Name: photoactivated localization microscopy with bimolecular fluorescence complementation (bifc-palm)
Uploaded: 2015-12-22T14:00:00.000+00:00
Duration: 12 min 42 s
Description: Watch this Scientific Journal Video about Photoactivated Localization Microscopy with Bimolecular Fluorescence Complementation BiFC-PALM at JoVE.com

The authors thank Drs. Steven Chu and Joe W. Gray for helpful discussions, Henry Marr for his initial work on the BiFC-PALM project, and Alexis Shoemaker for her technical assistance. This work is supported by startup funds to X.N. from OHSU. Research in the Nan laboratory was also supported by NIH 5U54CA143836-05, the Damon Runyon Cancer Research Foundation, the M. J. Murdock Charitable Trust, and the FEI company.

<ol>
	<li>Braun, P., Gingras, A. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=History+of+protein-protein+interactions:+From+egg-white+to+complex+networks.">History of protein-protein interactions: From egg-white to complex networks.</a> Proteomics. 12, 1478-1498 (2012).</li><li>Lasserre, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Raft+nanodomains+contribute+to+Akt/PKB+plasma+membrane+recruitment+and+activation.">Raft nanodomains contribute to Akt/PKB plasma membrane recruitment and activation.</a> Nat. Chem. Biol. 4 (9), 538-547 (2008).</li><li>Hu, C. D., Chinenov, Y., Kerppola, T. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Visualization+of+interactions+among+bZIP+and+Rel+family+proteins+in+living+cells+using+bimolecular+fluorescence+complementation.">Visualization of interactions among bZIP and Rel family proteins in living cells using bimolecular fluorescence complementation.</a> Mol. Cell. 9 (4), 789-798 (2002).</li><li>Kerppola, T. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bimolecular+fluorescence+complementation+(BiFC)+analysis+as+a+probe+of+protein+interactions+in+living+cells.">Bimolecular fluorescence complementation (BiFC) analysis as a probe of protein interactions in living cells.</a> Annu. Rev. Biophys. 37, 465-487 (2008).</li><li>Kodama, Y., Hu, C. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bimolecular+fluorescence+complementation+(BiFC):+a+5-year+update+and+future+perspectives.">Bimolecular fluorescence complementation (BiFC): a 5-year update and future perspectives.</a> Biotechniques. 53, 285-298 (2012).</li><li>Lingwood, D., Simons, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lipid+Rafts+As+a+Membrane-Organizing+Principle.">Lipid Rafts As a Membrane-Organizing Principle.</a> Science. 327 (5961), 46-50 (2009).</li><li>Tian, T., Harding, A., Inder, K., Plowman, S., Parton, R. G., Hancock, J. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Plasma+membrane+nanoswitches+generate+high-fidelity+Ras+signal+transduction.">Plasma membrane nanoswitches generate high-fidelity Ras signal transduction.</a> Nat. Cell Biol. 9 (8), 905-914 (2007).</li><li>Betzig, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Imaging+intracellular+fluorescent+proteins+at+nanometer+resolution.">Imaging intracellular fluorescent proteins at nanometer resolution.</a> Science. 313 (5793), 1642-1645 (2006).</li><li>Hess, S. T., Girirajan, T. P. K., Mason, M. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ultra-high+resolution+imaging+by+fluorescence+photoactivation+localization+microscopy.">Ultra-high resolution imaging by fluorescence photoactivation localization microscopy.</a> Biophys. J. 91 (11), 4258-4272 (2006).</li><li>Nickerson, A., Huang, T., Lin, L. J., Nan, X. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Photoactivated+Localization+Microscopy+with+Bimolecular+Fluorescence+Complementation+(BiFC-PALM)+for+Nanoscale+Imaging+of+Protein-Protein+Interactions+in+Cells.">Photoactivated Localization Microscopy with Bimolecular Fluorescence Complementation (BiFC-PALM) for Nanoscale Imaging of Protein-Protein Interactions in Cells.</a> PloS one. 9 (6), e100589 (2014).</li><li>Manley, S., Gillette, J. M., Lippincott-Schwartz, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single-particle+tracking+photoactivated+localization+microscopy+for+mapping+single-molecule+dynamics.">Single-particle tracking photoactivated localization microscopy for mapping single-molecule dynamics.</a> Methods Enzymol. 475, 109-120 (2010).</li><li>Shyu, Y. J., Hu, C. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fluorescence+complementation:+an+emerging+tool+for+biological+research.">Fluorescence complementation: an emerging tool for biological research.</a> Trends Biotechnol. 26 (11), 622-630 (2008).</li><li>Fan, J. Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Split+mCherry+as+a+new+red+bimolecular+fluorescence+complementation+system+for+visualizing+protein-protein+interactions+in+living+cells.">Split mCherry as a new red bimolecular fluorescence complementation system for visualizing protein-protein interactions in living cells.</a> Biochem. Biophys. Res. Commun. 367 (1), 47-53 (2008).</li><li>Kerppola, T. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Design+and+implementation+of+bimolecular+fluorescence+complementation+(BiFC)+assays+for+the+visualization+of+protein+interactions+in+living+cells.">Design and implementation of bimolecular fluorescence complementation (BiFC) assays for the visualization of protein interactions in living cells.</a> Nat. Protoc. 1, 1278-1286 (2006).</li><li>Gomez-Martinez, M., Schmitz, D., Hergovich, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Generation+of+stable+human+cell+lines+with+Tetracycline-inducible+(Tet-on)+shRNA+or+cDNA+expression.">Generation of stable human cell lines with Tetracycline-inducible (Tet-on) shRNA or cDNA expression.</a> J. Vis. Exp. March. (73), e50171 (2013).</li><li>Robida, A. M., Kerppola, T. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bimolecular+fluorescence+complementation+analysis+of+inducible+protein+interactions:+effects+of+factors+affecting+protein+folding+on+fluorescent+protein+fragment+association.">Bimolecular fluorescence complementation analysis of inducible protein interactions: effects of factors affecting protein folding on fluorescent protein fragment association.</a> J. Mol. Biol. 394 (3), 391-409 (2009).</li><li>Ding, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ratiometric+biosensors+based+on+dimerization-dependent+fluorescent+protein+exchange.">Ratiometric biosensors based on dimerization-dependent fluorescent protein exchange.</a> Nat. Methods. 12 (3), (2015).</li><li>Seidman, C. E., Struhl, K., Coligan, J. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Introduction+of+plasmid+DNA+into+cells.">Introduction of plasmid DNA into cells.</a> Curr. Protoc. Protein Sci. Appendix 4, 4D (2001).</li><li>Morrison, S. L., Coligan, J. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Preparing+frozen+bacterial+stocks.">Preparing frozen bacterial stocks.</a> Curr. Protoc. Immunol. Appendix 3, Appendix 3M (2001).</li><li>Campeau, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+versatile+viral+system+for+expression+and+depletion+of+proteins+in+mammalian+cells.">A versatile viral system for expression and depletion of proteins in mammalian cells.</a> PloS One. 4 (8), e6529 (2009).</li><li>Liu, H., Naismith, J. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+efficient+one-step+site-directed+deletion,+insertion,+single+and+multiple-site+plasmid+mutagenesis+protocol.">An efficient one-step site-directed deletion, insertion, single and multiple-site plasmid mutagenesis protocol.</a> BMC Biotechnol. 8 (91), (2008).</li><li>Deschout, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Precisely+and+accurately+localizing+single+emitters+in+fluorescence+microscopy.">Precisely and accurately localizing single emitters in fluorescence microscopy.</a> Nat. Methods. 11 (3), 253-266 (2014).</li><li>Nan, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single-molecule+superresolution+imaging+allows+quantitative+analysis+of+RAF+multimer+formation+and+signaling.">Single-molecule superresolution imaging allows quantitative analysis of RAF multimer formation and signaling.</a> Proc. Natl. Acad. Sci. USA. 110 (46), 18519-18524 (2013).</li><li>Chenouard, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Objective+comparison+of+particle+tracking+methods.">Objective comparison of particle tracking methods.</a> Nat. Methods. 11 (3), 281-289 (2014).</li><li>Persson, F., Lind&#233;n, M., Unoson, C., Elf, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Extracting+intracellular+diffusive+states+and+transition+rates+from+single-molecule+tracking+data.">Extracting intracellular diffusive states and transition rates from single-molecule tracking data.</a> Nat. Methods. 10 (3), 265-269 (2013).</li><li>Liu, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Super-resolution+imaging+and+tracking+of+protein&#8211;protein+interactions+in+sub-diffraction+cellular+space.">Super-resolution imaging and tracking of protein&#8211;protein interactions in sub-diffraction cellular space.</a> Nat. Commun. 5, 1-8 (2014).</li><li>Xia, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Super-resolution+imaging+reveals+structural+features+of+EB1+in+microtubule+plus-end+tracking.">Super-resolution imaging reveals structural features of EB1 in microtubule plus-end tracking.</a> Mol. Biol. Cell. 25 (25), 4166-4173 (2014).</li></ol>

The authors have nothing to disclose.

