Wir danken Dr. Alexandre Mourot für seine Bemerkungen über das Manuskript. Diese Arbeit wurde unterstützt durch Zuschüsse von der Agence Nationale De La Recherche (ANR 2011 MALZ 003 01; ANR-15-CE16-0010 und ANR-17-CE37-0010-03), BLG wird von der Fondation Pour la Recherche Sur Alzheimer-Stipendium unterstützt. Wir danken der Tierstation IBPS (Paris, Frankreich).

Die Autoren haben nichts preisgeben.

Einzelne Zelle Multiplex-RT-PCR nach Patch-Clamp zuverlässig und gleichzeitig die Expression von mehr als 30 Genen Elektrophysiologisch identifizierten Zellen5Sonde kann. Analyse der Genexpression auf der Ebene der einzelnen Zelle erfordert hocheffiziente PCR-Primer. Eine der am meisten einschränkenden Maßnahmen ist Sammlung des Zellinhalts. Seine Wirksamkeit hängt vom Durchmesser des Patch-PIPETTENSPITZE, die so groß wie möglich sein muss, während die passende Größe der Zellen. Pipetten mit einem 1-2 µm offene Spitzendurchmesser wurden ausgewiesen, für die meisten neuronalen Arten geeignet. Es ist auch unbedingt darauf zu achten, dass nur die zelluläre Inhalt gesammelt werden, und nicht das umliegende Gewebe. Dies wird erreicht durch die Steuerung Elektrophysiologisch der Erhaltung der dicht bei der Ernte. Die Bildung einer außen-Out Patch-Konfiguration bei der Pipette Entnahme weiter schützt die geerntete Zytoplasma zelltrümmer. Die Erfolgsquote der einzelnen Zelle, die Multiplex-RT-PCR auch von mRNAs Fülle des untersuchten Zelltyps hängt. Zum Beispiel die Ausbeute erhalten mit Astrozyten, die mRNAs in relativ geringen Mengen3zum Ausdruck bringen, ist in der Regel niedriger als die mit Neuronen erhalten und erfordert daher Erhöhung der Probe Größe15,16. Reversen Transkription, hat eine geringe Effizienz in Röhren48ist die begrenzende Reaktion von Single cell Multiplex-RT-PCR. Daher ist es wichtig, hochwertige Reagenzien als Aliquote bei-80 ° C lagern und verwenden sie nur für einen Tag zu verwenden. Schließlich ist die DNA-Polymerase-Aktivität von der RTase oft eine übersehene Quelle der Primer-Dimer-Bildung. Um dieses Problem zu beheben, ist die Durchführung eines hot-Start mit Primer entscheidend zur Steigerung der Effizienz der Verstärkung. Darüber hinaus kann die hemmende Wirkung des RTase auf die Taq-DNA-Polymerase-Aktivität49reduzieren.
Die einzelne Zelle Multiplex-RT-PCR-Technik ist vielseitig einsetzbar. Es wurde ausgiebig in Nagetieren10,11,13,19,20,34,50,51,52 verwendet ,53,54 , aber praktisch alle Tiermodelle und Gene davon aus, dass Gewebe und Gen-Sequenzen zur Verfügung stehen angepasst werden können. Verschiedene Patch-Clamp-Lösungen können verwendet werden, solange sie nicht mit der RT-PCR auf Zelle frei Assays stören. Beispielsweise wurden interne Lösungen basierend auf K+ oder Cs+ kationen, Cl– oder Gluconat erfolgreich verwendeten6,36,41,55.
