Name: generation of induced pluripotent stem cells from muscular dystrophy patients: efficient integration-free reprogramming of urine derived cells
Uploaded: 2015-01-28T13:00:00.000+00:00
Duration: 9 min 11 s
Description: Watch this Scientific Journal Video about Generation of Induced Pluripotent Stem Cells from Muscular Dystrophy Patients: Efficient Integration-free Reprogramming of Urine Derived Cells at JoVE.com

Development of this protocol was supported by the Advancing a Healthier Wisconsin and the National Center for Advancing Translational Sciences, National Institutes of Health, through Grant Number 8UL1TR000055. Its contents are solely the responsibility of the authors and do not necessarily represent the official views of the NIH.

참고 : 환자 및 / 또는 보호자는 연구를 승인 심사위원회 (Institutional Review Board)에 참여하는 동의를 제공해야합니다. 1. 버퍼 및 미디어 준비 <ol><li> 세척 버퍼 : 세척 버퍼 100 ㎖를 준비 인산염 완충 식염수 (PBS)의 99 ml의 100 배 펜 / 연쇄상 구균 솔루션 (스트렙토 마이신의 100 U / ml의 페니실린이 + 100 μg의 / ㎖) 1 ㎖를 추가합니다. </li><li> 소변 전구 세포 (UPC) 중간 : UPC 미디어를 준비 케 라티노 세럼 무료 (KSF) 중간 + 전구 세포 매체의 동일한 볼륨을 혼합합니다. <ol><li> KSF 중간 : 표피 성장 인자의 5 ng를 / ㎖ (EGF), 소 뇌하수체 추출물의 50 ng를 / ㎖ (BPE), 콜레라 독소의 30 ng를 / ㎖, 펜 / 연쇄상 구균 용액 (100 U를 추가, 각질 세포 미디어를 준비 / ml의 페니실린 500 ml의 KSF 매체, 100 ㎍ / ml의 스트렙토 마이신). </li><li> 전구 세포 매체 : FBS, 0.4 ㎍ / ㎖의 하이드로 코티손, 0.1 햄 F12 미디어의 1/4과 DMEM의 4 분의 3에 추가하고 10 % 보완nM의 콜레라 독소, 5 NG / ml의 인슐린, 1.8 × 10 -4 M 아데닌, / ㎖ 트랜스페린, 2 × 10 -9 M의 triiodo의 로닌, 10 NG / ml의 EGF, 펜 / 패 혈성 솔루션 5 μg의. </li></ol></li><li> 배아 줄기 중간 : 20 % KO-세럼 교체 (K-SR), 1X MEM 비 필수 아미노산, 2 mM L- 글루타민, 100 μM의 β 머 캅토 에탄올, 20 NG / ㎖의 bFGF 및 펜 / 패 혈성 추가 400 ㎖의 DMEM / F12 배지. </li></ol> 2. 소변 샘플 컬렉션 <ol><li> 소변 적절한 양의 (~ 30 ~ 40 ml)을 수집 할 수 있도록 소변 컬렉션에 30 분 전에 음료수를 마시지하는 환자를 지시합니다. </li><li> 환자 및 / 또는 보호자 다음 항목이 포함 된 소변 수집 키트를 제공한다 : (1) 멸균 또는 클린 캐치 소변 샘플을 구하는 방법에 대한 작성 지침, (2) 습기 항균 toilettes, (3) 100 ml의 멸균 표본 수집 컵. 샘플을 수집하는 환자를 지시합니다. </li><li> 즉시 얼음에 소변 샘플을 배치하고 LABORA로 전송쿨러 토리. 즉시 세포 분리를위한 소변을 처리합니다. 지연이 불가피한 경우, 세포 생존 능력의 손실을 최소화하면서 최대 4 시간 동안 얼음에 표본을 저장합니다. </li></ol> 3. 분리 및 소변 세포의 확장 참고 : BSL2 생물 안전 캐비닛에서 무균 상태에서 다음 단계를 수행하십시오. <ol><li> 멸균 피펫을 사용하여, 전송 소변 샘플은 50 ml의 원심 분리 튜브 멸균한다. RT에서 10 분 동안 400 × g에서 원심 분리한다. </li><li> 튜브에 1 ㎖를 떠나 뜨는을 기음; 세포 펠렛을 방해하지 않도록주의하십시오. </li><li> 재현 탁은 세척 완충액 7 ㎖ 중에 다중 튜브의 펠렛을 결합하고 RT에서 10 분 동안 400 × g에서 원심 분리를 반복하고. </li><li> 조심스럽게 세포 펠렛 및 상등액 ~ 0.2 ~ 0.5 ml를 떠나, 뜨는을 대기음. 소변 전구 세포 (UPC) 매체의 2-3 용액에 재현 탁과 유엔의 4-6 우물에 정지를 전송코팅 된 24 웰 플레이트. </li><li> 72 시간 후, 잘 당 신선한 UPC 매체의 0.5 ml의 문화를 보완하고 2 ~ 3 일 후에 매체 변경합니다. 판에 부착하지 않는 적혈구 및 편평 상피 세포 매체 변화에 제거됩니다. </li><li> 4-6일 후 문화를 모니터링합니다. 참고 : 작은 2-4 세포 식민지가 나타 시작합니다. 세포는 둥근 또는 유형 I 또는 신장 상피 (RE) 세포를 각각 3 종류 II를 대표하는 연장됩니다. </li><li> 세포가 표시되면, 그들은 빠른 확장 단계를 거쳐야하기 때문에 2-3 일마다 매체를 변경합니다. </li><li> 세포가 80-90 %, 도금 후 약 9-15일에 도달하면, 추가 확장 24 웰 플레이트의 2-4 우물에 세포 (15,000-18,000 세포 / cm 2) 해리와 통로. 세포 통로 1 (P1)로이를 표시합니다. </li><li> 유세포 분석을 통해 혈통 사양 소변 세포를 특성화, immunohistochem적인 염색 또는 역전사 효소 - 중합 효소 연쇄 반응을 통한 (RT-PCR). </li><li> 장기 cryostorage에 대한 (DMEM 10 % 혈청과 10 % DMSO로 보충) 절연 소변 세포 (섹션 4)를 다시 프로그램 또는 중간 동결에 그들을 동결. </li></ol> 센다이 바이러스를 사용하여 4. 소변 세포 재 프로그래밍 참고 : 트랜 에이전트를 조작하는 동안 적절한 취급과 PPE (개인 보호 장비)를 사용하는 것이 좋습니다. BSL2 생물 안전 캐비닛에서 무균 상태에서 다음 단계를 수행하십시오. 에이전트 및 / 또는 형질 감염된 세포를 형질의 적절한 폐기는 환경과 건강 위험의 위험을 방지하는 것이 좋습니다. 아래에 설명 된대로 소변 세포 재 프로그래밍은 제조업체의 공급에 의존하는 프로토콜의 수정 센다이 리 프로그래밍 키트를 사용합니다. <ol><li> 센다이 바이러스를 사용하여 고효율의 리 프로그래밍을 보장하기 위해 사용되어 신속한 뇨 세포 1-5 통로해동 분할. 세포가 잘 복제하거나 노화가되지 않는 경우가 효율적으로 재 프로그래밍되지 않으므로 취소하십시오. </li><li> 시드 6 웰 플레이트의 두 우물에 잘 60,000 세포. 마크 일 -2이. 셀 시드 농도를 조정 (5 × 10월 4일에서 9일까지 × 10 4 세포 아니라 당) 일 0으로 80-90 %에 도달하기 위해 필요에 따라. </li><li> 0 일째 (셀 도금 후 48 시간)에서, 네 OSKM 요소 각각을 함유 센다이 리 프로그래밍 벡터 (SEV)을 제조. 미리 예열 UPC 매체의 1 ml의 벡터의 각을 추가합니다. 프로그램을 다시 소변 세포에 충분한 1.5의 MOI (5-7.5 × 10 5 CIU)를 사용합니다. 매체를 대기음 천천히 소변 세포의 잘 하나에 1 ml의 UPC + SEV를 추가합니다. 전달 음성 대조군으로 두 번째 잘 사용합니다. </li><li> 1 일에, 신선한 UPC 매체와 UPC + SEV 매체를 교체합니다. 일부 세포의 죽음으로 인해 바이러스의 세포 독성에 24 시간 후에 볼 수 있습니다. </li><li> 재 프로그램 클론의 효율성에 따라전자 형성하고 컴팩트 한 형태는 하루 6 또는 7까지 매일 매체를 계속 변경. </li><li> 이전에 형질 세포 (5 일 또는 6), 미토 마이신 C (3 시간 10 ㎍ / ㎖)을 0.1에 5 × 104 세포 / cm 2의 밀도에서 처리-MEFs에 도금하여 MEF 피더 플레이트를 준비 해리에 어느 날 % 젤라틴은 100mm 2 배양 접시를 코팅. </li><li> 다음 날 (6 또는 7 일), 0.25 % 트립신으로 세포를 해리 UPC 매체 플레이트 5 × 104 세포에 재현 탁 - 2 × 105 세포 / 100mm이 MEF 피더 플레이트. </li><li> 다음 날, 배아 줄기 매체로 전환 한 매체 매일을 변경합니다. 형질 전환 된 세포를 모니터링 현미경으로 세포를 관찰한다. 참고 : 세포 특성 조약돌 형태와 세포질 비율이 더 높은 핵을 가진 (12-18일 게시물 전달)와 클론 집계를 형성한다. </li><li> 2~3주 내에서 전달 후, 식민지를 선택하고 클론에 대한 새로운 접시로 전송알 확장. </li><li> 37 ℃에서 1 시간 동안 TRA-1-81 항체로 세포를 배양하여 IPSC 클론을 선택하기위한 생균 염색을 수행 ° C에서 CO는 CO 2 인큐베이터에서 37 ° C에서 1 시간 동안 특정 형광 염료와 접합 된 이차 항체 염색에 의해 대향 인큐베이터 하였다. </li><li> 에 26 G 1.5 인치 바늘을 사용하여 작은 동일한 크기의 조각으로 큰 TRA-1-81 긍정적 인 IPSC 클론 (복제 당 4-6 개) 크로스 - 부화. </li><li> 선택 및 전송 매트 리겔의 각 웰 (10 ㎍ / cm 2)으로 여러 클론에서 10 ~ 20 크로스 해치 조각 배아 줄기 매체 24 웰 플레이트를 코팅 처리하는 멸균 피펫 팁을 사용합니다. 참고 : 하나의 우물에 개별적으로 도금 단일 클론에서 조각 확장 또는 능성을 유지하지 않습니다. </li><li> 재 프로그래밍 클론 마트 리젤의 표면에 부착 한 후 IPSC 매체에 배아 줄기에서 24 ~ 48 시간을 변경합니다. </li><li> 마트 리겔 코팅 플레이트, 수동 scra 유지 보수시PE-오프 완전히 재 프로그래밍과 만능 이영 IPSC (MD-IPSC) 클론 풍부하게 피펫 팁을 사용하는 차별화 된 세포 또는 오염 MEF 피더 세포를. </li><li> 개별 클론 ~ 100 ㎛의 크기에 도달 한 후, 3 분 동안 0.48 mM의 EDTA (에틸렌 디아민 테트라 아세트산) 용액으로 해리 및 IPSC 배지에 현탁 MD-iPSCs 작은 세포 집합체를 도금함으로써 클론 확장 (5 μM Y27632, RHO 키나제 보충 억제제 ) 신선한 마트 리겔 (10 ㎍ / cm 2) 12 웰 플레이트를 코팅. 매일 IPSC 매체를 변경합니다. </li><li> 각 클론의 완전한 리 프로그래밍은 OSKM 유전자 및 다 능성 마커 (OCT3 / 4, TRA-1-81)의 면역 조직 화학 염색을 모두 유전자 발현 분석에 의해 결정될 수있다. 만능 전위의 엄격한 평가가 완전히 재 프로그램 IPSC 라인 세 배엽으로 분화 할 수 확인하기 위해 채용되어야한다. 이 배아 체 (EB) 형성과 분화 분석 또는 운에 의해 중 수행 할 수 있습니다atoma 형성 분석법. </li></ol>