PALM 그대로 생체 시료의 나노 이미징을 가능하게하는 최근 단일 분자 수퍼 해상도 현미경 기법 동안 BiFC는 검출 셀에서 프로톤 펌프 억제제를 시각화 기술에 일반적으로 사용되어왔다. 손바닥 BiFC의 조합은 나노 미터 공간 해상도와 단일 분자 감도 세포 내에서 프로톤 펌프 억제제의 선택 영상을 달성했다. BiFC-PALM은 두 가지 기술의 유틸리티를 확장하고,이 연구에서 입증 된 바와 같이, 그 나라의 셀룰러 맥락에서 프로톤 펌프 억제제의 분자 세부 사항을 공개 큰 약속을 보여줍니다. 특히, 나노 미터 해상도는 생물 의학 연구에 도전하고있다 분자 규모에서 특정 프로톤 펌프 억제제의 공간 및 시간 규제, 자세한 조사를 할 수 있습니다. 앞서 언급 그러나, BiFC-PALM은 보완 느린 발색단 성숙의 비가역성에 의해 제한된다. 스플릿 PAmCherry1은 원칙을 증명하기 위해 사용 된 UBiFC-PALM의 tility. PAmCherry1 널리 우수한 광 물리 특성에 대한 PALM 실험에 사용되어왔다. 프로톤 펌프 억제제에 결합 할 때 BiFC 프로브로서 PAmCherry1 사용의 또 다른 이점은 37 ℃에서 단백질 재구성에 낮은 배경 및 높은 특이성과 효율성이다. 이러한 이유로, 분할 PAmCherry1 BiFC 프로브 프로톤 펌프 억제제의 고해상도 영상을 포함한 다양한 생물학적 연구에 적용 할 수있는 귀중한 자원이 될 것으로 예상된다. PAmCherry1, photoconvertible 형광 단백질, mEos3.2뿐만 아니라, 또한 BiFC-PALM 26 나뉘었다. 그 발광 스펙트럼이 중첩되므로 mEos3.2 및 PAmCherry1 함께 사용될 수 없지만, 녹색 PA-FPS 최근 프로톤 펌프 억제제의 2 색 나노 수퍼 해상도 영상에 대한 가능성을 열어 27보고되었다. 종래 BiFC 같이 BiFC-PALM 구현에서 중요한 단계는 융합 작 제물의 클로닝 및 디자인이다. 사실까지 그8 개의 서로 다른 식 구조로 복제 할 필요가 여덟 BiFC 쌍은 BiFC과 BiFC - 손바닥 지루한, 금지하지 않는 경우는, 과정이 될 수 있습니다 구현하는 각 시도에서 시험되어야한다. 라스 미친 예에 도시 된 바와 같이 그럼에도 불구하고, 종종 관심 단백질의 생화학 적 및 구조적 특성에 대한 사전 지식은 BiFC 쌍들의 감소 된 수를 테스트 할 함께 융합 구조의 최적 설계를 안내하는데 사용될 수있다. 즉, 현재 BiFC는 (따라서 BiFC-PALM)이 실험이 작동 할 수 있도록하는 보편적 인 가이드 라인이없는, 단계; 그것의 대부분은 여전히​​ 예술이다. BiFC 및 BiFC-PALM는 일반적으로 두 단백질 사이의 이종의 형성을 조사하는데 사용되는 반면, 2 개의 후보 단백질이 동일한 것,이 경우에 이러한 접근 방식을 이용하여 호모 다이머 형성을 연구하는 것도 가능하다. 그러나, 이와 같이, 동일한 단편 두 단백질 상호 작용할 수 있지만 BiFC 신호 발생하지. 각 구조는 역할에도 불구하고성공적인 보완의 결과로 상호 작용이 비가역성에 의한 축적 할 동안 다른, 이러한 상호 작용에 경쟁 억제제, 되돌릴 수 있습니다. 각 구조체의 발현 수준 사이의 급격한 차이가 있으면, 일반적으로, 신호의 감소가있을 수있다. 따라서, 두 가지 작 제물의 발현은 내인성 발현 수준 (야생형 및 돌연변이 호모 다이머 샘플 사이의 예)의 형광 강도를 비교할 때 결정되어야 할 필요가있다. BiFC 실험은 일반적으로 일시적 형질과 구조의 과발현으로 수행되는 이유는 아마도. 마지막으로이 모든 BiFC 실험은 적절한 컨트롤을 확인해야합니다. BiFC 신호가있는 경우, 신호 (즉, 단편이 아닌 때문에 PPI의 스스로 재구성된다) 비특이적 인 가능성이 있습니다. 한 음성 대조군은 하나의 돌연변이 또는 알려진 두 단백질이다BiFC 신호의 상당한 손실을 초래한다 상호 작용을 방해한다. 예컨대 점 돌연변이를 알 수없는 경우, 다른 방법이 이러한 단백질의 하나 경쟁적 결합 파트너를 도입로서 사용될 수 있고, 신호의 동반 감소가 있는지. 더 어려운 상황이 BiFC 신호 또는 음성 (false negative)의 부족 문제를 해결한다. 이러한 경우, 이러한 형질 감염 동안 GFP 제어와 같은 클로닝 과정 양성 대조군을 포함하는 것이 중요하다. 서양 말은 구조의 발현을 확인하기 위해 실행할 수 있습니다. 이러한 요인은 정상적인 경우, 다른 요소는 링커 길이 및 / 또는 서열, 또는 다른 BiFC 구성이 고려되어야 같이 변경 될 필요가있다. 이미지를 처리​​ 할 때 손바닥 부분에 관해서는, 매개 변수의 수를 고려해야합니다. 단계 2.4.2.1은 좌표를 선별 및 PALM 최종 이미지를 생성하는데 사용되는 파라미터를 설명한다. 첫번째우리가 이전 23 설명 된 바와 같이 두 개의 매개 변수, 프레임을 결합하고 거리의 결합은, ~ 떨어져 0.8 초 두 현지화 이벤트가 100 나노 미터 내에서 모두하고 (100 밀리 초 / 프레임에서) 미만 8 프레임을 표시하는 경우 정의하거나. 그렇다면, 이들은 동일 분자에서 발생하는 것으로 간주되고, 그 좌표는 평균화함으로써 결합 될 것이다. PAmCherry1는 드문 것 같습니다 0.8 초보다 훨씬 더 수명 어두운 상태; 장수명 어두운 상태에서 회복 형광의 이벤트가 근위 거리 발광 형광에 다른 분자와 구별로, 두 위치 파악 이벤트들이 어떤 수의 프레임 내에서 나타나있는 경우에만 동일 분자에서 발생하는 것으로 간주 물리적 거리. 경험적으로, 8 ~ 12 프레임 (0.8 ~ 1.2 초)에서 &#39;프레임을 결합&#39;설정은 우리의 실험 조건에서 최적의 것으로 보인다. 최소 RMS 피팅 진폭 및 잔류 잡음의 표준 편차 후 간의 최소 비율을 정의피팅. 이 값은 좌표 추출시 .cor 파일에 기록된다. 요약하면, BiFC - 팜 BiFC와 팜의 장점을 결합하여 이전에 달성 한 것보다 훨씬 더 많은 세부 사항에서 프로톤 펌프 억제제의 조사를 할 수 있습니다. 위의 적절한 제어 실험과 요인에 대한 고려와 함께, BiFC-PALM 생물학적 설정의 넓은 범위에서 프로톤 펌프 억제제를 연구하는데 유용한 도구가 될 것이다.