Klassische falsch-negative Ergebnisse stammen von RNase Kontamination der Patch Pipette Filament und/oder interne Patch-Clamp-Lösung. Sorgfältig das Filament chlorieren und Validierung von in der Regel die interne Lösung dieses Problem lösen. Falsch-negative Ergebnisse können auch auftreten, wenn ein Gen auf einem niedrigen einzelligen Niveau exprimiert wird, da nur ein Teil des Zytoplasmas geerntet wird. Die Ernte Qualität kann durch die Verwendung größerer Pipetten und/oder durch eine Verringerung der gesamten Zelle Buchungszeitpunkt erhöht werden. Qualität ernten kann beurteilt werden, durch die Einbeziehung eines Gens bekannt, auf einem niedrigen Niveau in Einzelzellen20ausgedrückt werden. Falsch-positive Ergebnisse können qualitativ schlechte Gewebe auftreten, in denen die Höhe der Kontamination zelltrümmer hoch ist. Prüfung der Anwesenheit von Schutt erfolgt durch das Einfügen einer Patch-Pipette in die Scheibe ohne Durchführung einer Dichtung und Freigabe der positive Druck vor dem Pipette entfernen. Das Vorhandensein von amplifiable Materialien ist dann von Multiplex-RT-PCR42sondiert. Silanizing der Patch-Pipette wurde auch verwendet, um die Sammlung von extrazellulären Verunreinigungen56zu reduzieren. Einzelne Zelle PCR ist eine sehr sensible Technik, die so wenig wie eine einzelne Kopie der doppelten stranded DNA57erkennen kann. Im Falle der Intron-weniger Gene produzieren die gDNA im Zellkern enthalten auch Fehlalarme. Die Sammlung von gDNA zu vermeiden, indem man die Pipette vom Zellkern während der Ernte hilft, dieses Problem zu lösen. Das Vorhandensein von gDNA kann zuverlässig durch die Verstärkung einer intronischen Sequenz25sondiert werden.
Der Nachweis von mRNA-Moleküle durch RT-PCR wird unzuverlässig auf 10 Exemplare44, vermutlich aufgrund der geringen Effizienz der RTase48und führen zu einer unter Nachweis von niedrig-Fülle Transkripte26,42. Dies kann im Fall von Gene Intron-weniger problematisch sein. In der Tat, reduziert die Ernte des Kerns zu vermeiden die Höhe der Zytoplasma, die gesammelt werden kann und daher die Nachweisempfindlichkeit. Die Kombination von einzelligen RT-PCR nach Patch-Clamp mit Biocytin Kennzeichnung erfordert, dass die Form der Zelle so weit wie möglich beibehalten wird (Abbildung 3). Unvermeidlich, reduziert dies die Menge des Materials, die gesammelt werden kann, wodurch die Erfolgsquote. Ein Kompromiss zwischen Zytoplasma Sammlung und Erhaltung der Zellmorphologie ist obligatorisch.
Multiplex-Einzeller-RT-PCR-Daten sind nicht quantitativ, wie sie nur Informationen geben darüber, ob cDNAs sind vorhanden oder fehlen in das gesammelte Material. Allerdings kann das Auftreten der Erkennung auf Bevölkerungsebene aufgrund der oben beschriebenen Nachweisgrenzen, die Fülle der Gene auf die einzelne Zellenebene widerspiegeln. Alternative Ansätze ermöglichen die Erzeugung mehr quantitative Daten, aber die technischen Zwänge, die durch ihre spezifische Verstärkung Strategien (d.h.relative Quantifizierung der homologen Gene oder RT-qPCR) weitgehend beschränken die Anzahl der Gene, die gleichzeitig sein können analysiert,41,53,55,58,59,60,61,62,63 ,64,65,66. Die aktuelle Kombination von Patch-Clamp-Aufnahmen und einzelne Zelle RNaseq, bezeichnet als Patch-Seq30,31, ermöglicht quantitative transkriptomischen Analyse der Zellen Elektrophysiologisch gekennzeichnet. Es ist eine neue, viel versprechende Ansatz, aber es erfordert Zugriff auf Hochdurchsatz-Sequenzer und erzeugten Daten erfordern zeitraubende Analyse.

Die Großhirnrinde besteht aus zahlreichen Zelltypen in verschiedenen physiologischen Prozessen beteiligt. Ihre Identifizierung und Charakterisierung, eine Voraussetzung für das Verständnis ihrer spezifischen Funktionen können sehr anspruchsvoll sein angesichts der großen morphologische, physiologische und molekulare Vielfalt, die kortikale Zelle Arten1 charakterisiert ,2,3,4.