<ol>
	<li>Guan, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dystrophin-deficient+cardiomyocytes+derived+from+human+urine:+New+biologic+reagents+for+drug+discovery.">Dystrophin-deficient cardiomyocytes derived from human urine: New biologic reagents for drug discovery.</a> Stem Cell Research. 12 (2), 467-480 (2014).</li><li>Dick, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Exon+Skipping+and+Gene+Transfer+Restore+Dystrophin+Expression+in+Human+Induced+Pluripotent+Stem+Cells-Cardiomyocytes+Harboring+DMD+Mutations.">Exon Skipping and Gene Transfer Restore Dystrophin Expression in Human Induced Pluripotent Stem Cells-Cardiomyocytes Harboring DMD Mutations.</a> Stem Cells Dev. 22 (20), 2714-2724 (2013).</li><li>Zhou, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Generation+of+human+induced+pluripotent+stem+cells+from+urine+samples.">Generation of human induced pluripotent stem cells from urine samples.</a> Nat Protoc. 7 (12), 2080-2089 (2012).</li><li>Bellin, M., Marchetto, M. C., Gage, F. H., Mummery, C. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Induced+pluripotent+stem+cells:+the+new+patient.">Induced pluripotent stem cells: the new patient.</a> Nat Rev Mol Cell Biol. 13 (11), 713-726 (2012).</li><li>Carvajal-Vergara, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Patient-specific+induced+pluripotent+stem-cell-derived+models+of+LEOPARD+syndrome.">Patient-specific induced pluripotent stem-cell-derived models of LEOPARD syndrome.</a> Nature. 465 (7299), 808-812 (2010).</li><li>Sun, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Patient-Specific+Induced+Pluripotent+Stem+Cells+as+a+Model+for+Familial+Dilated+Cardiomyopathy.">Patient-Specific Induced Pluripotent Stem Cells as a Model for Familial Dilated Cardiomyopathy.</a> Science Translational Medicine. 4 (130), 130ra147 (2012).</li><li>Zhang, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Urine+derived+cells+are+a+potential+source+for+urological+tissue+reconstruction.">Urine derived cells are a potential source for urological tissue reconstruction.</a> J Urol. 180 (5), 2226-2233 (2008).</li><li>Bayart, E., Cohen-Haguenauer, O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Technological+overview+of+iPS+induction+from+human+adult+somatic+cells.">Technological overview of iPS induction from human adult somatic cells.</a> Curr Gene Ther. 13 (2), 73-92 (2013).</li><li>Malik, N., Rao, M. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+review+of+the+methods+for+human+iPSC+derivation.">A review of the methods for human iPSC derivation.</a> Methods Mol Biol. 997, 23-33 (2013).</li><li>Nakanishi, M., Otsu, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+of+Sendai+virus+vectors+and+their+potential+applications+in+gene+therapy+and+regenerative+medicine.">Development of Sendai virus vectors and their potential applications in gene therapy and regenerative medicine.</a> Curr. Gene Ther. 12 (5), 410-416 (2012).</li><li>Gonz&#225;lez-Ram&#237;rez, R., Morales-L&#225;zaro, S. L., Tapia-Ram&#237;rez, V., Mornet, D., Cisneros, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nuclear+and+nuclear+envelope+localization+of+dystrophin+Dp71+and+dystrophin-associated+proteins+(DAPs)+in+the+C2C12+muscle+cells:+DAPs+nuclear+localization+is+modulated+during+myogenesis.">Nuclear and nuclear envelope localization of dystrophin Dp71 and dystrophin-associated proteins (DAPs) in the C2C12 muscle cells: DAPs nuclear localization is modulated during myogenesis.</a> J Cell Biochem. 105 (3), 735-745 (2008).</li><li>Villarreal-Silva, M., Centeno-Cruz, F., Su&#225;rez-S&#225;nchez, R., Garrido, E., Cisneros, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Knockdown+of+dystrophin+Dp71+impairs+PC12+cells+cycle:+localization+in+the+spindle+and+cytokinesis+structures+implies+a+role+for+Dp71+in+cell+division.">Knockdown of dystrophin Dp71 impairs PC12 cells cycle: localization in the spindle and cytokinesis structures implies a role for Dp71 in cell division.</a> PloS One. 6 (8), e23504 (2011).</li></ol>

