Brome mosaic virus (BMV), a non-enveloped multicomponent RNA virus pathogenic to plants, has been used as a model system for studying genome packaging in vivo and in vitro. For encapsidation assays in Nicotiana benthamiana plants, Agrobacterium -mediated transient expression, refer to as agroinfiltration, is an efficient and robust technique for the synchronized delivery and expression of multiple components to the same cell. In this approach, a suspension of Agrobacterium tumefaciens cells carrying binary plasmid vectors carrying cDNAs of desiredviral mRNAs is infiltrated into the intercellular space withina leaf using nothing more sophisticated than a 1 ml disposable syringe (without needle). This process results in the transfer of DNA insert into plant cells; the T-DNA insert remains transiently in the nucleus and is then transcribed by the host polymerase II, leading to the transient expression. The resulting mRNA transcript (capped and polyadenylated) is then exported to the cytoplasm for translation. After approximately 24 to 48 hours of incubation,sections of infiltrated leaves can be sampled for microscopyor biochemical analyses. Agroinfiltration permits large numbers (hundreds to thousands) of cells to be transfected simultaneously. For in vitro encapsidation, purified virions of BMV are dissociated into capsid protein by dialyzing against dissociation buffer containing calcium chloride followed by removal of RNA and un-dissociated virions by centrifugation. Genome depleted capsid protein subunits are then reassembled with desired viral genome components or non-viral components such as indocyanine dye.

Simple and Robust in vivo and in vitro Approach for Studying Virus Assembly

A simple, efficient and robust way to synchronize the delivery of multiple viral components to plant cells via Agrobacterium-mediated transient expression is described. This approach is amenable for studying replication, encapsidation followed by in vitro reassembly of non-viral components into genome depleted optical viral ghosts suitable for biomedical applications.

간편하고 강력한 생체내에서과 체외에서</em바이러스 조립 유학을위한> 접근법

In viruses with positive-sense RNA genomes pathogenic to humans, animals and plants, progeny encapsidation into mature and stable virions is a cardinal ...

연구

면역학 및 감염병학

High-throughput Screening for Broad-spectrum Chemical Inhibitors of RNA Viruses

RNA viruses are responsible for major human diseases such as flu, bronchitis, dengue, Hepatitis C or measles. They also represent an emerging threat because of increased worldwide exchanges and human populations penetrating more and more natural ecosystems. A good example of such an emerging situation is chikungunya virus epidemics of 2005-2006 in the Indian Ocean. Recent progresses in our understanding of cellular pathways controlling viral replication suggest that compounds targeting host cell functions, rather than the virus itself, could inhibit a large panel of RNA viruses. Some broad-spectrum antiviral compounds have been identified with host target-oriented assays. However, measuring the inhibition of viral replication in cell cultures using reduction of cytopathic effects as a readout still represents a paramount screening strategy. Such functional screens have been greatly improved by the development of recombinant viruses expressing reporter enzymes capable of bioluminescence such as luciferase. In the present report, we detail a high-throughput screening pipeline, which combines recombinant measles and chikungunya viruses with cellular viability assays, to identify compounds with a broad-spectrum antiviral profile.

In vitro assays to measure virus replication have been greatly improved by the development of recombinant RNA viruses expressing luciferase or other enzymes capable of bioluminescence. Here we detail a high-throughput screening pipeline that combines such recombinant strains of measles and chikungunya viruses to isolate broad-spectrum antivirals from chemical libraries.

RNA 바이러스의 넓은 스펙트럼 화학 억제를위한 높은 처리량 검사

RNA viruses are responsible for major human diseases such as flu, bronchitis, dengue, Hepatitis C or measles. They also represent an emerging threat ...