Einzellige Multiplex-RT-PCR basiert auf der Kombination von Patch-Clamp und RT-PCR-Techniken. Es kann gleichzeitig die Expression von mehr als 30 vordefinierte Genen Elektrophysiologisch identifizierten Zellen5Sonde. Die Einbeziehung eines neuronalen Tracers in der Aufnahme-Pipette weiter ermöglicht die Morphologische Charakterisierung der aufgezeichneten Zellen nach histochemische Offenbarung6,7,8,9, 10. es ist eine sehr nützliche Technik für die Klassifizierung von neuronalen Arten anhand der multivariaten Analyse ihrer phänotypischen Merkmale5,9,10,11,12 ,13,14. Einzelne Zelle Multiplex-RT-PCR eignet sich auch zur Charakterisierung von nicht-neuronalen Zellen wie Astrozyten15,16,17und kann praktisch auf jedem Gehirn Struktur18angewendet werden, 19,20,21,22,23 und Zelle Art, vorausgesetzt, sie können in ganz-Zell Konfiguration aufgenommen werden.
Diese Technik ist sehr praktisch für die Identifizierung von zellulären Quellen bzw. Ziele der Übertragung Systeme7,8,15,16,20,21, 24,25,26,27,28, vor allem, wenn spezifische Antikörper fehlen. Es stützt sich auf Patch-Clamp-Aufnahmen von visuell identifizierte Zellen29und ermöglicht somit auch die Ausrichtung der Zellen in einem bestimmten zellulären Umgebung8,15,16. Außerdem da die Cytoarchitecture von Hirngewebe in Gehirnscheiben bewahrt wird, ermöglicht dieser Ansatz auch Studie über die anatomischen Verhältnisse der gekennzeichneten Zellen mit neuronalen und nicht-neuronale Elements7,8 , 18.
Da diese Technik durch die Menge des geernteten Zytoplasma und die Effizienz des RT begrenzt ist, kann der Nachweis von mRNA ausgedrückt bei geringen Kopienzahl schwierig sein. Obwohl andere Ansätze, basierend auf RNaseq-Technologie ermöglichen, um das ganze Transkriptom Einzelzellen3,4,30,31, zu analysieren, benötigen sie Hochdurchsatz-teure Sequenzer nicht unbedingt Jedes Labor zur Verfügung. Da die einzelne Zelle Multiplex-RT-PCR Technik Endpunkt PCR verwendet, erfordert es nur allgemein verfügbar Thermocycler. Es kann leicht in Laboratorien ausgestattet mit elektrophysiologischen Setups entwickelt werden und erfordert keine teure Ausrüstung. Es kann innerhalb eines Tages eine Qualitative Analyse des Ausdrucks einen vordefinierten Satz von Genen bereitstellen. So bietet dieser Ansatz eine gute Anbindung an die molekulare Charakterisierung einzelner Zellen in einer schnellen Weise.

<table><tbody><tr><td>MACAW v.2.0.5</td><td>NCBI</td><td></td><td>Multiple alignement for primer design</td></tr><tr><td>Dithiothreitol</td><td>VWR</td><td>443852A</td><td>RT</td></tr><tr><td>Random primers</td><td>Sigma-Aldrich (Merck)</td><td>11034731001</td><td>RT</td></tr><tr><td>dNTPs</td><td>GE Healthcare Life Sciences</td><td>28-4065-52</td><td>RT and PCR</td></tr><tr><td>RNasin Ribonuclease Inhibitors</td><td>Promega</td><td>N2511</td><td>RT</td></tr><tr><td>SuperScript II Reverse Transcriptase</td><td>Invitrogen</td><td>18064014</td><td>RT</td></tr><tr><td>Taq DNA Polymerase</td><td>Qiagen</td><td>201205</td><td>PCR</td></tr><tr><td>Mineral Oil</td><td>Sigma-Aldrich (Merck)</td><td>M5904-5ML</td><td>PCR</td></tr><tr><td>PCR primers</td><td>Sigma-Aldrich (Merck)</td><td></td><td>PCR / desalted and diluted at 200 &amp;micro;M</td></tr><tr><td>Tubes, 0.5 mL, flat cap</td><td>ThermoFisher Scientific</td><td>AB0350</td><td>RT and PCR</td></tr><tr><td>BT10 Series - 10 &amp;micro;L Filter Tip</td><td>Neptune Scientific</td><td>BT10</td><td>RT and PCR</td></tr><tr><td>BT20 Series - 20 &amp;micro;L