The authors declare that they have no competing financial interests.

iPSCs를 사용하여 심혈관 질환을 모델링하는 것은 유전 적 기여 4-6를 이해하는 일반적인 방법이되고있다. 환자 세포로부터 샘플을 얻는 몇몇 예상치 못한 문제, 특히 어린 아이들, 이러한 소변 수집 같이 비 침습적 접근하는 옵션을 제공함으로써 회피 할 수있다. 이 젊은 환자 집단에서, 재 프로그래밍을위한 충분한 세포 소변을 수득하기에 충분한 양의 소변을 수집하는 것이 곤란하다. 유체에게 소변 수집하기 전에 30 분을 마시는 젊은 환자 코칭 소변 세포 분리의 성공을 향상시킨다. 그러나, 반복 소변 컬렉션이 인구에 필요할 수 있습니다. 우리는 합하고 근이영양증 환자에서 UCS의 분리 및 배양을 최적화하기 위해 두 개의 서로 다른 프로토콜을 3,7-을 적응. 유도 된 다 능성 줄기 세포는 근육 이영양증의 patien로부터 피부 섬유 아세포 또는 소변 중 세포에서 생성 된TS 1,2. 그러나 두 리 프로그래밍 프로토콜은 체세포로 리 프로그래밍 요소를 소개하는 렌티 바이러스에 의존. 트랜스 임의로 숙주 게놈에 통합 (평가 8) 또는 트랜스 활성화 돌연변이를 일으키는 경우 통합 바이러스 배송 방법은 문제가 될 수있다. 따라서 비 통합 방식 9 소변 세포로 OSKM 형질 전환 유전자를 형질 도입하는 센다이 바이러스를 사용하여 이러한 방법으로 향상. UCS 재 프로그램 센다이 바이러스를 사용하는이 방법은 더 높은 전달 효율 9,10와 비 통합 방식의 장점을 제공한다. 근이영양증 환자에서 수집 한 소변 세포는 2-3주 후 전달 내에서 재 프로그래밍된다. 이러한 재 프로그래밍 반응 속도는 렌티 바이러스 전달 1을 사용 UC 재 프로그래밍에 필적한다. 이 프로토콜은 소변 세포 재 프로그래밍에 대한 공급이없는 방법을 설정하기 위해 확장 할 수 있지만, 수근이영양증 환자에서 분리 한 세포의 뇨 센다이 바이러스를 이용한 형질 도입 효율적인 방법을 보내고. 설명 된이 방법은 완전히 통로 (2)에 피더가없는 조건을 양도하기 전에 능성 MD 클론을 확립하기 위해 피더 층으로서 MEFs에 의존. 디스트로핀 단백질 Dp71 이성체의 분포는 핵의 맹아 긴 다른 셀 모델 (11, 12)에 설립되었다. 초기 전구 / 배아 단계의 세포의 핵 매트릭스 분율 Dp71이 유비쿼터스 표현은 핵 아키텍처와 세포주기 조절 (12)에서 자신의 역할을 제안합니다. 우리의 재 프로그래밍 야생형 iPSCs는 Dp71을 표현; 그러나, 이영 iPSCs의 부재는 곧 재 프로그래밍 또는 이영 세포의 만능 가능성을 억제하지 않습니다. 결론적으로, 이영 유전자 돌연변이 재 프로그램 iP​​SCs에 보존된다; 그것을 효율적인 도구를 만드는 것은 이영 심근 병증을 모델링합니다.

심근증은 뒤 시엔 느와 베커 근이영양증 (MD) 환자에서 두 번째로 높은 사망 원인이다. X-연결 디스트로핀 유전자의 돌연변이가 하나 발생하더라도 3,500 남성 출산, 약간은 진보적 인 심장 근육 손상을 유도하는 분자 및 세포 이벤트에 대한 알려져있다. 근이영양증 환자 유래의 인간 유도 다 능성 줄기 세포는 기저 질환 메커니즘을 연구 약물 1,2- 스크리닝에 사용하는 신규 한 도구로 나왔다. 피부 조직 검사 또는 혈액 샘플의 예상되는 불편 함은 연구 참여에 대한 동의를하는 젊은 환자 및 / 또는 보호자를 설득 할 수 있습니다. 소변 샘플은 리 프로그래밍을 수정할 수있는 방법이다 체세포 비 침습적 원천이다. 우리는 최근 근이영양증 환자로부터 수집 된 소변 세포를 배양 할 수 있다는 것을 도시하고 효율적 야마나카 인자를 사용하여 레트로 바이러스 형질 도입 iPSCs (내로 재 프로그램 한OCT3 / 4, SOX2, Klf4 및 c-Myc와; OSKM) 1. 레트로 바이러스 유전자 전달의 단점은 숙주 염색체로 유전자의 재 프로그래밍 랜덤 통합이다. 이러한 한계를 극복하기 위해, 우리는 소변 세포 리 프로그래밍에 대한 비 통합 센다이 바이러스를 사용 하였다. 이 프로토콜은 추가 연구를위한 심근 세포 또는 다른 종류의 세포로 분화 할 수 근이영양증 환자의 격리 소변 세포의 센다이 바이러스의 재 프로그래밍에 대해 자세히 설명합니다. 이 프로토콜은 또한 특정 환자 다른 질환을 위해 더 적응 될 수있다.