Reverse Genetics to Engineer Positive-Sense RNA Virus Variants

The lack of a convenient method for the iterative generation of diverse full-length viral variants has impeded the study of directed evolution in RNA viruses. By integrating a full RNA genome error-prone PCR and reverse genetics, random genome-wide substitution mutagenesis can be induced. We have developed a method using this technique to synthesize diverse libraries to identify viral mutants with phenotypes of interest. This method, called full-length mutant RNA synthesis (FL-MRS), offers the following advantages: (i) the ability to create a large library via a highly efficient one-step error-prone PCR; (ii) the ability to create groups of libraries with varying levels of genetic diversity by manipulating the fidelity of DNA polymerase; (iii) the creation of a full-length PCR product that can directly serve as a template for mutant RNA synthesis; and (iv) the ability to create RNA that can be delivered into host cells as a non-selected input pool to screen for viral mutants of the desired phenotype. We have found, using a reverse genetics approach, that FL-MRS is a reliable tool to study viral-directed evolution at all stages in the life cycle of the hepatitis C virus, JFH1 isolate. This technique appears to be an invaluable tool to employ directed evolution to understand adaptation, replication, and the role of viral genes in pathogenesis and antiviral resistance in positive-sense RNA viruses.

The protocol describes a method for introducing controllable genetic diversity in the hepatitis C virus genome by combining full-length mutant RNA synthesis using error-prone PCR and reverse genetics. The method provides a model for phenotype selection and can be used for 10 kb long positive-sense RNA virus genomes.

양성 RNA 바이러스 변이체를 엔지니어링하기 위한 역유전학

The lack of a convenient method for the iterative generation of diverse full-length viral variants has impeded the study of directed evolution in RNA ...

유전학

Generation and Assembly of Virus-Specific Nucleocapsids of the Respiratory Syncytial Virus

The use of an authentic RNA template is critical to advance the fundamental knowledge of viral RNA synthesis that can guide both mechanistic discovery and assay development in virology. The RNA template of nonsegmented negative-sense (NNS) RNA viruses, such as the respiratory syncytial virus (RSV), is not an RNA molecule alone but rather a nucleoprotein (N) encapsidated ribonucleoprotein complex. Despite the importance of the authentic RNA template, the generation and assembly of such a ribonucleoprotein complex remain sophisticated and require in-depth elucidation. The main challenge is that the overexpressed RSV N binds non-specifically to cellular RNAs to form random nucleocapsid-like particles (NCLPs). Here, we established a protocol to obtain RNA-free N (N0) first by co-expressing N with a chaperone phosphoprotein (P), then assembling N0 with RNA oligos with the RSV-specific RNA sequence to obtain virus-specific nucleocapsids (NCs). This protocol shows how to overcome the difficulty in the preparation of this traditionally challenging viral ribonucleoprotein complex.

For in-depth mechanistic analysis of the respiratory syncytial virus (RSV) RNA synthesis, we report a protocol of utilizing the chaperone phosphoprotein (P) for coexpression of the RNA-free nucleoprotein (N0) for subsequent in vitro assembly of the virus-specific nucleocapsids (NCs).

호흡기 싱크량 바이러스의 바이러스 특이적 뉴클레오캡시드의 생성 및 조립

The use of an authentic RNA template is critical to advance the fundamental knowledge of viral RNA synthesis that can guide both mechanistic discovery and ...

생화학

Modeling The Lifecycle Of Ebola Virus Under Biosafety Level 2 Conditions With Virus-like Particles Containing Tetracistronic Minigenomes

Ebola viruses cause severe hemorrhagic fevers in humans and non-human primates, with case fatality rates as high as 90%. There are no approved vaccines or specific treatments for the disease caused by these viruses, and work with infectious Ebola viruses is restricted to biosafety level 4 laboratories, significantly limiting the research on these viruses. Lifecycle modeling systems model the virus lifecycle under biosafety level 2 conditions; however, until recently such systems have been limited to either individual aspects of the virus lifecycle, or a single infectious cycle. Tetracistronic minigenomes, which consist of Ebola virus non-coding regions, a reporter gene, and three Ebola virus genes involved in morphogenesis, budding, and entry (VP40, GP1,2, and VP24), can be used to produce replication and transcription-competent virus-like particles (trVLPs) containing these minigenomes. These trVLPs can continuously infect cells expressing the Ebola virus proteins responsible for genome replication and transcription, allowing us to safely model multiple infectious cycles under biosafety level 2 conditions. Importantly, the viral components of this systems are solely derived from Ebola virus and not from other viruses (as is, for example, the case in systems using pseudotyped viruses), and VP40, GP1,2 and VP24 are not overexpressed in this system, making it ideally suited for studying morphogenesis, budding and entry, although other aspects of the virus lifecycle such as genome replication and transcription can also be modeled with this system. Therefore, the tetracistronic trVLP assay represents the most comprehensive lifecycle modeling system available for Ebola viruses, and has tremendous potential for use in investigating the biology of Ebola viruses in future. Here, we provide detailed information on the use of this system, as well as on expected results.