단백질 - 단백질 상호 작용 (프로톤 펌프 억제제)는 생물학 1 기본적인 단단히 많은 시간과 길이 스케일에서 시공간 메커니즘을 통해 조절된다. 세포막 시그널링 세포에 관한 연구는 예를 들어, 특정 프로톤 펌프 억제제 및 세포 과정 (2)을 용이하게 동적 나노 스케일 공간 구획을 밝혀냈다. 따라서, 충분한 공간 및 시간 해상도, 높은 특이성 및 고감도 생물학적 시스템에서 프로톤 펌프 억제제를 검사 할 수있는 능력은 생물의 기계적 이해를 달성하기위한 키이다. 5 - 이분자 형광 보완 (BiFC)는 세포 내 해상도와 라이브 셀 호환성 3 셀에 프로톤 펌프 억제제를 시각화에 대한 몇 가지 기존 도구 중 하나입니다. 이 기술은 비교적 간단하고 두 비 형광 조각으로 형광 단백질의 분리를 포함한다; 유전자 두 개의 상호 작용하는 단백질에 태그 때근접하게, 단편은 형광 신호를 산출 완전한 형광 단백질을 형성하도록 재구성 할 수있다. 적절하게 설계하면 BiFC 프로브 자발적 프로톤 펌프 억제제의 부재하에 재구성 안된다. 이와 같이, BiFC 분석에서의 형광 신호 만 높은 특이성 프로톤 펌프 억제제의 직접적인 시각화를 가능하게 프로톤 펌프 억제제의 존재하에 일어난다. 판독으로 형광을 사용하는 추가 혜택은 다른 사람의 사이에서 높은 처리량과 높은 콘텐츠 심사 분석, 높은 감도, 세포 내 해상도 및 호환성이다. 이러한 장점에 대해, 다른 상위 형광 단백질에 기초 BiFC 프로브의 수는 개발되었다. 통상적 인 광 현미경 검사에 기초하여 모든 다른 검출 기술에서와 같이, 그러나 BiFC의 공간 분해능은 빛의 회절에 의해 ~ 250 나노 미터로 제한된다. 이 지질 뗏목 (6)을하여 이전 언급과 예시 된 바와 같이, 나노 스케일에서 프로톤 펌프 억제제의 조절을 연구하기 위해 그것에게 도전한다ND 라스 나노 클러스터 (7)는 이러한 시그널링 많은 세포 과정을 이해하는데 중요한 길이 스케일이다. BiFC는 프로톤 펌프 억제제 (10) 이미징을위한 공간 해상도에서이 한계를 극복하기 위해 광 활성화 현지화 현미경 (PALM) 8,9과 결합되었다. 손바닥 확률 활성화 및 단일 형광 분자의 subdiffractive 현지화를 통해 형광 이미징의 회절 한계를 우회 최근 수퍼 해상력 현미경 기술이다. 각 사이클에서 활성화, 형광 분자는 몇천 광자 몇백을 방출하고 검출기상의 단일 분자 영상을 발생시킨다. 화상 회절 한정 동안 (~ 250 nm의 폭)은, 그 중심은 일반적으로 검출 된 광자의 수에 따라 10 ~ 50 nm 인 주문에, 훨씬 더 높은 정밀도로 측정 할 수있다. 활성화하고 샘플의 각 형광 분자를 로컬 화하여, 고해상도 화상이 재구성 될 수있다. Performe살아있는 세포에 D, 하나의 셀 (11)에서 단백질 확산 궤적 수천의 단일 분자 추적 (SMT를 구분) 종려 추가 허가 취득. 중요한 것은, 손바닥 확률 활성화를 달성하기 위해 이러한 광활성 형광 단백질 (PA-FPS)와 같은 특수 형광 프로브를 사용합니다. BiFC 및 PALM 이용 형광 단백질 양 때문에,이 아미노산 159과 160 사이의 두 단편으로, PALM PAmCherry1 위해, 일반적으로 사용되는 PA-FP를 분할하여 혼합 하였다. 스플릿 PAmCherry1에 기초 BiFC 시스템은 두 조각의 자발적인 재구성에서 낮은 배경 신호를 나타낸다. 상호 작용하는 단백질의 유전자 쌍 태그 때, 두 조각 (RN = 159은 잔기 RC = + 잔기 1백60부터 2백36까지 메트)에도 37 ℃ 낮은 온도에서 배양없이 완전한 PAmCherry1 단백질을 형성하도록 효율적으로 재구성 어느 이러한 부모 mCherry (13)와 같은 다른 BiFC 쌍 (12)의 경우에는 해당되지 않습니다. Furthermo다시 재구성 PAmCherry1 단백질은 정확한 단일 분자 현지화 및 고해상도 PALM 영상에 중요한 다른 사람 사이의 높은 명암비, 매체 광자 수율, 빠른 photoactivati​​on, 같은 부모 PAmCherry1의 광 물리 특성을 유지했다. 이 프로토콜에서, 스플릿 PAmCherry1 (도 1A)를 사용하여 U2OS 세포에서 라스 - 미친 상호 작용을 이미징 BiFC-PALM의 사용을 설명한다. 첫 번째 단계는 PAmCherry1 단편 (즉, RN과 RC) 및 관심 단백질 사이의 융합 단백질을 표현하기위한 구조를 설계하는 것이다. 이론적으로, 후보 단백질 (A 및 B)의 각 쌍에 대해, 융합 단백질 여덟 쌍 테스트 될있다 : RN-A / RC-B; RN-A / B-RC; RC-A / RN-B; RC-A / B-RN; A-RN / RC-B; A-RN / B-RC; -RC / RN-B; 및-RC는 / B-RN. 이 프로세스는 종종 계정에 후보 단백질의 구조적 또는 생화학 적 특성을 고려함으로써 단순화 될 수있다. 라스의 경우, 상기 단백질은번역 후 C- 말단 CAAX 상자에서 수정 (C = Cys이고; = 지방족, X = 모든), 그 후 AAX 모티브 전원이 절단된다. 따라서, RN 또는 RC은 라스의 N 말단에 융합 될 수있다; 이 4 개의 (도 1b)에 대한 융합 단백질의 쌍의 수를 감소시킨다. Raf를 들어, 도메인은 라스 - 결합 (RBD를 잔기 51에서 1백31까지)가 사용되며, 양단에 태그 될 수있다. 이러한 네 융합 구성이 생성되었다 : RN-KRAS / RC-Raf를 RBD; RN-KRAS / Raf를 RBD-RC; RC-KRAS / RN-Raf를 RBD; 와 RC-KRAS / Raf를 RBD-RN. 또한, 단편 및 관심 단백질 사이의 링커는 고려 될 필요가있을 것이다. 약 10 아미노산 링커는 유연 종종 보완이 발생하기에 충분한 자유도를 제공로서 사용된다. 여러 복제 사이트 (MCS) (14)에서 생성 된 임의의 시퀀스를 포함하여 성공적으로 적용되어 많은 사람들이 있기는하지만 그 중 하나 링커, (GGGGS) X2입니다. 링커의 길이는 dependin 최적화 될 필요가있다관심의 단백질과 방향 상호 작용의 크기에 들어. PAmCherry1 단편의 MCS의 측면에있는 작은 복제 백본에 포함되어 있습니다 (자료 목록 참조). 관심있는 유전자는 제한 부위로 결찰 또는 독립적 인 방식으로 삽입 될 수있다. 클로닝 및 서열 확인 후, 발현 카세트가 재조합 효소 반응, 높은 정확도 및 높은 효율로 복제 프로세스를 사용하여 발현 벡터로 전달된다. 이어서, 생성 된 작 제물은 발현 표적 세포주를 감염위한 안정된 세포주 원하면, 렌티 바이러스로 패키지, 표적 세포주로 형질 감염 또는된다. 과도 형질은 BiFC 구성의 빠른 확인이 가능하지만, 잠재적 인 문제는 주목해야합니다. 종종 화학 물질을 사용하는 형질 감염이 높은 형광도의 결과, 세포를 강조; 반면 전반사 형광 (TIRF) microsco 사용PY는 프로톤 펌프 억제제는 세포막에 일어날 때 조명 볼륨 TIRF 이상적 제한함으로써 이러한 배경 신호를 완화 할 수있다. 또한, 일시적인 형질은 종종까지 프로톤 펌프 억제제를 검출하는 아티팩트가 발생할 수 있습니다 내인성 단백질의 사람들을 초과, 단백질 발현의 높은 수준을 초래할. 따라서, 적절한 BiFC 구성은 초기 테스트를 통해 측정 한 후 안정한 세포주를 확립하는 것이 권장된다. 안정한 세포주는 독시사이클린 유도 (15)를 통해 조정 가능한 발현의 가능성을 가지고있다. 감염 후 세포는 일반적으로 퓨로 마이신과 각 구조에 대한 네오 마이신, 하나, 항생제로 선택됩니다. 샘플 준비, 이미지 수집 및 데이터 분석을위한 후속 단계는 프로토콜에 상세히 설명한다. 이 방법, 라스-Raf를 RBD의 BiFC-PALM 이미지에서 나노 클러스터의 형성이 정기적으로 관찰된다 (그림 2A &lt;/ STRONG&gt;). 지속적으로, 라스-Raf를 RBD의 SMT-PALM 궤도는 확산 상태 (그림 2B-D)에서 이종 분포를 보여줍니다. 이러한 결과는 라스-Raf를 착체 잠재적 생물 함의 아마도 단량체 및 클러스터로서, 세포막의 여러 상태에 있는지 제안한다. 이 작업은 종래 BiFC 형광 공동 지역화 또는 형광 공명 에너지 전달 (FRET)을 얻는 것이 어려울 수 나노 미터의 공간 해상도와 단일 분자 감도를 가진 세포에서의 프로톤 펌프 억제제의 선택적 이미징 BiFC-PALM의 전력을 나타낸다. BiFC 실험을 설계하고 결과를 해석 할 때, BiFC 프로세스가 분할 PAmCherry1을 포함하여 대부분의 경우에 돌이킬 명심하는 것이 중요하다. 두 조각이 결합하여 완전한 PAmCherry1 단백질, 두 조각 사이의 결합을 형성하고, 일단 따라서 PPI는 영구된다. 이것은 BiFC과 BiFC-PAL의 사용을 제한프로톤 펌프 억제제의 역학 (즉, 결합 반응 속도가 아니라이 형성되면 단백질 복합체의 확산 역학)를 모니터링하고 시간에 M 심지어 PPI 단지의 mislocalization가 발생할 수 있습니다. BiFC-PALM 실험을 설계하는 형광 단백질에 내재되어 발색단 성숙의 지연 인 경우 추가 요인을 고려해야한다. 두 단백질이 상호 작용하고 FP 조각이 함께 모여되면, 그들은 일반적으로 초 (EYFP 3 60 초 하프 타임)의 순서에 접힘. 그러나, 이후의 발색단의 성숙과 형광 신호 분 정도의 개발. 형광 분할 금성, 빨리 접는 YFP 변형의 재구성 후 10 분 이내에 검출 할 수 있지만, 일반적으로 성숙 하프 타임은 종종 약 60 분 (16)이다. 분할 PAmCherry1 비슷한 속도를 가지고 관찰 하였다. 따라서, BiFC과 BiFC-PALM 실시간 PPI 속도론을 모니터링 현재 가난한 선택할 수 있습니다; 다른 나FRET과 같은 최근 개발 된 이량 종속 형광 단백질 17 thods 등이 목적에 더 적합 할 수있다.