<table><tbody><tr><td colspan="4">&lt;strong&gt;Materials&lt;/strong&gt;</td></tr><tr><td>4 Oz. Specimen Cup with Lid</td><td>STL Medical Supply</td><td>M9AMSAS340</td><td>For Urine Sample Collection</td></tr><tr><td>15 ml BD-Falcon Tubes</td><td>Fisher Scientific</td><td>352097</td><td></td></tr><tr><td>50 ml BD-Falcon Tubes</td><td>Fisher Scientific</td><td>352098</td><td></td></tr><tr><td>Round Glass Coverslips</td><td>Fisher Scientific</td><td>12-545-81</td><td></td></tr><tr><td>CytoTune-iPS Sendai Reprogramming Kit</td><td>Life Technologies</td><td>A1378-001</td><td></td></tr><tr><td>PBS, pH 7.4</td><td>Life Technologies</td><td>10010-023</td><td></td></tr><tr><td>Pen-Strep w/o Glutamine&amp;nbsp;</td><td>Life Technologies</td><td>15140-122</td><td>Warm in 37 &amp;deg;C water bath before use</td></tr><tr><td>RPMI Medium 1640</td><td>Life Technologies</td><td>11875-093</td><td>Warm in 37 &amp;deg;C water bath before use</td></tr><tr><td>B-27 Supplement w/Insulin (50x)</td><td>Life Technologies</td><td>17504-044</td><td>Warm in 37 &amp;deg;C water bath before use</td></tr><tr><td>B-27 Supplement w/o Insulin (50x)</td><td>Life Technologies</td><td>0050129SA</td><td>Warm in 37 &amp;deg;C water bath before use</td></tr><tr><td>DMEM/F12 (1:1)</td><td>Life Technologies</td><td>11330-032</td><td>Warm in 37 &amp;deg;C water bath before use</td></tr><tr><td>Versene, 1:5,000</td><td>Life Technologies</td><td>15040066</td><td>Warm in 37 &amp;deg;C water bath before use</td></tr><tr><td>bFGF (10 &amp;micro;g)</td><td>Life Technologies</td><td>13256-029</td><td>Warm in 37 &amp;deg;C water bath before use</td></tr><tr><td>Cell Counter Cartridges</td><td>Life Technologies</td><td>C10228</td><td></td></tr><tr><td>Knockout Serum (500&amp;nbsp;ml Bottle)</td><td>Life Technologies</td><td>10828-028</td><td>Warm in 37 &amp;deg;C water bath before use</td></tr><tr><td>Recovery Cell Culture Freezing Medium</td><td>Life Technologies</td><td>12648-010</td><td></td></tr><tr><td>Keratinocyte-SFM (1x), Liquid</td><td>Life Technologies</td><td>17005-042</td><td>Warm in 37 &amp;deg;C water bath before use</td></tr><tr><td>DMEM, High Glucose, Glutamax</td><td>Life Technologies</td><td>10566-016</td><td>Warm in 37 &amp;deg;C water bath before use</td></tr><tr><td>Ham&#039;s F-12 Nutrient Mix&amp;nbsp;</td><td>Life Technologies</td><td>11765-054</td><td>Warm in 37 &amp;deg;C water bath before use</td></tr><tr><td>EGF Recombinant Human Protein, Liquid Form</td><td>Life Technologies</td><td>PHG0311L</td><td>Warm in 37 &amp;deg;C water bath before use</td></tr><tr><td>Insulin, Human Recombinant, Zinc Soln</td><td>Life Technologies</td><td>12585-014</td><td>Warm in 37 &amp;deg;C water bath before use</td></tr><tr><td>TeSR-E8</td><td>Stem Cell Technologies</td><td>5940</td><td>Warm in 37 &amp;deg;C water bath before use</td></tr><tr><td>ROCK Inhibitor (Y-27632)</td><td>Selleck</td><td>S1049</td><td>Warm in 37 &amp;deg;C water bath before use</td></tr><tr><td>Matrigel</td><td>BD Biosciences</td><td>354277</td><td>hESC Qualified Matrix, LVED Free</td></tr><tr><td>RNeasy Mini Kit&amp;nbsp;</td><td>Qiagen</td><td>74104</td><td></td></tr><tr><td>iScript cDNA Synthesis Kit</td><td>Bio-Rad</td><td>170-8890</td><td></td></tr><tr><td>DreamTaq Green PCR Master Mix (2x)</td><td>Thermo-Scientific</td><td>K1081</td><td></td></tr><tr><td>FBS-Qualified</td><td>Sigma Aldrich</td><td>F6178</td><td>Warm in 37 &amp;deg;C water bath before use</td></tr><tr><td>Adenine Bioreagent</td><td>Sigma Aldrich</td><td>A2786-5G</td><td>Warm in 37 &amp;deg;C water bath before use</td></tr><tr><td>Cholera Toxin from &lt;em&gt;Vibrio cholerae&lt;/em&gt;</td><td>Sigma Aldrich</td><td>C8052-.5MG</td><td>Warm in 37 &amp;deg;C water bath before use</td></tr><tr><td>Hydrocortisone</td><td>Sigma Aldrich</td><td>H0888-1G</td><td>Warm in 37 &amp;deg;C water bath before use</td></tr><tr><td>Holo-transferrin from human</td><td>Sigma Aldrich</td><td>T0665-50MG</td><td>Warm in 37 &amp;deg;C water bath before use</td></tr><tr><td>3,3&#039;,5-Triiodo-L-thyronine sodium salt</td><td>Sigma Aldrich</td><td>T6397-100MG</td><td>Warm in 37 &amp;deg;C water bath before use</td></tr><tr><td>DAPI&amp;nbsp;</td><td>Santa Cruz Biotechnology</td><td>SC-3598</td><td></td></tr><tr><td>Fluoromount Aquous mounting medium</td><td>Sigma Aldrich</td><td>F4680</td><td></td></tr><tr><td>16% Paraformaldehyde</td><td>Alfa-Aesar</td><td>43368</td><td></td></tr><tr><td colspan="4">&lt;strong&gt;Antibodies&lt;/strong&gt;</td></tr><tr><td>Mouse anti CD44 - labeled with FITC&amp;nbsp;</td><td>BD Biosciences</td><td>560977</td><td></td></tr><tr><td>Mouse anti CD146 - labeled with PE</td><td>BD Biosciences</td><td>561013</td><td></td></tr><tr><td>Mouse anti CD73 - labeled with PE</td><td>BD Biosciences</td><td>561014</td><td></td></tr><tr><td>Mouse anti-&amp;alpha;-smooth muscle actin</td><td>Sigma Aldrich</td><td>A2547</td><td></td></tr><tr><td>Mouse anti-Vimentin</td><td>Abcam</td><td>ab8978-100</td><td></td></tr><tr><td>Mouse Anti - TRA-1-81</td><td>Life Technologies</td><td>411100</td><td></td></tr><tr><td>Rabbit anti Oct 3/4</td><td>Santa Cruz Biotechnology</td><td>SC-9081</td><td></td></tr><tr><td>Mouse Anti Dystrophin</td><td>Leica Biosystems</td><td>NCL-DYSB</td><td></td></tr></tbody></table>

generation of induced pluripotent stem cells from muscular dystrophy patients: efficient integration-free reprogramming of urine derived cells

이영 심근 병증은 근육 이영양증 제대로 이해 결과이다. 근이영양증 환자에서 유도 다 능성 줄기 세포 (iPSCs)를 생성하면 체외 질병 모델 시스템을위한 귀중한 셀룰러 소스 및 약물 검사 연구에 사용할 수 있습니다. 환자 뇨 - 유래 세포는 1 이영양증 심근증을 모델링하기 위해 유도 된 다 능성 줄기 세포로의 성공적인 리 프로그래밍에 사용되어왔다. 벡터 시스템을 통합의 안전성 문제를 해결하는, 우리는 야마나카의 전달은 근이영양증 환자로부터 수집 된 소변 세포에 인자 비 통합 센다이 바이러스 벡터를 이용하여 프로토콜을 제시한다. 이 프로토콜은 완전히 2-3주 내에서 클론을 재 프로그램 생성합니다. 만능 세포 통로 (13)에 의해 벡터 무료입니다. 이 이영 iPSCs는 심근 세포로 분화 및 질병 메커니즘 또는 약물 검사에 대한 공부를 사용할 수있다.