Work with infectious Ebola viruses is restricted to biosafety level 4 laboratories. Tetracistronic minigenome-containing replication and transcription-competent virus like particles (trVLPs) represent a lifecycle modeling system that allows us to safely model multiple infectious cycles under biosafety level 2 conditions, relying exclusively on Ebola virus components.

Tetracistronic Minigenomes를 포함하는 바이러스 입자와 바이오 안전성 수준이 조건에서 에볼라 바이러스의 수명주기를 모델링

Ebola viruses cause severe hemorrhagic fevers in humans and non-human primates, with case fatality rates as high as 90%. There are no approved vaccines or ...

Combining Analysis of DNA in a Crude Virion Extraction with the Analysis of RNA from Infected Leaves to Discover New Virus Genomes

This metagenome approach is used to identify plant viruses with circular DNA genomes and their transcripts. Often plant DNA viruses that occur in low titers in their host or cannot be mechanically inoculated to another host are difficult to propagate to achieve a greater titer of infectious material. Infected leaves are ground in a mild buffer with optimal pH and ionic composition recommended for purifying most bacilliform Para retroviruses. Urea is used to break up inclusion bodies that trap virions and to dissolve cellular components. Differential centrifugation provides further separation of virions from plant contaminants. Then proteinase K treatment removes the capsids. Then the viral DNA is concentrated and used for next-generation sequencing (NGS). The NGS data are used to assemble contigs which are submitted to NCBI-BLASTn to identify a subset of virus sequences in the generated dataset. In a parallel pipeline, RNA is isolated from infected leaves using a standard column-based RNA extraction method. Then ribosome depletion is carried out to enrich for a subset of mRNA and virus transcripts. Assembled sequences derived from RNA sequencing (RNA-seq) were submitted to NCBI-BLASTn to identify a subset of virus sequences in this dataset. In our study, we identified two related full-length badnavirus genomes in the two datasets. This method is preferred to another common approach which extracts the aggregate population of small RNA sequences to reconstitute plant virus genomic sequences. This latter metagenomic pipeline recovers virus related sequences that are retro-transcribing elements inserted into the plant genome. This is coupled to biochemical or molecular assays to further discern the actively infectious agents. The approach documented in this study, recovers sequences representative of replicating viruses that likely indicate active virus infection.

Here we present a new approach to identify plant viruses with double-strand DNA genomes. We use standard methods to extract DNA and RNA from infected leaves and carry out next-generation sequencing. Bioinformatic tools assemble sequences into contigs, identify contigs representing virus genomes and assign genomes to taxonomic groups.

새로운 바이러스 게놈을 발견 감염 된 잎에서 RNA 분석 원유 Virion 추출에 DNA의 결합 분석

This metagenome approach is used to identify plant viruses with circular DNA genomes and their transcripts. Often plant DNA viruses that occur in low ...