Filter Tip</td><td>Neptune Scientific</td><td>BT20</td><td>RT and PCR</td></tr><tr><td>BT200 Series - 200 &amp;micro;L Filter Tip</td><td>Neptune Scientific</td><td>BT200</td><td>RT and PCR</td></tr><tr><td>BT1000 Series - 1000 &amp;micro;L Filter Tip</td><td>Neptune Scientific</td><td>BT1000.96</td><td>RT and PCR</td></tr><tr><td>DNA Thermal Cylcer</td><td>Perkin Elmer Cetus</td><td></td><td>PCR</td></tr><tr><td>Ethidium Bromide</td><td>Sigma-Aldrich (Merck)</td><td>E1510-10ML</td><td>Agarose gel electrophoresis</td></tr><tr><td>Tris-Borate-EDTA buffer</td><td>Sigma-Aldrich (Merck)</td><td>T4415-1L</td><td>Agarose gel electrophoresis</td></tr><tr><td>UltraPure Agarose</td><td>Life Technologies</td><td>16500-500</td><td>Agarose gel electrophoresis</td></tr><tr><td>&amp;Phi;X174 DNA-Hae III Digest</td><td>NEB (New England BioLabs)</td><td>N3026S</td><td>Agarose gel electrophoresis</td></tr><tr><td>EDA 290</td><td>Kodak</td><td></td><td>Agarose gel electrophoresis</td></tr><tr><td>Electrophoresis Power supply EPS 3500</td><td>Pharmacia Biotech</td><td></td><td>Agarose gel electrophoresis</td></tr><tr><td>Midi Horizontal Elecrophoresis Unit Model SHU13</td><td>Sigma-Aldrich (Merck)</td><td></td><td>Agarose gel electrophoresis</td></tr><tr><td>Smooth paper with satin appearance</td><td>Fisherbrand</td><td>1748B</td><td>Patch clamp internal solution</td></tr><tr><td>Potassium Hydroxyde</td><td>Sigma-Aldrich (Merck)</td><td>60377</td><td>Patch clamp internal solution</td></tr><tr><td>Ethylene glycol-bis(2-aminoethylether)-N,N,N&amp;prime;,N&amp;prime;-tetraacetic acid</td><td>Sigma-Aldrich (Merck)</td><td>E3889</td><td>Patch clamp internal solution</td></tr><tr><td>HEPES</td><td>Sigma-Aldrich (Merck)</td><td>H4034</td><td>Patch clamp internal solution</td></tr><tr><td>Potassium D-gluconate</td><td>Sigma-Aldrich (Merck)</td><td>G4500</td><td>Patch clamp internal solution</td></tr><tr><td>Magnesium chloride solution</td><td>Sigma-Aldrich (Merck)</td><td>M1028</td><td>Patch clamp internal solution</td></tr><tr><td>5500 Vapor Pressure Osmometer</td><td>Wescor</td><td></td><td>Patch clamp internal solution</td></tr><tr><td>Biocytin</td><td>Sigma-Aldrich (Merck)</td><td>B4261</td><td>Patch clamp internal solution</td></tr><tr><td>Sucrose</td><td>Sigma-Aldrich (Merck)</td><td>S5016</td><td>Slice preparation</td></tr><tr><td>D-(+)-Glucose monohydrate</td><td>Sigma-Aldrich (Merck)</td><td>49159</td><td>Slice preparation</td></tr><tr><td>Sodium chloride</td><td>Sigma-Aldrich (Merck)</td><td>S6191</td><td>Slice preparation</td></tr><tr><td>Potassium chloride</td><td>Sigma-Aldrich (Merck)</td><td>60128</td><td>Slice preparation</td></tr><tr><td>Sodium bicarbonate</td><td>Sigma-Aldrich (Merck)</td><td>31437-M</td><td>Slice preparation</td></tr><tr><td>Sodium phosphate monobasic</td><td>Sigma-Aldrich (Merck)</td><td>S5011</td><td>Slice preparation</td></tr><tr><td>Magnesium chloride solution</td><td>Sigma-Aldrich (Merck)</td><td>63069</td><td>Slice preparation</td></tr><tr><td>Calcium chloride solution</td><td>Sigma-Aldrich (Merck)</td><td>21115</td><td>Slice preparation</td></tr><tr><td>Kynurenic acid</td><td>Sigma-Aldrich (Merck)</td><td>K3375</td><td>Slice preparation</td></tr><tr><td>Isoflurane</td><td>Piramal Healthcare UK</td><td></td><td>Slice preparation</td></tr><tr><td>VT 1000S</td><td>Leica Biosystems</td><td>14047235613</td><td>Slice preparation</td></tr><tr><td>Hydrogen peroxide solution</td><td>Sigma-Aldrich (Merck)</td><td>H1009</td><td>Patch Clamp set-up cleaning</td></tr><tr><td>Thin Wall Glass Capillaries with filament</td><td>World Precision Instruments</td><td>TW150F-4</td><td>Patch Clamp</td></tr><tr><td>PP-83</td><td>Narishige</td><td></td><td>Patch Clamp</td></tr><tr><td>Eppendorf Microloader</td><td>Eppendorf</td><td>5242956003</td><td>Patch Clamp</td></tr><tr><td>BX51WI Upright microscope</td><td>Olympus</td><td></td><td>Patch Clamp</td></tr><tr><td>XC-ST70/CE CCD B/W VIDEO CAMERA</td><td>Sony</td><td></td><td>Patch Clamp</td></tr><tr><td>Axopatch 200B Amplifier</td><td>Molecular Devices</td><td></td><td>Patch Clamp</td></tr><tr><td>Digidata 1440</td><td>Molecular Devices</td><td></td><td>Patch Clamp</td></tr><tr><td>pCLAMP 10 software suite</td><td>Molecular Devices</td><td></td><td>Patch Clamp</td></tr><tr><td>10 mL syringe</td><td>Terumo</td><td>SS-10ES</td><td>Expelling</td></tr><tr><td>E Series with Straight Body (Holder)</td><td>Phymep</td><td>64-0997</td><td>Expelling</td></tr><tr><td>Sodium phosphate dibasic</td><td>Sigma-Aldrich (Merck)</td><td>S7907</td><td>Histochemical revelation</td></tr><tr><td>Sodium phosphate monobasic</td><td>Sigma-Aldrich (Merck)</td><td>S8282</td><td>Histochemical revelation</td></tr><tr><td>Paraformaldehyde</td><td>Sigma-Aldrich (Merck)</td><td>P6148</td><td>Histochemical revelation</td></tr><tr><td>Triton X-100</td><td>Sigma-Aldrich (Merck)</td><td>X100</td><td>Histochemical revelation</td></tr><tr><td>Gelatin from cold water fish skin</td><td>Sigma-Aldrich (Merck)</td><td>G7041</td><td>Histochemical revelation</td></tr><tr><td>Streptavidin, Alexa Fluor 488 conjugate</td><td>ThermoFisher Scientific</td><td>S11223</td><td>Histochemical revelation</td></tr><tr><td>24-well plate</td><td>Greiner Bio-One</td><td>662160</td><td>Histochemical revelation</td></tr></tbody></table>

single cell multiplex reverse transcription polymerase chain reaction after patch-clamp

Die Großhirnrinde besteht aus zahlreichen Zelltypen, die verschiedenen morphologische, physiologische und molekulare Eigenschaften ausstellen. Diese Vielfalt behindert einfache Identifizierung und Charakterisierung dieser Zelltypen, Voraussetzungen, um ihre spezifischen Funktionen zu studieren. Dieser Artikel beschreibt das Multiplex-Einzelzelle reversen Transkription Polymerase Kettenreaktion (RT-PCR) Protokoll, das, nach Patch-Clamp-Aufnahme in Scheiben schneiden, ermöglicht gleichzeitig die Expression von Zehntausenden Gene in einer einzelnen Zelle erkennen. Diese einfache Methode kann mit Morphologische Charakterisierung durchgeführt werden und gilt allgemein für die phänotypische Merkmale der verschiedenen Zelltypen und ihre bestimmten zellulären Umgebung, wie z. B. in der Nähe von Blutgefäßen zu bestimmen. Das Prinzip dieses Protokolls ist aufzeichnen eine Zelle mit der Patch-Clamp-Technik, zu ernten und umkehren transkribieren zytoplasmatischen inhaltlich und qualitativ zu erkennen der Ausdruck der einen vordefinierten Satz von Genen durch multiplex-PCR. Es erfordert eine sorgfältige Planung der PCR Zündkapseln und intrazellulären Patch-Clamp-Lösung kompatibel mit RT-PCR. Um eine selektive und zuverlässige Abschrift zu gewährleisten benötigt-Erkennung, diese Technik auch entsprechende Kontrollen von Zytoplasma Ernte zur Verstärkung Schritte. Obwohl hier beschriebenen Vorsichtsmaßnahmen strikt befolgt werden müssen, kann praktisch alle elektrophysiologischen Labor die Multiplex-einzelne Zelle RT-PCR-Technik verwenden.