(각각 97.37 %, 97.09 %, 97.3 %; 그림 1A 및 1B) 인간의 소변에서 분리 된 대부분의 전구 세포는 CD44, CD73, 및 CD146 등 uroepithelial 전구 및 혈관 주위 세포 마커에 대한 긍정적이다. 이 세포는 또한 알파 - 평활근 액틴과 멘틴 (그림 1B)와 같은 다른 중간 엽 마커를 표명했다. RT-PCR 분석 아세포-7의 약한 표현이 점에서 문화 세포의 혼합 인구의 증거를 제공합니다 (CK-7) 및 Uroplakin (UP) -ia 및 -IIIa, uroepithelial 혈통의 마커 (그림 1C). 재 프로그래밍 단계는도 2a에 개략적으로 나타내었다. 대표적인 이미지는 프로토콜 (도 2B)에 걸쳐 상이한 시점 동안 세포의 형태를 보여준다. 소변 세포는 연장에서, 유형 II 셀 조약돌 패턴에 (0 일) (4 일) 재 프로그래밍하는 동안 변환. BY의 날 (12), 전형적인 만능 클론 (IPSC)는 볼 피더 무료 조건에서 만능 형태 (IPSC-P2)를 유지할 수있다. TRA-1-81에 대한 라이브 세포 얼룩은 재 프로그램 클론 (그림 2C)를 식별합니다. 벡터 및 자유 능성 트랜스 클론의 생성을 확인하기 위하여, RT-PCR은 바이러스 게놈에 대해 SEV 프라이머 및 외인성 인자 OSKM 각각을 사용하여 수행된다. 리 프로그래밍 내인성 인자들의 상향 조절은 또한이 단계에서 확인 될 수있다. 외인성 유전자의 발현은 더 이상 통로 (13)에 의해 검출되지 않고, 내인성 인자의 상향 조절 (up-regulation)는 (도 3a)을 볼 수있다. 면역 형광 염색에 iPSCs 능성 마커 발현을 확인 (OCT3 / 4, TRA-1-81을도 3B 참조). 소변에서 세포 리 프로그래밍 보이는 내인성 유전자의 발현은 다른 체세포 소스에 비해 높은 효율로 한 재 프로그래밍이 셀들을 초래할 수있다. EXPRES디스트로핀 유전자 및 단백질의 시온은 면역 형광 염색으로 확인, 웨스턴 블롯 (WB)과 RT-PCR (그림 3C-E) 분석합니다. 디스트로핀에 대한 야생형 UCS와 iPSCs의 면역 염색 iPSCs에서 분명 핵 지역화 (11)을 보여,하지만 거의 UCS는 긍정적 (그림 3C)를 표명했다. 세포에서 디스트로핀의 발현을 확인하려면, 디스트로핀에 대한 면역 분석은 이영 iPSCs는 디스트로핀 유전자 발현이 부족한 상태에서 유비쿼터스 디스트로핀 이소 형 (Dp71)이 검출되지 Dp71 식 (그림 3 차원), 야생형 iPSCs에서 생산 지배적 인 이소 한 것으로 밝혀졌다. 디스트로핀의 엑손 결실 돌연변이 삭제 엑손을 플 랭킹 프라이머를 사용하여 특정 이영양증 iPSCs에서 확인할 수있다. 야생형 iPSCs는 디스트로핀 성적 증명서 증폭 (그림 3E)를 보여 반면 어떤 PCR 증폭 이영 iPSCs에서 검출되지 않습니다. &quot;항상&quot;=&gt; 페이지 내에서 <img alt="그림 1" src="/files/ftp_upload/52032/52032fig1highres.jpg" width="700px" /> 격리 된 소변 세포 (UCS)의 그림 1. 특성화 uroepithelial 전구, 중간 엽 평활근 계보를 보여줍니다. (A) 흐름 UCS의 유세포 분석 uroepithelial 및 혈관 주위 세포 마커 CD44, CD73와 CD146에 대한 복합 항체와 프로브. CD44, αSMA 및 멘틴와 UCS의 (B) 면역 염색. 알파 - 평활근 액틴 (αSMA)의 유전자 발현이 양성 대조군에 비해 동안 양성 대조군 샘플에 비해 (C) UCS의 유전자 발현 프로파일은 CK-7 및 UP-1a 및 UP-Ⅲa에 약한 표현을 보여줍니다. <a href="https://www-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/52032/52032fig1highres.jpg" target="_blank">여기를 클릭하십시오 이 그림의 더 큰 버전을 볼 수 있습니다.</a> / 52032 / 52032fig2highres.jpg &quot;폭 =&quot;700 픽셀을 &quot;업로드 /&gt; UC 그림 2. 재 프로그래밍 iPSCs를 생성합니다. 프로그램을 다시 타임 라인의 (A) 도식 개요. (B) 0 일 (SEV 전달), 4 일 (형태 전환), 일 (12)의 SEV 전달하는 동안 UCS의 다른 형태학을 나타내는 이미지 (만능 클론 MEFs에에 신흥) 및 피더없는 조건에서 특성 IPSC 클론 (IPSC을 마트 리겔에 -P2). (C) TRA-1-81 일 17 만능 식민지를 식별하기위한 라이브 세포 이미징. <a href="https://www-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/52032/52032fig2highres.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> <img alt="그림 3" src="/files/ftp_upload/52032/52032fig3highres.jpg" width="700px" /> 바이러스 성 게놈 및 형질 전환 유전자 무료 iPSCs 그림 3. 세대. (A)내인성 유전자 발현에 걸쳐 지속되는 동안 유전자 발현 분석 통로 (2) (IPSC-P2) 및 통로 (13) (IPSC-P13)에 의해 자신의 실종에 SEV 게놈과 OSKM의 도입 유전자의 존재를 보여줍니다. UCS 및 얻어진 iPSCs에 OCT3 / 4, TRA-1-81 염색 비교 (B) 위상차 이미지 및 면역 형광. (C) 디스트로핀 야생형 UCS, 및 (D) 특정 디스트로핀 이성체 (Dp71)은 WB에 의해 확인 될 수있다 비해 야생형 iPSCs에서 면역 형광에 의해 검출된다. (E) RT-PCR 분석을 야생형 UCS 및 iPSCs에 비해 이영 iPSCs에서 특정 디스트로핀 엑손 삭제를 확인하는 데 사용됩니다. <a href="https://www-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/52032/52032fig3highres.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> <table border="0" cellpadding="0" cellspacing="0"><tbody><tr><td> 시약 / 재료 / 장비의 이름 </td><td>회사 </td><td> 카탈로그 번호 </td><td> 댓글 </td></tr><tr><td> GAPDH 포워드 프라이머 </td><td> IDT 주식 </td><td> 서열 번호는 의견에 주어진 </td><td> GTGGACCTGACCTGCCGTCT </td></tr><tr><td> GAPDH - 역방향 프라이머 </td><td> IDT 주식 </td><td> 서열 번호는 의견에 주어진 </td><td> GGAGGAGTGGGTGTCGCTGT </td></tr><tr><td> CK7 포워드 프라이머 </td><td> IDT 주식 </td><td> 서열 번호는 의견에 주어진 </td><td> TGGTGCTGAAGAAGGATGTG </td></tr><tr><td> CK7-역방향 프라이머 </td><td> IDT 주식 </td><td> 서열 번호는 의견에 주어진 </td><td> CACGCTGGTTCTTGATGTTG </td></tr><tr><td> 업 IA-앞으로 프라이머 </td><td> IDT 주식 </td><td> 서열 번호는 의견에 주어진 </td><td> ACGTCCTACACCCACCGTGA </td></tr><tr><td> 업 IA-역방향 프라이머 </td><td> IDT 주식 </td><td> 서열 번호는 의견에 주어진 </td><td> ACCCCACGTGTAGCTGTCGAT </td></tr><tr><td> 최대-Ⅲa의 포워드 프라이머 </td><td> IDT 주식 </td><td> 서열 번호 g코멘트 iven </td><td> ACAAACAGAGGGTGGGAGGA CAG </td></tr><tr><td> 최대-Ⅲa의-역방향 프라이머 </td><td> IDT 주식 </td><td> 서열 번호는 의견에 주어진 </td><td> AGAAGGGCAGGGAGCCCAGG </td></tr><tr><td> αSMA 포워드 프라이머 </td><td> IDT 주식 </td><td> 서열 번호는 의견에 주어진 </td><td> ACCCACAATGTCCCCATCTA </td></tr><tr><td> αSMA - 역방향 프라이머 </td><td> IDT 주식 </td><td> 서열 번호는 의견에 주어진 </td><td> TGATCCACATCTGCTGGAAG </td></tr><tr><td> OCT3 / 4 (외인성) - 앞으로 프라이머 * </td><td> IDT 주식 </td><td> * 생명 기술 - Cytotune 키트 </td><td> CCCGAAAGAGAAAGCGAACCAG </td></tr><tr><td> OCT3 / 4 (외인성) - 역 프라이머 * </td><td> IDT 주식 </td><td> * 생명 기술 - Cytotune 키트 </td><td> AATGTATCGAAGGTGCTCAA </td></tr><tr><td> SOX2 (외인성) - 앞으로 프라이머 * </td><td> IDT 주식 </td><td> * 생명 기술 - Cytotune 키트 </td><td> ATGCACCGCTACGACGTGAG CGC </td></tr><tr><td> SOX2 (외인성) -Revers전자 뇌관 * </td><td> IDT 주식 </td><td> * 생명 기술 - Cytotune 키트 </td><td> AATGTATCGAAGGTGCTCAA </td></tr><tr><td> Klf4 (외인성) - 앞으로 프라이머 * </td><td> IDT 주식 </td><td> * 생명 기술 - Cytotune 키트 </td><td> TTCCTGCATGCCAGAGGAGCCC </td></tr><tr><td> Klf4 (외인성) - 역 프라이머 * </td><td> IDT 주식 </td><td> * 생명 기술 - Cytotune 키트 </td><td> AATGTATCGAAGGTGCTCAA </td></tr><tr><td> cMyc (외인성) - 앞으로 프라이머 * </td><td> IDT 주식 </td><td> * 생명 기술 - Cytotune 키트 </td><td> TAACTGACTAGCAGGCTTGTCG </td></tr><tr><td> cMyc (외인성) - 역 프라이머 * </td><td> IDT 주식 </td><td> * 생명 기술 - Cytotune 키트 </td><td> TCCACATACAGTCCTGGATGAT GATG </td></tr><tr><td> SEV (외인성) - 앞으로 프라이머 * </td><td> IDT 주식 </td><td> * 생명 기술 - Cytotune 키트 </td><td> GGATCACTAGGTGATATCGAGC </td></tr><tr><td> SEV (외인성) - 역 프라이머 * </td><td> IDT 주식 </td><td> * 생명 기술 - Cytotune 키트 </td><td>CCAGACAAGAGTTTAAGAGA TATGTATC </td></tr><tr><td> OCT3 / 4 (내인성) - 앞으로 프라이머 </td><td> IDT 주식 </td><td> 서열 번호는 의견에 주어진 </td><td> CAGTGCCCGAAACCCACAC </td></tr><tr><td> OCT3 / 4 (내인성) - 역 프라이머 </td><td> IDT 주식 </td><td> 서열 번호는 의견에 주어진 </td><td> GGAGACCCAGCAGCCTCAAA </td></tr><tr><td> SOX2 (내인성) - 앞으로 프라이머 </td><td> IDT 주식 </td><td> 서열 번호는 의견에 주어진 </td><td> CAAGATGCACAACTCGGAGA </td></tr><tr><td> SOX2 (내인성) - 역 프라이머 </td><td> IDT 주식 </td><td> 서열 번호는 의견에 주어진 </td><td> GTTCATGTGCGCGTAACTGT </td></tr><tr><td> 디스트로핀 포워드 프라이머 </td><td> IDT 주식 </td><td> 서열 번호는 의견에 주어진 </td><td> GGCAAAAACTGCCAAAAGAA </td></tr><tr><td> 디스트로핀 - 역방향 프라이머 </td><td> IDT 주식 </td><td> 서열 번호는 의견에 주어진 </td><td> GACCTGCCAGTGGAGGATTA </td></tr></tbody></table> PRI의 표 1. 목록메르 시퀀스.