Arbovirus Infections As Screening Tools for the Identification of Viral Immunomodulators and Host Antiviral Factors

RNA interference- and genome editing-based screening platforms have been widely used to identify host cell factors that restrict virus replication. However, these screens are typically conducted in cells that are naturally permissive to the viral pathogen under study. Therefore, the robust replication of viruses in control conditions may limit the dynamic range of these screens. Furthermore, these screens may be unable to easily identify cellular defense pathways that restrict virus replication if the virus is well-adapted to the host and capable of countering antiviral defenses. In this article, we describe a new paradigm for exploring virus-host interactions through the use of screens that center on naturally abortive infections by arboviruses such as vesicular stomatitis virus (VSV). Despite the ability of VSV to replicate in a wide range of dipteran insect and mammalian hosts, VSV undergoes a post-entry, abortive infection in a variety of cell lines derived from lepidopteran insects, such as the gypsy moth (Lymantria dispar). However, these abortive VSV infections can be &#34;rescued&#34; when host cell antiviral defenses are compromised. We describe how VSV strains encoding convenient reporter genes and restrictive L. dispar cell lines can be paired to set-up screens to identify host factors involved in arbovirus restriction. Furthermore, we also show the utility of these screening tools in the identification of virally encoded factors that rescue VSV replication during coinfection or through ectopic expression, including those encoded by mammalian viruses. The natural restriction of VSV replication in L. dispar cells provides a high signal-to-noise ratio when screening for the conditions that promote VSV rescue, thus enabling the use of simplistic luminescence- and fluorescence-based assays to monitor the changes in VSV replication. These methodologies are valuable for understanding the interplay between host antiviral responses and viral immune evasion factors.

Here, we present the protocols to identify 1) virus-encoded immunomodulators that promote arbovirus replication and 2) eukaryotic host factors that restrict arbovirus replication. These fluorescence- and luminescence-based methods allow researchers to rapidly obtain quantitative readouts of arbovirus replication in simplistic assays with low signal-to-noise ratios.

Arbovirus 감염 바이러스 Immunomodulators 및 호스트 항 바이러스 요인의 식별을 위한 도구를 심사로

RNA interference- and genome editing-based screening platforms have been widely used to identify host cell factors that restrict virus replication. ...

Confocal Imaging of Double-Stranded RNA and Pattern Recognition Receptors in Negative-Sense RNA Virus Infection

Double-stranded (ds) RNA is produced as a replicative intermediate during RNA virus infection. Recognition of dsRNA by host pattern recognition receptors (PRRs) such as the retinoic acid (RIG-I) like receptors (RLRs) RIG-I and melanoma differentiation-associated protein 5 (MDA-5) leads to the induction of the innate immune response. The formation and intracellular distribution of dsRNA in positive-sense RNA virus infection has been well characterized by microscopy. Many negative-sense RNA viruses, including some arenaviruses, trigger the innate immune response during infection. However, negative-sense RNA viruses were thought to produce low levels of dsRNA, which hinders the imaging study of PRR recognition of viral dsRNA. Additionally, infection experiments with highly pathogenic arenaviruses must be performed in high containment biosafety level facilities (BSL-4). The interaction between viral RNA and PRRs for highly pathogenic RNA virus is largely unknown due to the additional technical challenges that researchers need to face in the BSL-4 facilities. Recently, a monoclonal antibody (Mab) (clone 9D5) originally used for pan-enterovirus detection has been found to specifically detect dsRNA with a higher sensitivity than the traditional J2 or K1 anti-dsRNA antibodies. Herein, by utilizing the 9D5 antibody, we describe a confocal microscopy protocol that has been used successfully to visualize dsRNA, viral protein and PRR simultaneously in individual cells infected by arenavirus. The protocol is also suitable for imaging studies of dsRNA and PRR distribution in pathogenic arenavirus infected cells in BSL4 facilities.

Double-stranded RNA produced during RNA virus replication can be recognized by pattern recognition receptors to induce an innate immune response. For negative-sense RNA viruses, the interaction between the low-level dsRNA and PRRs remains unclear. We have developed a confocal microscopy method to visualize arenavirus dsRNA and PRR in individual cells.

이중 가닥 RNA와 패턴 인식 수용 체 부정적인 감 RNA 바이러스 감염에의 confocal 영상

Double-stranded (ds) RNA is produced as a replicative intermediate during RNA virus infection. Recognition of dsRNA by host pattern recognition receptors ...