<table><tbody><tr><td>Microscope frame</td><td>Nikon</td><td>Ti-U</td><td></td></tr><tr><td>60X oil immersion TIRF objective with 1.49 NA</td><td>Nikon</td><td>CFI Apo TIRF 60x H</td><td></td></tr><tr><td>EMCCD camera</td><td>Andor</td><td>iXon Ultra 897</td><td></td></tr><tr><td>561 nm laser</td><td>Opto Engine</td><td>MGL-FN-561</td><td></td></tr><tr><td>405 nm laser</td><td>Coherent</td><td>CUBE-405 50mW</td><td></td></tr><tr><td>561 nm dichroic mirror</td><td>Semrock</td><td>&amp;nbsp;Di01-R405/488/561/635-25x36</td><td></td></tr><tr><td>561 nm filter</td><td>Semrock</td><td>FF01-525/45-25</td><td></td></tr><tr><td>405/561 nm notch filter</td><td>Semrock</td><td>NF01-405/488/568-25</td><td></td></tr><tr><td>Temperature and CO&lt;sub&gt;2&lt;/sub&gt; controlled stage</td><td>Tokai Hit</td><td>INUBG2ATW-PLAM</td><td></td></tr><tr><td>pENTR-D-TOPO-PAmCherry1_1-159-MCS</td><td>Addgene</td><td>60545</td><td></td></tr><tr><td>pENTR-D-TOPO-PAmCherry160-236-MCS</td><td>Addgene</td><td>60546</td><td></td></tr><tr><td>pcDNA3.2-DEST</td><td>Life Technologies</td><td>12489-019</td><td></td></tr><tr><td>pLenti-DEST</td><td>Addgene</td><td></td><td>http://www.addgene.org/Eric_Campeau/</td></tr><tr><td>Phusion High-Fidelity DNA Polymerase</td><td>Thermo Scientific</td><td>F-531</td><td></td></tr><tr><td>In-Fusion HD Cloning</td><td>Clontech</td><td>639649</td><td></td></tr><tr><td>LR Clonase</td><td>Life Technologies</td><td>11791</td><td></td></tr><tr><td>Vira Power Lentivirus Packaging</td><td>Life Technologies</td><td>K497500</td><td></td></tr><tr><td>X-tremeGENE Transfection Reagent</td><td>Roche</td><td>13873800</td><td></td></tr><tr><td>Lab-Tek II Chambered Coverglass</td><td>Thermo Scientific</td><td>155409</td><td>#1.5 glass bottom dishes</td></tr><tr><td>U2OS cells</td><td>ATCC</td><td>HTB-96</td><td></td></tr><tr><td>293T/17 cells</td><td>ATCC</td><td>CRL-11268</td><td></td></tr><tr><td>DMEM with phenol red</td><td>Life Technologies</td><td>11995</td><td></td></tr><tr><td>DMEM no phenol red</td><td>Life Technologies</td><td>21063</td><td></td></tr><tr><td>Fetal bovine serum</td><td>Life Technologies</td><td>10082</td><td></td></tr><tr><td>Leibovit&#039;s L-15, no phenol red</td><td>Life Technologies</td><td>21083-027</td><td></td></tr><tr><td>Reduced serum medium</td><td>Life Technologies</td><td>31985</td><td></td></tr><tr><td>Phosphate Buffered Saline</td><td>Life Technologies</td><td>14040</td><td></td></tr><tr><td>Syringe</td><td>BD Biosciences</td><td>309604</td><td></td></tr><tr><td>Syringe filter</td><td>Millipore</td><td>SLHV033RB</td><td></td></tr><tr><td>Lentiviral concentrator</td><td>Clontech</td><td>631231</td><td></td></tr><tr><td>Retroviral concentrator</td><td>Clontech</td><td>631455</td><td></td></tr><tr><td>10 cm culture dish</td><td>BD Biosciences</td><td>353003</td><td></td></tr><tr><td>6-well culture plate</td><td>BD Biosciences</td><td>353046</td><td></td></tr><tr><td>Polybrene</td><td>Sigma</td><td>107689</td><td></td></tr><tr><td>Puromycin</td><td>Life Technologies</td><td>A11138</td><td></td></tr><tr><td>G-418</td><td>Calbiochem</td><td>345812</td><td>Neomycin</td></tr><tr><td>Doxycyline</td><td>Fisher</td><td>BP2653</td><td></td></tr><tr><td>Tris base</td><td>Fisher</td><td>BP152</td><td></td></tr><tr><td>EDTA</td><td>Sigma</td><td>EDS</td><td></td></tr><tr><td>Sodium Hydroxide</td><td>Sigma</td><td>S5881</td><td></td></tr><tr><td>Paraformaldehyde</td><td>Sigma</td><td>158127</td><td></td></tr><tr><td>Glutaraldehyde</td><td>Sigma</td><td>G6257</td><td></td></tr><tr><td>PIPES</td><td>Sigma</td><td>P6757</td><td></td></tr><tr><td>HEPES</td><td>Sigma</td><td>H4034</td><td></td></tr><tr><td>EGTA</td><td>Sigma</td><td>3777</td><td></td></tr><tr><td>Magnesium Sulfate</td><td>Sigma</td><td>M2643</td><td></td></tr><tr><td>Potassium Hydroxide</td><td>Sigma</td><td>221473</td><td></td></tr><tr><td>Sodium chloride</td><td>Fisher</td><td>BP358</td><td></td></tr><tr><td>Magnesium chloride</td><td>Fisher</td><td>M33</td><td></td></tr><tr><td>100 nm gold particles</td><td>BBI Solutions</td><td>EM.GC100</td><td></td></tr><tr><td>Molecular grade water</td><td>Life Technologies</td><td>10977</td><td></td></tr><tr><td>Dpn1</td><td>New England Biolabs</td><td>R0176</td><td></td></tr><tr><td>PCR purification kit</td><td>Qiagen</td><td>28104</td><td></td></tr><tr><td>Miniprep kit</td><td>Qiagen</td><td>27104</td><td></td></tr><tr><td>Midiprep kit</td><td>Macherey-Nagel</td><td>740410</td><td></td></tr><tr><td>0.6 ml microcentrifuge tubes</td><td>Fisher</td><td>05-408-120</td><td></td></tr><tr><td>1.5 ml microcentrifuge tubes</td><td>Fisher</td><td>05-408-137</td><td></td></tr><tr><td>15 ml tubes</td><td>Fisher</td><td>05-539-12</td><td></td></tr><tr><td>5 ml polypropylene round-bottom tubes</td><td>BD Biosciences</td><td>352063</td><td></td></tr><tr><td>14 ml polypropylene round-bottom tubes</td><td>BD Biosciences</td><td>352059</td><td></td></tr><tr><td>50 ml tube</td><td>BD Biosciences</td><td>352070</td><td></td></tr><tr><td>PCR tube</td><td>GeneMate</td><td>C-3328-1</td><td></td></tr><tr><td>SOC medium</td><td>Life Technologies</td><td>15544</td><td></td></tr><tr><td>LB broth</td><td>BD Biosciences</td><td>244610</td><td></td></tr><tr><td>Kanamycin sulfate</td><td>Fisher</td><td>BP906</td><td></td></tr><tr><td>Competent cells</td><td>Life Technologies</td><td>C4040</td><td></td></tr><tr><td>Matlab</td><td>Mathworks</td><td></td><td></td></tr></tbody></table>

photoactivated localization microscopy with bimolecular fluorescence complementation (bifc-palm)