Watch this Scientific Journal Video about Generation of Induced Pluripotent Stem Cells from Muscular Dystrophy Patients: Efficient Integration-free Reprogramming of Urine Derived Cells at JoVE.com

Generation of Induced Pluripotent Stem Cells from Muscular Dystrophy Patients: Efficient Integration-free Reprogramming of Urine Derived Cells

This protocol entails detailed procedures for isolation of urine derived cells from muscular dystrophy patients; their efficient and rapid reprogramming through Sendai virus transduction.

근육 영양 장애 환자에서 유도 만능 줄기 세포의 생성 : 소변 유래 세포의 효율적인 통합이없는 프로그램을 다시

Dystrophic cardiomyopathy is a poorly understood consequence of muscular dystrophy. Generating induced Pluripotent Stem Cells (iPSCs) from patients with ...

generation-induced-pluripotent-stem-cells-from-muscular-dystrophy

Universidad San Sebastian

Research

JoVE Journal

Medicine

11.2K 조회수.  Medical College of Wisconsin. This protocol entails detailed procedures for isolation of urine derived cells from muscular dystrophy patients; their efficient and rapid reprogramming through Sendai virus transduction. 

비디오: Generation of Induced Pluripotent Stem Cells from Muscular Dystrophy Patients: Efficient Integration-free Reprogramming of Urine Derived Cells

Generation of Induced Pluripotent Stem Cells from Frozen Buffy Coats using Non-integrating Episomal Plasmids

Somatic cells can be reprogrammed into induced pluripotent stem cells (iPSCs) by forcing the expression of four transcription factors (Oct-4, Sox-2, Klf-4, and c-Myc), typically expressed by human embryonic stem cells (hESCs). Due to their similarity with hESCs, iPSCs have become an important tool for potential patient-specific regenerative medicine, avoiding ethical issues associated with hESCs. In order to obtain cells suitable for clinical application, transgene-free iPSCs need to be generated to avoid transgene reactivation, altered gene expression and misguided differentiation. Moreover, a highly efficient and inexpensive reprogramming method is necessary to derive sufficient iPSCs for therapeutic purposes. Given this need, an efficient non-integrating episomal plasmid approach is the preferable choice for iPSC derivation. Currently the most common cell type used for reprogramming purposes are fibroblasts, the isolation of which requires tissue biopsy, an invasive surgical procedure for the patient. Therefore, human peripheral blood represents the most accessible and least invasive tissue for iPSC generation.
In this study, a cost-effective and viral-free protocol using non-integrating episomal plasmids is reported for the generation of iPSCs from human peripheral blood mononuclear cells (PBMNCs) obtained from frozen buffy coats after whole blood centrifugation and without density gradient separation.

Induced pluripotent stem cells (iPSCs) represent a source of patient-specific tissues for clinical applications and basic research. Here, we present a detailed protocol to reprogram human peripheral blood mononuclear cells (PBMNCs) obtained from frozen buffy coats into viral-free iPSCs using non-integrating episomal plasmids.

비 통합 에피 솜 플라스미드를 사용하여 냉동 버피 코트에서 유도 만능 줄기 세포의 생성

Somatic cells can be reprogrammed into induced pluripotent stem cells (iPSCs) by forcing the expression of four transcription factors (Oct-4, Sox-2, ...

연구

발생학

Transplantation of Induced Pluripotent Stem Cell-derived Mesoangioblast-like Myogenic Progenitors in Mouse Models of Muscle Regeneration

Patient-derived iPSCs could be an invaluable source of cells for future autologous cell therapy protocols. iPSC-derived myogenic stem/progenitor cells similar to pericyte-derived mesoangioblasts (iPSC-derived mesoangioblast-like stem/progenitor cells: IDEMs) can be established from iPSCs generated from patients affected by different forms of muscular dystrophy. Patient-specific IDEMs can be genetically corrected with different strategies (e.g. lentiviral vectors, human artificial chromosomes) and enhanced in their myogenic differentiation potential upon overexpression of the myogenesis regulator MyoD. This myogenic potential is then assessed in vitro with specific differentiation assays and analyzed by immunofluorescence. The regenerative potential of IDEMs is further evaluated in vivo, upon intramuscular and intra-arterial transplantation in two representative mouse models displaying acute and chronic muscle regeneration. The contribution of IDEMs to the host skeletal muscle is then confirmed by different functional tests in transplanted mice. In particular, the amelioration of the motor capacity of the animals is studied with treadmill tests. Cell engraftment and differentiation are then assessed by a number of histological and immunofluorescence assays on transplanted muscles. Overall, this paper describes the assays and tools currently utilized to evaluate the differentiation capacity of IDEMs, focusing on the transplantation methods and subsequent outcome measures to analyze the efficacy of cell transplantation.

Induced pluripotent stem cell (iPSC)-derived myogenic progenitors are promising candidates for cell therapy strategies to treat muscular dystrophies. This protocol describes transplantation and functional measurements required to evaluate the engraftment and differentiation of iPSC-derived mesoangioblasts (a type of muscle progenitors) in mouse models of acute and chronic muscle regeneration.