Eine repräsentative Validierung der Multiplex-RT-PCR ist in Abbildung 3dargestellt. Das Protokoll wurde entwickelt, um gleichzeitig die Expression von 12 verschiedenen Genen Sonde. Die vesikuläre Glutamat Transporter vGluT1 wurde als Positivkontrolle für glutamatergen Neuronen42übernommen. Die GABA-Synthese von Enzymen (GAD65 und GAD-67), NEUROPEPTID Y (NPY) und Somatostatin (SOM) dienten als Marker der Gabaergen Interneuronen3,5,11. Das Enzym Cyclooxygenase-2 (COX-2) diente als ein Marker für die pyramidale Zelle Subpopulation3,16.
ATP1α1-3 Untereinheiten des Na+/+ ATPase k und die Kir6.2 und SUR1 Untereinheiten des ATP-sensitiven K+ -Kanäle wurden ausgewählt, um die Beziehung zwischen neuronaler Aktivität und metabolische Staaten43bewerten. Da Kir6.2 ein Intron-Less-gen ist, war die SOM-Intron als genomische Steuerelement enthalten. Das Protokoll wurde getestet auf 1 ng von reverse transkribierten Gesamt-RNS extrahiert vom ganzen Gehirn der Maus, die etwa die Transkripte von 20 entspricht44Zellen. Die Multiplex-PCR produziert 12 Amplifikate der erwarteten Größe (Abbildung 3 und Tabelle 1) zeigt die Empfindlichkeit und die Effizienz des Protokolls. Die negative-Kontrolle durchgeführt, ohne RNA produziert keine Amplifikate (Daten nicht gezeigt).
Eine Schicht V pyramidale Neuron wurde optisch durch seine großen Soma und einem prominenten apikalen Dendriten identifiziert (Abb. 5A, inset). Ganze Zelle Aufnahme zeigte typische elektrophysiologische Eigenschaften der Schicht V regelmäßige spiking Neuronen5,45,46 , vor allem, einen niedrigen Eingangswiderstand, lang anhaltende Aktionspotentiale und ausgeprägte spike Frequenz-Anpassung (Abb. 5A). Die molekulare Analyse von diesem Neuron offenbart die Expression von vGluT1 (Abb. 5 b), bestätigt seine glutamatergen Phänotyp42,46. Dieses Neuron auch ausgedrückt, SOM, ATP1α1 und 3 Untereinheiten des Na+/+ ATPase k. Biocytin Kennzeichnung der aufgezeichneten Neuronen bestätigt eine pyramidale Morphologie (Abbildung 5).