Protein-protein interactions (PPIs) are key molecular events to biology. However, it remains a challenge to visualize PPIs with sufficient resolution and sensitivity in cells because the resolution of conventional light microscopy is diffraction-limited to ~250 nm. By combining bimolecular fluorescence complementation (BiFC) with photoactivated localization microscopy (PALM), PPIs can be visualized in cells with single molecule sensitivity and nanometer spatial resolution. BiFC is a commonly used technique for visualizing PPIs with fluorescence contrast, which involves splitting of a fluorescent protein into two non-fluorescent fragments. PALM is a recent superresolution microscopy technique for imaging biological samples at the nanometer and single molecule scales, which uses phototransformable fluorescent probes such as photoactivatable fluorescent proteins (PA-FPs). BiFC-PALM was demonstrated by splitting PAmCherry1, a PA-FP compatible with PALM, for its monomeric nature, good single molecule brightness, high contrast ratio, and utility for stoichiometry measurements. When split between amino acids 159 and 160, PAmCherry1 can be made into a BiFC probe that reconstitutes efficiently at 37 &#176;C with high specificity to PPIs and low non-specific reconstitution. Ras-Raf interaction is used as an example to show how BiFC-PALM helps to probe interactions at the nanometer scale and with single molecule resolution. Their diffusion can also be tracked in live cells using single molecule tracking (smt-) PALM. In this protocol, factors to consider when designing the fusion proteins for BiFC-PALM are discussed, sample preparation, image acquisition, and data analysis steps are explained, and a few exemplary results are showcased. Providing high spatial resolution, specificity, and sensitivity, BiFC-PALM is a useful tool for studying PPIs in intact biological samples.

표시된 BiFC-PALM 예제 CRaf의 도메인 (RBD) (그림 1A)를 결합 라스와 상호 작용 KRAS G12D 돌연변이입니다. 논의 된 바와 같이 그것의 라스 막 지역화 때문에 생물학적 활성을 방해 할 것이기 때문에, RN 또는 RC 라스 단편의 C- 말단에 태그되지 않았다. 이 네 가지 (그림 1B)에 여덟에서 가능한 조합을 감소시켰다. 이러한 네 개의 조합들 각각은 렌티 바이러스를 사용하여 감염 U2OS 세포에 도입 하였다. 프로토콜에서 설명하는대로 세포를 고정하고, BiFC 신호는 팜 설정을 사용하여 평가 하였다. 405 nm의 레이저가 켜져 때 긍정적 인 BiFC 신호와 세포 형광의 급격한 증가에 의해 확인되었다; 561 nm의 레이저 이미징 실험 내내이었다. 형광이 갑작스러운 변화는 405 nm의 레이저와 조명에 따라 BiFC-재구성 PAmCherry1의 photoactivati​​on 때문이다. 샘플의 복수의 영역은이 방법을 사용하여 평가 하였다및 BiFC 신호 강도가 전 화소 강도의 증가에 의해 평균 405 nm의 레이저로부터의 고전력 펄스 후에 계산 하였다. 그림 1C에서 볼 수 있듯이, 네 가지 구성 중, 두 가지 구성은 (즉-RN 라스 / RC-Raf를 RBD 및 RN-RAS / Raf를 RBD-RC)는 강한 BiFC 신호를했다. 또 다른 구성 (RC-RAS / Raf를 RBD-RN)는 약한 신호가 있고, 하나는 아무런 신호도 없었다. 모든 후속 실험에서, RN-RAS / Raf를 RBD-RC 구성 (도 1C에서 오른쪽 위)을 사용 하였다. 네거티브 대조군으로서, Raf를 라스의 결합 도메인에 점 돌연변이 (R89L)을 도입하고, 동일한 구성을 사용 BiFC 효율 시험 하였다. 이 돌연변이는 Raf를가 라스 결합을 방해하는 것으로 알려져 있었다; 지속적으로, 돌연변이는 크게 BiFC 신호 (그림 1D)를 감소시켰다. BiFC 통해 생성 PAmCherry1 분자는 원래 photoactivati​​on 유사한 특성을 나타내었다 때문에PAmCherry1 10, 이것은 상위 PAmCherry1와 동일한 실험 설정을 사용하여 BiFC 샘플 PALM 이미징을 허용한다. RN-RAS 영국 공군 RBD-RC와 감염 후 강한 BiFC 신호와 세포의 예를 손바닥 이미지는 그림 2A에 표시됩니다. 확대하면 (그림 2A 바닥은 왼쪽 박스 확대 분야와 세트), 개별 분자들이 나노 스케일의 공간 분포를 명확하게 볼 수 있습니다. 참고로,이 종려 이미지의 각 점은 PAmCherry1 분자로 태그 한 추정 라스-Raf를 RBD 단지를 나타냅니다. 비교를 위해,도 2b의 우측 클러스터 가릴 된 뷰의 동일한 필드의 저해상도 이미지를 시뮬레이션 하였다. 라스-Raf를 RBD 클러스터 RAS 및 관찰 된 Raf의 클러스터링 동작에 이전의 관찰과 일치한다. BiFC을 표현하는 살아있는 세포가 PAmCherry1을 재구성으로, SMT-팜 PERFO했다개별 라스-Raf를 RBD 단지의 확산 궤적을 획득 rmed 유사 이전에 (10)를 설명합니다. 561 nm의 405 nm의 레이저 연속 조명에 따라, 개별 PAmCherry1 분자는 확률 적에 스위치 (일부 인해 photobleaching에에) 어두운 상태에 들어가기 전에 몇 프레임을 지속. 부동 상태 (도 2B, 분자 1) 및 이동 상태 (도 2B, 분자 2)이 기간에서, 분자는 적어도 두 개의 서로 다른 확산 거동을 나타내었다. 궤도의 두 유형은 다수의 분자 궤도가 기록되어도 2c에 도시 된 (X, Y) 플롯에서 분명히 존재한다. 확산 상태의 불균일 분포는 동일한 연속적인 프레임 사이의 분자 변위 히스토그램으로부터 추론 될 수있다. 일반적으로 10,000 - 100,000 확산 궤적은 각 셀로부터 획득 될 수있다; 이 많은 수의 T의보다 엄격한 통계 분석이 가능그는 vbSPT 알고리즘 (25)와 예를 들어, 상태를 확산이. <img alt="그림 1" src="/files/ftp_upload/53154/53154fig1highres.jpg" width="700" /> 라스 - 영국 공군 상호 작용 그림 1. BiFC-PALM 실험 설계는. (A) 라스 활성 Raf를을 모집 막 결합 단백질이다. 비 - 분할 형광 PAmCherry1 단편 RAS 및 Raf를 부착하는 경우, 상호 작용은 함께 단편 및 상보성을 가져온다는 기능적 형광 단백질의 결과 발생한다. 그 막 현지화을 방해 할 그것의 C- 말단에 라스 태그 이후 (B)는, 라스-Raf를 BiFC-PALM 테스트 구성의 수는 8-4 감소 하였다. TIRF 현미경으로 찍은 테스트 구성을 표현 U2OS 세포 (C) 이미지. 각 구성의 BiFC 효율을 측정하기 위해 세포는 405 nm의 빛 동안의 같은 높은 복용량을 부여561 nm의 빛으로 흥분된다. Raf를 RBD로 R89L 돌연변이를 도입 (D)는 크게 RN-KRAS G12D / CRaf RBD-RC 구성의 BiFC 신호 감소 (C에서 오른쪽을, N = 5-8). 오차 막대는 (D)의 SEM이다. (C)의 스케일 바, 10 μm의. RN = PAmCherry1 N- 말단 단편, RC = PAmCherry1 C- 말단 단편, 및 RBD = 라스 결합 도메인. <a href="https://www-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/53154/53154fig1large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> <img alt="그림 2" src="/files/ftp_upload/53154/53154fig2highres.jpg" width="700" /> RN-KRAS G12D / CRaf RBD-RC 구성을 표현 U2OS 세포의 그림 2. BiFC-PALM. (A) 손바닥 전체 이미지가 위에 표시됩니다. 표시된대로 낮은 패널은 상단 이미지의 박스 지역의 전망을 확대하고 있습니다. 세트는 높은각각의 확대 전망에 박스 영역의 배율. 회절 제한 현미경으로 찍은 것처럼 하부 패널 (표시 TIRF)의 오른쪽은 왼쪽의 이미지의 표현입니다. (B) 느린 (1) 및 고속 (2) 이동 라스 - 영국 공군 단지를 묘사 살아있는 세포 SMT-PALM 실험에서 연속적인 프레임. 셀의 작은 영역 내에서 라스 - 미친 착체의 확산 궤적을 도시 SMT-PALM 실험에서 (C) 출력. (D) SMT-PALM 실험에서 라스 - 영국 공군 단지의 프레임 당 변위의 히스토그램. (A)의 스케일 바, 5 μm의 상단, 500 nm의 바닥, 50 나노 미터 세트, 및 (C), 1 ㎛. RN = PAmCherry1 N- 말단 단편, RC = PAmCherry1 C- 말단 단편, 및 RBD = 라스 결합 도메인. <a href="https://www-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/53154/53154fig2large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> <table><tbody><tr><td></td><td> 프라이머 서열 (5 &#39;3&#39;) </td></tr><tr><td> N- 말단 역에 삽입 플라스미드 복제 </td><td> CATGGTACCGAGCTCCTGCAGC </td></tr><tr><td> 순방향 N 말단 RN </td><td> GTGAGCAAGGGCGAGGAGGATAA </td></tr><tr><td> 앞으로 N- 말단에서 RC </td><td> GGCGCCCTGAAGGGCGA </td></tr><tr><td> 앞으로 C- 말단에 삽입 플라스미드 복제 </td><td> TAAAAGGGTGGGCGCGCC </td></tr><tr><td> C 말단 역방향에서 RN </td><td> GTCCTCGGGGTACATCCGCTC </td></tr><tr><td> C 말단 역방향에서 RC </td><td> CTTGTACAGCTCGTCCATGCCG </td></tr></tbody></table> 표 1. PAmCherry1 단편을 함유하는 플라스미드를 선형화 클로닝 프라이머. RN 및 RC 함유 클로닝 플라스미드 N- 또는 단편의 C- 말단에서의 삽입의 어느 시점에서, 역 PCR 선형화 될 수있다. 시퀀스가 나열되어 5 &#39;3R에17 ;. <table><tbody><tr><td></td><td> ( &#39;3&#39;5) 관심 프라이머의 유전자에 대한 오버행 </td></tr><tr><td> N- 말단 삽입 RN 또는 RC의 앞으로 </td><td> GAGCTCGGTACCATG </td></tr><tr><td> N 말단 삽입 RN 역방향 </td><td> ACTTCCACCTCCACCACTACCTCCACCTCCCTCGCCCTTGCTCAC </td></tr><tr><td> N 말단 삽입 RC 역방향 </td><td> ACTTCCACCTCCACCACTACCTCCACCTCCGCCCTTCAGGGCGCC </td></tr><tr><td> 순방향 C-단자 삽입 RN </td><td> ATGTACCCCGAGGACGGAGGTGGAGGTAGTGGTGGAGGTGGAAGT </td></tr><tr><td> 순방향 C-단자 삽입 RC </td><td> GACGAGCTGTACAAGGGAGGTGGAGGTAGTGGTGGAGGTGGAAGT </td></tr><tr><td> C-단자 삽입 RN 또는 RC 역방향 </td><td> GCGCCCACCCTTTTA </td></tr></tbody></table> 표 1 표 프라이머 일치 관심의 유전자 프라이머 2. 오버행. 결찰 독립적 반응 동성 15 염기쌍이 생성된다프라이머 오버행에서. 또한, 오버행은 (GGGGS) X2 유연한 링커에 대한 순서를 포함한다. 가요 성 링커 서열 대신에 표 1의 프라이머에 첨가 될 수있다. 시퀀스는 &#39;3&#39;5 나열되어 있습니다.