근육 재생의 마우스 모델에서 유도 만능 줄기 세포 유래 메소안지오블라스트 와 같은 근생 성 전구의 이식

Patient-derived iPSCs could be an invaluable source of cells for future autologous cell therapy protocols. iPSC-derived myogenic stem/progenitor cells ...

생체공학

Exon Skipping in Directly Reprogrammed Myotubes Obtained from Human Urine-Derived Cells

Duchenne muscular dystrophy (DMD), a progressive and fatal muscle disease, is caused by mutations in the DMD gene that result in the absence of dystrophin protein. To date, we have completed an investigator-initiated first-in-human study at the National Center of Neurology and Psychiatry based on the systemic injection of the morpholino oligonucleotides which are prone to exon-53 skipping. For the effective treatment of DMD, in vitro testing with myoblasts derived from DMD patients to screen drugs and assess patient eligibility before undertaking clinical trials is thought to be essential. Very recently, we reported a new MYOD1-converted urine-derived cell (UDC) treated with the histone methyltransferase inhibitor (3-deazaneplanocin A hydrochloride), as a cellular model of DMD. The new autologous UDC might show phenocopy of the disease-specific phenotypes of DMD, leading to the application of precision medicine in a variety of muscle-related diseases. In this article, we describe a detailed protocol for efficient modelling of DMD muscle cells using MYOD1-converted UDCs along with reverse transcriptase polymerase chain reaction (RT-PCR), Western blotting, and immunocytochemistry to evaluate the restoration of dystrophin mRNA and protein levels after exon skipping.

In this article, we describe a detailed protocol for efficient modelling of Duchenne muscular dystrophy muscle using MYOD1-converted urine-derived cells to evaluate the restoration of dystrophin mRNA and protein levels after exon skipping.

인간 소변 유래 세포에서 얻은 직접 재프로그래밍 된 Myotube에서 건너 뛰는 Exon

Duchenne muscular dystrophy (DMD), a progressive and fatal muscle disease, is caused by mutations in the DMD gene that result in the absence of dystrophin ...

유전학

Direct Reprogramming of Human Fibroblasts into Myoblasts to Investigate Therapies for Neuromuscular Disorders

Investigations into both the pathophysiology and therapeutic targets in muscular dystrophies have been hampered by the limited proliferative capacity of human myoblasts. Several mouse models have been created but they either do not truly represent the human physiopathology of the disease or are not representative of the broad spectrum of mutations found in humans. The immortalization of human primary myoblasts is an alternative to this limitation; however, it is still dependent on muscle biopsies, which are invasive and not easily available. In contrast, skin biopsies are easier to obtain and less invasive to patients. Fibroblasts derived from skin biopsies can be immortalized and transdifferentiated into myoblasts, providing a source of cells with excellent myogenic potential. Here, we describe a fast and direct reprogramming method of fibroblast into a myogenic lineage. Fibroblasts are transduced with two lentiviruses: hTERT to immortalize the primary culture and a tet-inducible MYOD, which upon the addition of doxycycline, induces the conversion of fibroblasts into myoblasts and then mature myotubes, which express late differentiation markers. This quick transdifferentiation protocol represents a powerful tool to investigate pathological mechanisms and to investigate innovative gene-based or pharmacological biotherapies for neuromuscular disorders.

This protocol describes the conversion of skin fibroblasts into myoblasts and their differentiation into myotubes. The cell lines are derived from patients with neuromuscular disorders and can be used to investigate pathological mechanisms and to test therapeutic strategies.

신경 근육 장애에 대 한 치료를 조사 하기 위해 Myoblasts에 인간 섬유 아 세포의 직접 재프로그래밍

Investigations into both the pathophysiology and therapeutic targets in muscular dystrophies have been hampered by the limited proliferative capacity of ...

RNA-based Reprogramming of Human Primary Fibroblasts into Induced Pluripotent Stem Cells

Induced pluripotent stem cells (iPSCs) have proven to be a valuable tool to study human development and disease. Further advancing iPSCs as a regenerative therapeutic requires a safe, robust, and expedient reprogramming protocol. Here, we present a clinically relevant, step-by-step protocol for the extremely high-efficiency reprogramming of human dermal fibroblasts into iPSCs using a non-integrating approach. The core of the protocol consists of expressing pluripotency factors (SOX2, KLF4, cMYC, LIN28A, NANOG, OCT4-MyoD fusion) from in vitro transcribed messenger RNAs synthesized with modified nucleotides (modified mRNAs). The reprogramming modified mRNAs are transfected into primary fibroblasts every 48 h together with mature embryonic stem cell-specific microRNA-367/302 mimics for two weeks. The resulting iPSC colonies can then be isolated and directly expanded in feeder-free conditions. To maximize efficiency and consistency of our reprogramming protocol across fibroblast samples, we have optimized various parameters including the RNA transfection regimen, timing of transfections, culture conditions, and seeding densities. Importantly, our method generates high-quality iPSCs from most fibroblast sources, including difficult-to-reprogram diseased, aged, and/or senescent samples.

Here we describe a clinically relevant, high-efficiency, feeder-free method to reprogram human primary fibroblasts into induced pluripotent stem cells using modified mRNAs encoding reprogramming factors and mature microRNA-367/302 mimics. Also included are methods to assess reprogramming efficiency, expand clonal iPSC colonies, and confirm expression of the pluripotency marker TRA-1-60.

인간의 기본 섬유 아 세포의 유도 만능 줄기 세포로 재프로그래밍 RNA 기반

Induced pluripotent stem cells (iPSCs) have proven to be a valuable tool to study human development and disease. Further advancing iPSCs as a regenerative ...

CRISPR/Cas9 Technology in Restoring Dystrophin Expression in iPSC-Derived Muscle Progenitors

Duchenne muscular dystrophy (DMD) is a severe progressive muscle disease caused by mutations in the dystrophin gene, which ultimately leads to the exhaustion of muscle progenitor cells. Clustered regularly interspaced short palindromic repeats/CRISPR-associated 9 (CRISPR/Cas9) gene editing has the potential to restore the expression of the dystrophin gene. Autologous induced pluripotent stem cells (iPSCs)-derived muscle progenitor cells (MPC) can replenish the stem/progenitor cell pool, repair damage, and prevent further complications in DMD without causing an immune response. In this study, we introduce a combination of CRISPR/Cas9 and non-integrated iPSC technologies to obtain muscle progenitors with recovered dystrophin protein expression. Briefly, we use a non-integrating Sendai vector to establish an iPSC line from dermal fibroblasts of Dmdmdx mice. We then use the CRISPR/Cas9 deletion strategy to restore dystrophin expression through a non-homologous end joining of the reframed dystrophin gene. After PCR validation of exon23 depletion in three colonies from 94 picked iPSC colonies, we differentiate iPSC into MPC by doxycycline (Dox)-induced expression of MyoD, a key transcription factor playing a significant role in regulating muscle differentiation. Our results show the feasibility of using CRISPR/Cas9 deletion strategy to restore dystrophin expression in iPSC-derived MPC, which has significant potential for developing future therapies for the treatment of DMD.

Here, we present a Cas9-based exon23 deletion protocol to restore dystrophin expression in iPSC from Dmdmdx mouse-derived skin fibroblasts and directly differentiate iPSCs into myogenic progenitor cells (MPC) using the Tet-on MyoD activation system.

iPSC 유래 근육 전조제에서 디스트로핀 발현 복원에 있는 CRISPR/Cas9 기술

Duchenne muscular dystrophy (DMD) is a severe progressive muscle disease caused by mutations in the dystrophin gene, which ultimately leads to the ...