Generation, Amplification, and Titration of Recombinant Respiratory Syncytial Viruses

The use of recombinant viruses has become crucial in basic or applied virology. Reverse genetics has been proven to be an extremely powerful technology, both to decipher viral replication mechanisms and to study antivirals or provide development platform for vaccines. The construction and manipulation of a reverse genetic system for a negative-strand RNA virus such as a respiratory syncytial virus (RSV), however, remains delicate and requires special know-how. The RSV genome is a single-strand, negative-sense RNA of about 15 kb that serves as a template for both viral RNA replication and transcription. Our reverse genetics system uses a cDNA copy of the human RSV long strain genome (HRSV). This cDNA, as well as cDNAs encoding viral proteins of the polymerase complex (L, P, N, and M2-1), are placed in individual expression vectors under T7 polymerase control sequences. The transfection of these elements in BSR-T7/5 cells, which stably express T7 polymerase, allows the cytoplasmic replication and transcription of the recombinant RSV, giving rise to genetically modified virions. A new RSV, which is present at the cell surface and in the culture supernatant of BSRT7/5, is gathered to infect human HEp-2 cells for viral amplification. Two or three rounds of amplification are needed to obtain viral stocks containing 1 x 106 to 1 x 107 plaque-forming units (PFU)/mL. Methods for the optimal harvesting, freezing, and titration of viral stocks are described here in detail. We illustrate the protocol presented here by creating two recombinant viruses respectively expressing free green fluorescent protein (GFP) (RSV-GFP) or viral M2-1 fused to GFP (RSV-M2-1-GFP). We show how to use RSV-GFP to quantify RSV replication and the RSV-M2-1-GFP to visualize viral structures, as well as viral protein dynamics in live cells, by using video microscopy techniques.

We describe a method for generating and amplifying genetically modified respiratory syncytial viruses (RSVs) and an optimized plaque assay for RSVs. We illustrate this protocol by creating two recombinant viruses that respectively allow quantification of RSV replication and live analysis of RSV inclusion bodies and inclusion bodies-associated granules dynamics.

생성, 증폭 및 재조합 호흡 Syncytial 바이러스의 적정

The use of recombinant viruses has become crucial in basic or applied virology. Reverse genetics has been proven to be an extremely powerful technology, ...

Rescue of Recombinant Zika Virus from a Bacterial Artificial Chromosome cDNA Clone

The association of Zika virus (ZIKV) infection with neurological complications during the recent worldwide outbreak and the lack of approved vaccines and/or antivirals have underscored the urgent need to develop ZIKV reverse genetic systems to facilitate the study of ZIKV biology and the development of therapeutic and/or prophylactic approaches. However, like with other flaviviruses, the generation of ZIKV full-length infectious cDNA clones has been hampered due to the toxicity of viral sequences during its amplification in bacteria. To overcome this problem, we have developed a nontraditional approach based on the use of bacterial artificial chromosomes (BACs). Using this approach, the full-length cDNA copy of the ZIKV strain Rio Grande do Norte Natal (ZIKV-RGN) is generated from four synthetic DNA fragments and assembled into the single-copy pBeloBAC11 plasmid under the control of the human cytomegalovirus (CMV) immediate-early promoter. The assembled BAC cDNA clone is stable during propagation in bacteria, and infectious recombinant (r)ZIKV is recovered in Vero cells after transfection of the BAC cDNA clone. The protocol described here provides a powerful technique for the generation of infectious clones of flaviviruses, including ZIKV, and other positive-strand RNA viruses, particularly those with large genomes that have stability problems during bacterial&#160;propagation.

The recent epidemic of Zika virus highlights the importance of establishing reverse genetic approaches to develop vaccines and/or therapeutic strategies. Here, we describe the protocol to rescue an infectious recombinant Zika virus from a full-length cDNA clone assembled in a bacterial artificial chromosome under the control of the human cytomegalovirus immediate-early promoter.

세균성 인공 염색체 cDNA 클론에서 재조합 Zika 바이러스의 구조

The association of Zika virus (ZIKV) infection with neurological complications during the recent worldwide outbreak and the lack of approved vaccines ...