Watch this Scientific Journal Video about Photoactivated Localization Microscopy with Bimolecular Fluorescence Complementation BiFC-PALM at JoVE.com

Photoactivated Localization Microscopy with Bimolecular Fluorescence Complementation BiFC-PALM

Protein-protein interactions are visualized in cells with nanometer spatial resolution by combining bimolecular fluorescence complementation (BiFC) with photoactivated localization microscopy (PALM). Described here is the use of BiFC-PALM for imaging Ras-Raf interactions in U2OS cells for visualizing the nanoscale clustering and diffusion of individual Ras-Raf complexes.

이분자 형광 보완과 광 활성화 현지화 현미경 (BiFC-PALM)

Protein-protein interactions (PPIs) are key molecular events to biology. However, it remains a challenge to visualize PPIs with sufficient resolution and ...

photoactivated-localization-microscopy-with-bimolecular-fluorescence

Universidad San Sebastian

Research

JoVE Journal

Bioengineering

Photoactivated Localization Microscopy with Bimolecular Fluorescence Complementation (BiFC-PALM)

9.9K 조회수.  Oregon Health and Science University. Protein-protein interactions are visualized in cells with nanometer spatial resolution by combining bimolecular fluorescence complementation (BiFC) with photoactivated localization microscopy (PALM). Described here is the use of BiFC-PALM for imaging Ras-Raf interactions in U2OS cells for visualizing the nanoscale clustering and diffusion of individual Ras-Raf complexes. 

비디오: Photoactivated Localization Microscopy with Bimolecular Fluorescence Complementation BiFC-PALM

Visualization of Cortex Organization and Dynamics in Microorganisms, using Total Internal Reflection Fluorescence Microscopy

TIRF microscopy has emerged as a powerful imaging technology to study spatio-temporal dynamics of fluorescent molecules in vitro and in living cells1. The optical phenomenon of total internal reflection occurs when light passes from a medium with high refractive index into a medium with low refractive index at an angle larger than a characteristic critical angle (i.e. closer to being parallel with the boundary). Although all light is reflected back under such conditions, an evanescent wave is created that propagates across and along the boundary, which decays exponentially with distance, and only penetrates sample areas that are 100-200 nm near the interface2. In addition to providing superior axial resolution, the reduced excitation of out of focus fluorophores creates a very high signal to noise ratios and minimizes damaging effects of photobleaching2,3. Being a widefield technique, TIRF also allows faster image acquisition than most scanning based confocal setups.
At first glance, the low penetration depth of TIRF seems to be incompatible with imaging of bacterial and fungal cells, which are often surrounded by thick cell walls. On the contrary, we have found that the cell walls of yeast and bacterial cells actually improve the usability of TIRF and increase the range of observable structures4-8. Many cellular processes can therefore be directly accessed by TIRF in small, single-cell microorganisms, which often offer powerful genetic manipulation techniques. This allows us to perform in vivo biochemistry experiments, where kinetics of protein interactions and activities can be directly assessed in living cells.
We describe here the individual steps required to obtain high quality TIRF images for Saccharomyces cerevisiae or Bacillus subtilis cells. We point out various problems that can affect TIRF visualization of fluorescent probes in cells and illustrate the procedure with several application examples. Finally, we demonstrate how TIRF images can be further improved using established image restoration techniques.

Total Internal Reflection Fluorescence (TIRF) microscopy is a powerful approach to observe structures close to the cell surface at high contrast and temporal resolution. We demonstrate how TIRF can be employed to study protein dynamics at the cortex of cell wall-enclosed bacterial and fungal cells.

미생물에 접속 조직 및 역학 시각화, 총 내부 반사의 형광 현미경을 사용하여

TIRF microscopy has emerged as  a powerful imaging technology to study spatio-temporal dynamics of fluorescent molecules  in vitro and in living cells1. ...