Derivation of Adult Human Fibroblasts and their Direct Conversion into Expandable Neural Progenitor Cells

Generation of&#160;induced pluripotent stem cell (iPSCs) from adult skin fibroblasts and subsequent differentiation into somatic cells provides fascinating prospects for the derivation of autologous transplants that circumvent histocompatibility barriers. However, progression through a pluripotent state and subsequent complete differentiation into desired lineages remains a roadblock for the clinical translation of iPSC technology because of the associated neoplastic potential and genomic instability. Recently, we and others showed that somatic cells cannot only be converted into iPSCs but also into different types of multipotent somatic stem cells by using defined factors, thereby circumventing progression through the pluripotent state. In particular, the direct conversion of human fibroblasts into induced neural progenitor cells (iNPCs) heralds the possibility of a novel autologous cell source for various applications such as cell replacement, disease modeling and drug screening. Here, we describe the isolation of adult human primary fibroblasts by skin biopsy and their efficient direct conversion into iNPCs by timely restricted expression of Oct4, Sox2, Klf4, as well as c-Myc. Sox2-positive neuroepithelial colonies appear after 17 days of induction and iNPC lines can be established efficiently by monoclonal isolation and expansion. Precise adjustment of viral multiplicity of infection and supplementation of leukemia inhibitory factor during the induction phase represent critical factors to achieve conversion efficiencies of up to 0.2%. Thus far, patient-specific iNPC lines could be expanded for more than 12 passages and uniformly display morphological and molecular features of neural stem/progenitor cells, such as the expression of Nestin and Sox2. The iNPC lines can be differentiated into neurons and astrocytes as judged by staining against TUJ1 and GFAP, respectively. In conclusion, we report a robust protocol for the derivation and direct conversion of human fibroblasts into stably expandable neural progenitor cells that might provide a cellular source for biomedical applications such as autologous neural cell replacement and disease modeling.

Generation of induced pluripotent stem cells provides fascinating prospects for the derivation of autologous transplants. However, progression through a pluripotent state and laborious re-differentiation still hinders clinical translation. Here we describe the derivation of adult human fibroblasts and their direct conversion into induced neural progenitor cells and the subsequent differentiation into neural lineages.

성인 인간 섬유 아세포의 유도 및 확장 신경 전구 세포에 자신의 직접 변환

Generation of&#160;induced pluripotent stem cell (iPSCs) from adult skin fibroblasts and subsequent differentiation into somatic cells provides ...

신경과학

Selecting and Isolating Colonies of Human Induced Pluripotent Stem Cells Reprogrammed from Adult Fibroblasts

Herein we present a protocol of reprogramming human adult fibroblasts into human induced pluripotent stem cells (hiPSC) using retroviral vectors encoding Oct3/4, Sox2, Klf4 and c-myc (OSKM) in the presence of sodium butyrate 1-3. We used this method to reprogram late passage (&gt;p10) human adult fibroblasts derived from Friedreich's ataxia patient (GM03665, Coriell Repository). The reprogramming approach includes highly efficient transduction protocol using repetitive centrifugation of fibroblasts in the presence of virus-containing media. The reprogrammed hiPSC colonies were identified using live immunostaining for Tra-1-81, a surface marker of pluripotent cells, separated from non-reprogrammed fibroblasts and manually passaged 4,5. These hiPSC were then transferred to Matrigel plates and grown in feeder-free conditions, directly from the reprogramming plate. Starting from the first passage, hiPSC colonies demonstrate characteristic hES-like morphology. Using this protocol more than 70% of selected colonies can be successfully expanded and established into cell lines. The established hiPSC lines displayed characteristic pluripotency markers including surface markers TRA-1-60 and SSEA-4, as well as nuclear markers Oct3/4, Sox2 and Nanog. 
The protocol presented here has been established and tested using adult fibroblasts obtained from Friedreich's ataxia patients and control individuals 6, human newborn fibroblasts, as well as human keratinocytes.

We present a protocol for efficient reprogramming of human somatic cells into human induced pluripotent stem cells (hiPSC) using retroviral vectors encoding Oct3/4, Sox2, Klf4 and c-myc (OSKM) and identification of correctly reprogrammed hiPSC by live staining with Tra-1-81 antibody.

인간 유도 Pluripotent 줄기 세포의 선택 및 분리 식민지는 성인 섬유아 세포에서 다시 프로그램

Herein we present a protocol of reprogramming human adult fibroblasts into human induced pluripotent stem cells (hiPSC) using retroviral vectors encoding ...

생물학

Isolation of Adult Human Dermal Fibroblasts from Abdominal Skin and Generation of Induced Pluripotent Stem Cells Using a Non-Integrating Method

Induced pluripotent stem cells (iPSCs) could be considered, to date, a promising source of pluripotent cells for the management of currently untreatable diseases, for the reconstitution and regeneration of injured tissues and for the development of new drugs. Despite all the advantages related to the use of iPSCs, such as the low risk of rejection, the lessened ethical issues, and the possibility to obtain them from both young and old patients without any difference in their reprogramming potential, problems to overcome are still numerous. In fact, cell reprogramming conducted with viral and integrating viruses can cause infections and the introduction of required genes can induce a genomic instability of the recipient cell, impairing their use in clinic. In particular, there are many concerns about the use of c-Myc gene, well-known from several studies for its mutation-inducing activity. Fibroblasts have emerged as the suitable cell population for cellular reprogramming as they are easy to isolate and culture and are harvested by a minimally invasive skin punch biopsy. The protocol described here provides a detailed step-by-step description of the whole procedure, from sample processing to obtain cell cultures, choice of reagents and supplies, cleaning and preparation, to cell reprogramming by the means of a commercial non-modified RNAs (NM-RNAs)-based reprogramming kit. The chosen reprogramming kit allows an effective reprogramming of human dermal fibroblast to iPSCs and small colonies can be seen as early as 24 h after the first transfection, even with modifications with the respect to the standard datasheet. The reprogramming procedure used in this protocol offers the advantage of a safe reprogramming, without the risk of infections caused by viral vector-based methods, reduces the cellular defense mechanisms, and allows the generation of xeno-free iPSCs, all critical features that are mandatory for further clinical applications.

Cell reprogramming requires the introduction of key genes, which regulate and maintain the pluripotent cell state. The protocol described enables the formation of induced pluripotent stem cells (iPSCs) colonies from human dermal fibroblasts without viral/integrating methods but using non-modified RNAs (NM-RNAs) combined with immune evasion factors reducing cellular defense mechanisms.

비통합 방법을 사용하여 복부 피부에서 성인 인간 진피 섬유 아세포의 분리 및 유도 만능 줄기 세포의 생성

Induced pluripotent stem cells (iPSCs) could be considered, to date, a promising source of pluripotent cells for the management of currently untreatable ...

Generation of Myospheres From hESCs by Epigenetic Reprogramming

Generation of a homogeneous and abundant population of skeletal muscle cells from human embryonic stem cells (hESCs) is a requirement for cell-based therapies and for a "disease in a dish" model of human neuromuscular diseases. Major hurdles, such as low abundance and heterogeneity of the population of interest, as well as a lack of protocols for the formation of three-dimensional contractile structures, have limited the applications of stem cells for neuromuscular disorders. We have designed a protocol that overcomes these limits by ectopic introduction of defined factors in hESCs - the muscle determination factor MyoD and SWI/SNF chromatin remodeling complex component BAF60C - that are able to reprogram hESCs into skeletal muscle cells. Here we describe the protocol established to generate hESC-derived myoblasts and promote their clustering into tridimensional miniaturized structures (myospheres) that functionally mimic miniaturized skeletal muscles7.

Here, we describe a protocol based on epigenetic reprogramming of human embryonic stem cells (hESCs) toward generating a homogeneous population of skeletal muscle progenitors that under permissive culture conditions form three-dimensional clusters of contractile myofibers (myospheres), which recapitulate biological features of human skeletal muscles.

성적인 프로그램을 다시 만들에 의해 인간 배아 줄기 세포에서 Myospheres의 생성

Generation of a homogeneous and abundant population of skeletal muscle cells from human embryonic stem cells (hESCs) is a requirement for cell-based ...