연구

생체공학

Visualizing Protein-DNA Interactions in Live Bacterial Cells Using Photoactivated Single-molecule Tracking

Protein-DNA interactions are at the heart of many fundamental cellular processes. For example, DNA replication, transcription, repair, and chromosome organization are governed by DNA-binding proteins that recognize specific DNA structures or sequences. In vitro experiments have helped to generate detailed models for the function of many types of DNA-binding proteins, yet, the exact mechanisms of these processes and their organization in the complex environment of the living cell remain far less understood. We recently introduced a method for quantifying DNA-repair activities in live Escherichia coli cells using Photoactivated Localization Microscopy (PALM) combined with single-molecule tracking. Our general approach identifies individual DNA-binding events by the change in the mobility of a single protein upon association with the chromosome. The fraction of bound molecules provides a direct quantitative measure for the protein activity and abundance of substrates or binding sites at the single-cell level. Here, we describe the concept of the method and demonstrate sample preparation, data acquisition, and data analysis procedures.

Photoactivated localization microscopy (PALM) combined with single-molecule tracking allows direct observation and quantification of protein-DNA interactions in live Escherichia coli cells.

Photoactivated 단일 분자 추적을 사용하여 라이브 박테리아 세포에있는 단백질-DNA 상호 작용을 시각화

Protein-DNA interactions are at the heart of many fundamental cellular processes. For example, DNA replication, transcription, repair, and chromosome ...

면역학 및 감염병학

Conventional BODIPY Conjugates for Live-Cell Super-Resolution Microscopy and Single-Molecule Tracking

Single molecule localization microscopy (SMLM) techniques overcome the optical diffraction limit of conventional fluorescence microscopy and can resolve intracellular structures and the dynamics of biomolecules with ~20 nm precision. A prerequisite for SMLM are fluorophores that transition from a dark to a fluorescent state in order to avoid spatio-temporal overlap of their point spread functions in each of the thousands of data acquisition frames. BODIPYs are well-established dyes with numerous conjugates used in conventional microscopy. The transient formation of red-shifted BODIPY ground-state dimers (DII) results in bright single molecule emission enabling single molecule localization microscopy (SMLM). Here we present a simple but versatile protocol for SMLM with conventional BODIPY conjugates in living yeast and mammalian cells. This procedure can be used to acquire super-resolution images and to track single BODIPY-DII states to extract spatio-temporal information of BODIPY conjugates. We apply this procedure to resolve lipid droplets (LDs), fatty acids, and lysosomes in living yeast and mammalian cells at the nanoscopic length scale. Furthermore, we demonstrate the multi-color imaging capability with BODIPY dyes when used in conjunction with other fluorescent&#160;probes. Our representative results show the differential spatial distribution and mobility of BODIPY-fatty acids and neutral lipids in yeast under fed and fasted conditions. This optimized protocol for SMLM can be used with hundreds of commercially available BODIPY conjugates and is a useful resource to study biological processes at the nanoscale far beyond the applications of this work.&#160;

Conventional BODIPY conjugates can be used for live-cell single-molecule localization microscopy (SMLM) through exploitation of their transiently forming, red-shifted ground state dimers. We present an optimized SMLM protocol to track and resolve subcellular neutral lipids and fatty acids in living mammalian and yeast cells at the nanoscopic length scale.

라이브 셀 슈퍼 분해능 현미경 및 단일 분자 추적을 위한 기존의 BODIPY 접합체

Single molecule localization microscopy (SMLM) techniques overcome the optical diffraction limit of conventional fluorescence microscopy and can resolve ...

생화학

Single Molecule Fluorescence Microscopy on Planar Supported Bilayers

In the course of a single decade single molecule microscopy has changed from being a secluded domain shared merely by physicists with a strong background in optics and laser physics to a discipline that is now enjoying vivid attention by life-scientists of all venues 1. This is because single molecule imaging has the unique potential to reveal protein behavior in situ in living cells and uncover cellular organization with unprecedented resolution below the diffraction limit of visible light 2. Glass-supported planar lipid bilayers (SLBs) are a powerful tool to bring cells otherwise growing in suspension in close enough proximity to the glass slide so that they can be readily imaged in noise-reduced Total Internal Reflection illumination mode 3,4. They are very useful to study the protein dynamics in plasma membrane-associated events as diverse as cell-cell contact formation, endocytosis, exocytosis and immune recognition. Simple procedures are presented how to generate highly mobile protein-functionalized SLBs in a reproducible manner, how to determine protein mobility within and how to measure protein densities with the use of single molecule detection. It is shown how to construct a cost-efficient single molecule microscopy system with TIRF illumination capabilities and how to operate it in the experiment.

Preparation of protein-functionalized planar glass-supported lipid bilayers, determination of protein mobility within and measurement of protein densities is shown here. A roadmap to building a noise-reduced Total Internal Reflection microscope is outlined, which allows visualizing single bilayer-resident fluorochromes with high spatiotemporal resolution.

평면에 단일 분자 형광 현미경은 이중층 지원

In the course of a single decade single molecule microscopy has changed from being a secluded domain shared merely by physicists with a strong background ...

Automated System for Single Molecule Fluorescence Measurements of Surface-immobilized Biomolecules

Fluorescence Resonance Energy Transfer (FRET) microscopy has been widely used to study the structure and dynamics of molecules of biological interest, such as nucleic acids and proteins. Single molecule FRET (sm-FRET) measurements on immobilized molecules permit long observations of the system -effectively until both dyes photobleach- resulting in time-traces that report on biomolecular dynamics with a broad range of timescales from milliseconds to minutes. To facilitate the acquisition of large number of traces for statistical analyses, the process must be automated and the sample environment should be tightly controlled over the entire measurement time (~12 hours). This is accomplished using an automated scanning confocal microscope that allows the interrogation of thousands of single molecules overnight, and a microfluidic cell that permits the controlled exchange of buffer, with restricted oxygen content and maintains a constant temperature throughout the entire measuring period. Here we show how to assemble the microfluidic device and how to activate its surface for DNA immobilization. Then we explain how to prepare a buffer to maximize the photostability and lifetime of the fluorophores. Finally, we show the steps involved in preparing the setup for the automated acquisition of time-resolved single molecule FRET traces of DNA molecules.

In this article we describe how we obtain FRET traces from individual DNA molecules immobilized to a surface using an automated scanning confocal microscope.

표면 고정화 Biomolecules의 단일 분자 형광 측정을위한 자동화된 시스템

Fluorescence Resonance Energy Transfer (FRET) microscopy has been widely used to study the structure and dynamics of molecules of biological interest, ...

생물학

Bimolecular Fluorescence Complementation

Defining the subcellular distribution of signaling complexes is imperative to understanding the output from that complex. Conventional methods such as immunoprecipitation do not provide information on the spatial localization of complexes. In contrast, BiFC monitors the interaction and subcellular compartmentalization of protein complexes. In this method, a fluororescent protein is split into amino- and carboxy-terminal non-fluorescent fragments which are then fused to two proteins of interest. Interaction of the proteins results in reconstitution of the fluorophore (Figure 1)1,2. A limitation of BiFC is that once the fragmented fluorophore is reconstituted the complex is irreversible3. This limitation is advantageous in detecting transient or weak interactions, but precludes a kinetic analysis of complex dynamics. An additional caveat is that the reconstituted flourophore requires 30min to mature and fluoresce, again precluding the observation of real time interactions4. BiFC is a specific example of the protein fragment complementation assay (PCA) which employs reporter proteins such as green fluorescent protein variants (BiFC), dihydrofolate reductase, b-lactamase, and luciferase to measure protein:protein interactions5,6. Alternative methods to study protein:protein interactions in cells include fluorescence co-localization and F&ouml;rster resonance energy transfer (FRET)7. For co-localization, two proteins are individually tagged either directly with a fluorophore or by indirect immunofluorescence. However, this approach leads to high background of non-interacting proteins making it difficult to interpret co-localization data. In addition, due to the limits of resolution of confocal microscopy, two proteins may appear co-localized without necessarily interacting. With BiFC, fluorescence is only observed when the two proteins of interest interact. FRET is another excellent method for studying protein:protein interactions, but can be technically challenging. FRET experiments require the donor and acceptor to be of similar brightness and stoichiometry in the cell. In addition, one must account for bleed through of the donor into the acceptor channel and vice versa. Unlike FRET, BiFC has little background fluorescence, little post processing of image data, does not require high overexpression, and can detect weak or transient interactions. Bioluminescence resonance energy transfer (BRET) is a method similar to FRET except the donor is an enzyme (e.g. luciferase) that catalyzes a substrate to become bioluminescent thereby exciting an acceptor. BRET lacks the technical problems of bleed through and high background fluorescence but lacks the ability to provide spatial information due to the lack of substrate localization to specific compartments8. Overall, BiFC is an excellent method for visualizing subcellular localization of protein complexes to gain insight into compartmentalized signaling.

The subcellular localization of proteins is important in determining the spatio-temporal regulation of cell signaling. Here, we describe bimolecular fluorescence complementation (BiFC) as a straightforward method for monitoring the spatial interactions of proteins in the cell.

Bimolecular 형광 Complementation

Defining the subcellular distribution of signaling complexes is imperative to understanding the output from that complex. Conventional methods such as ...

Super-resolution Imaging of the Bacterial Division Machinery

Bacterial cell division requires the coordinated assembly of more than ten essential proteins at midcell1,2. Central to this process is the formation of a ring-like suprastructure (Z-ring) by the FtsZ protein at the division plan3,4. The Z-ring consists of multiple single-stranded FtsZ protofilaments, and understanding the arrangement of the protofilaments inside the Z-ring will provide insight into the mechanism of Z-ring assembly and its function as a force generator5,6. This information has remained elusive due to current limitations in conventional fluorescence microscopy and electron microscopy. Conventional fluorescence microscopy is unable to provide a high-resolution image of the Z-ring due to the diffraction limit of light (~200 nm). Electron cryotomographic imaging has detected scattered FtsZ protofilaments in small C. crescentus cells7, but is difficult to apply to larger cells such as E. coli or B. subtilis. Here we describe the application of a super-resolution fluorescence microscopy method, Photoactivated Localization Microscopy (PALM), to quantitatively characterize the structural organization of the E. coli Z-ring8.
	PALM imaging offers both high spatial resolution (~35 nm) and specific labeling to enable unambiguous identification of target proteins. We labeled FtsZ with the photoactivatable fluorescent protein mEos2, which switches from green fluorescence (excitation = 488 nm) to red fluorescence (excitation = 561 nm) upon activation at 405 nm9. During a PALM experiment, single FtsZ-mEos2 molecules are stochastically activated and the corresponding centroid positions of the single molecules are determined with &lt;20 nm precision. A super-resolution image of the Z-ring is then reconstructed by superimposing the centroid positions of all detected FtsZ-mEos2 molecules.
	Using this method, we found that the Z-ring has a fixed width of ~100 nm and is composed of a loose bundle of FtsZ protofilaments that overlap with each other in three dimensions. These data provide a springboard for further investigations of the cell cycle dependent changes of the Z-ring10 and can be applied to other proteins of interest.

We describe a super-resolution imaging method to probe the structural organization of the bacterial FtsZ-ring, an essential apparatus for cell division. This method is based on quantitative analyses of photoactivated localization microscopy (PALM) images and can be applied to other bacterial cytoskeletal proteins.

세균 본부 기계의 슈퍼 해상도 이미징

Bacterial cell division requires the coordinated  assembly of more than ten essential proteins at midcell1,2. Central  to this process is the formation of ...

Simultaneous Multicolor Imaging of Biological Structures with Fluorescence Photoactivation Localization Microscopy

Localization-based super resolution microscopy can be applied to obtain a spatial map (image) of the distribution of individual fluorescently labeled single molecules within a sample with a spatial resolution of tens of nanometers. Using either photoactivatable (PAFP) or&#160;photoswitchable (PSFP) fluorescent proteins fused to proteins of interest, or organic dyes conjugated to antibodies or other molecules of interest, fluorescence photoactivation localization microscopy (FPALM) can simultaneously image multiple species of molecules within single cells. By using the following approach, populations of large numbers (thousands to hundreds of thousands) of individual molecules are imaged in single cells and localized with a precision of ~10-30 nm. Data obtained can be applied to understanding the nanoscale spatial distributions of multiple protein types within a cell. One primary advantage of this technique is the dramatic increase in spatial resolution: while diffraction limits resolution to ~200-250 nm in conventional light microscopy, FPALM can image length scales more than an order of magnitude smaller. As many biological hypotheses concern the spatial relationships among different biomolecules, the improved resolution of FPALM can provide insight into questions of cellular organization which have previously been inaccessible to conventional fluorescence microscopy. In addition to detailing the methods for sample preparation and data acquisition, we here describe the optical setup for FPALM. One additional consideration for researchers wishing to do super-resolution microscopy is cost: in-house setups are significantly cheaper than most commercially available imaging machines. Limitations of this technique include the need for optimizing the labeling of molecules of interest within cell samples, and the need for post-processing software to visualize results. We here describe the use of PAFP and PSFP expression to image two protein species in fixed cells. Extension of the technique to living cells is also described.

We demonstrate the use of fluorescence photo activation localization microscopy (FPALM) to simultaneously image multiple types of fluorescently labeled molecules&#160;within cells. The techniques described yield the localization of thousands to hundreds of thousands of individual fluorescent labeled proteins, with a precision of tens of nanometers&#160;within single cells.

Localization-based super resolution microscopy can be applied to obtain a spatial map (image) of the distribution of individual fluorescently labeled ...

Multi-color Localization Microscopy of Single Membrane Proteins in Organelles of Live Mammalian Cells

Knowledge about the localization of proteins in cellular subcompartments is crucial to understand their specific function. Here, we present a super-resolution technique that allows for the determination of the microcompartments that are accessible for proteins by generating localization and tracking maps of these proteins. Moreover, by multi-color localization microscopy, the localization and tracking profiles of proteins in different subcompartments are obtained simultaneously. The technique is specific for live cells and is based on the repetitive imaging of single mobile membrane proteins. Proteins of interest are genetically fused with specific, so-called self-labeling tags. These tags are enzymes that react with a substrate in a covalent manner. Conjugated to these substrates are fluorescent dyes. Reaction of the enzyme-tagged proteins with the fluorescence labeled substrates results in labeled proteins. Here, Tetramethylrhodamine (TMR) and Silicon Rhodamine (SiR) are used as fluorescent dyes attached to the substrates of the enzymes. By using substrate concentrations in the pM to nM range, sub-stoichiometric labeling is achieved that results in distinct signals. These signals are localized with ~15&#8211;27 nm precision. The technique allows for multi-color imaging of single molecules, whereby the number of colors is limited by the available membrane-permeable dyes and the repertoire of self-labeling enzymes. We show the feasibility of the technique by determining the localization of the quality control enzyme (Pten)-induced kinase 1 (PINK1) in different mitochondrial compartments during its processing in relation to other membrane proteins. The test for true physical interactions between differently labeled single proteins by single molecule FRET or co-tracking is restricted, though, because the low labeling degrees decrease the probability for having two adjacent proteins labeled at the same time. While the technique is strong for imaging proteins in membrane compartments, in most cases it is not appropriate to determine the localization of highly mobile soluble proteins.

Here, we present a protocol for multi-color localization of single membrane proteins in organelles of live cells. To attach fluorophores, self-labeling proteins are used. Proteins, located in different membranes compartments of the same organelle, can be localized with a precision of ~18 nm.

살아있는 포유류 세포의 세포에서 단일 막 단백질의 다 색 지역화 현미경

Knowledge about the localization of proteins in cellular subcompartments is crucial to understand their specific function. Here, we present a ...

Bimolecular Fluorescence Complementation-Coupled Photoactivated Localization Microscopy

To prepare a sample for imaging, plate about 5.5 x 104 stable expression cells per well of an 8-well glass-bottomed chamber slide, in 350 microliters of phenol red-free DMEM. Use fresh paraformaldehyde with glutaraldehyde to fix the cells, and after replacing the fixative with PBS or imaging buffer, vortex 100-nanometer gold particles, and add 35 microliters per well for tracking stage drift during imaging.
Approach the microscope and power on the 405 and 561-nanometer lasers. Keeping the shutters closed at this point, ensure the 561-nanometer dichroic mirror and notch filter are in place. Open the image acquisition software.
Turn on the EMCCD camera and allow it to cool down, and set the exposure time to 100 milliseconds and the EMCCD gain to an appropriate value. Add immersion oil to the objective, and secure the sample on the microscope stage. Next, with either brightfield or the 561-nanometer laser, bring the sample into focus.
For imaging Ras and other membrane proteins, use a 60X apochromat TIRF objective with a 1.49 numerical aperture, and bring the microscope into TIRF configuration.
Adjust the excitation laser so that it is off-centered when hitting the back aperture of the TIRF objective, which will cause the laser to deflect upon reaching the coverslip buffer interface. Keep adjusting the laser incident position until the critical angle is reached and the laser is being reflected back.
Search for a cell to image with several gold particles in view. Then, set a region of interest that encloses the cell or a region of it and the gold particles.
In case sufficient activation is already occurring because of high expression levels, begin acquisition with the 405-nanometer laser off and the 561-laser on. Otherwise, turn on the 405-nanometer laser at the lowest factory power setting, and increase it gradually until there are tens of molecules per frame or so that single molecules are well-separated.
As data acquisition continues, gradually increase the 405-nanometer laser power to keep the spot density roughly constant. Continue image acquisition until high 405 power does not initiate any more activation events.