Erwartungsgemäß von glutamatergen Neuronen offenbart die molekulare Analyse von 26 v. Schicht Pyramidenzellen Ausdruck des VGluT1, aber keiner von den beiden GADs (Abbildung 5). Markierungen von Interneuronen wurden5,42,46selten beobachtet. COX-2, vor allem zum Ausdruck von Schicht II-III Pyramidenzellen3,16, wurde nicht in Schicht V Pyramidenzellen erkannt. Die ATP1α1 und 3 Untereinheiten wurden häufiger beobachtet als ATP1α2 Untereinheit3. Die Kir6.2 und SUR1 Untereinheiten wurden selten in Schicht V pyramidale Neuronen, erkannt die steht im Einklang mit ihren bevorzugten Ausdruck in oberen Schichten3,43. Darauf wurde geachtet, nicht um die Kerne, wodurch eine seltene Entdeckung von SOM Introns (3 von 26 Zellen, d.h.12 %) zu ernten.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/57627/57627fig1.jpg"> Abbildung 1: eigene Box für einzelne Zelle RT-PCR. Liste der Materialien, die für die RT-PCR nach Patch-Clamp reserviert. (1) Borosilikatglas Kapillaren, lange (2) 20 µL, fein, flexibel Tipps (3) 20 µL mikropipette, (4) hausgemachte Expeller, (5) 500 µL PCR Tubes, (6) 10 µL Aerosol beständig Filtertips und (7) permanent-Marker. <a href="https://www-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/57627/57627fig1large.jpg" target="_blank">Bitte klicken Sie hier für eine größere Version dieser Figur.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/57627/57627fig2.jpg"> Abbildung 2: PCR Primer Designstrategie. (A) schematische Darstellung der kodierenden Sequenz von COX 2 cDNA ausgerichtet, die Maus-Chromosom 2-Sequenz, die COX-2-Gen enthält. Exons werden durch Black Boxes und Introns auf gDNA von weißen Kästchen dargestellt. Beachten Sie die Lücken in der cDNA, die intronischen Sequenzen auf gDNA entspricht. Repräsentative Beispiele für schlechte und gute Oligonukleotide, die jeweils als rote und grüne Pfeile dargestellt. Rechte und linke Pfeile kennzeichnen forward und reverse Primer. (B) Sequenzen und Sekundärstrukturen der Oligonukleotide in (A) gezeigt. Linken und Rechte Platten zeigen Haarnadel selbst-Komplementarität und selbst-Dimer-Bildung, beziehungsweise. B1 -Oligonukleotid zeigt eine starke Haarnadel selbst-Komplementarität und Dimer der Bildung, während die B2 -Oligonukleotid nur Dimer-Bildung zeigt. B3 und B4 Oligonukleotide haben keine Haarnadel selbst-Komplementarität und keine Dimer-Bildung; Sie sind Intron overspanning (A) und als potenziellen PCR-Primer (siehe Tabelle 1) ausgewählt wurden. <a href="https://www-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/57627/57627fig2large.jpg" target="_blank">Bitte klicken Sie hier für eine größere Version dieser Figur.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/57627/57627fig3.jpg"> Abbildung 3: Validierung von multiplex PCR. 1 ng von Gesamt-RNS von ganzen Gehirn der Maus eine reverse Transkription, gefolgt von zwei Runden der PCR-Amplifikation unterzogen wurde. Die 12 PCR-Produkte wurden in getrennten Fahrspuren durch Agarose-Gelelektrophorese parallel mit Φx174 von HaeIII verdaut gelöst. Die zweite PCR-Produkte hatte Größen (in bp) von den Sequenzen vorhergesagt: 153 (vGluT1), 248 (GAD65), 255 (GAD67), 181 (COX-2), 220 (NPY), 146 (SOM), 183 (ATP1a1), 213 (ATP1a2), 128 (ATP1a3), 342 (Kir6.2), 211 (SUR1) und 182 (SOMInt). <a href="https://www-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/57627/57627fig3large.jpg" target="_blank">Bitte klicken Sie hier für eine größere Version dieser Figur.</a>
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/57627/57627fig4.jpg"> Abbildung 4: Patch-Clamp Ernte in Hirnschnitten. Sobald eine Zelle visuell erkannt wird, ist die Aufnahme-Pipette mit einem Überdruck näherte, um zelltrümmer Verunreinigungen an der Spitze der Pipette zu vermeiden. Beachten Sie die Grübchen auf der Membran von diesem Neuron. Überdruck wird dann unterbrochen, um eine Zelle-attached Konfiguration Gigaohm dicht zu bilden. Kurze Lenzsauger werden angewendet, um zu ganz-Zell Konfiguration wechseln. Am Ende der Aufzeichnung wird Zytoplasma geerntet, durch die Anwendung eines leichten Unterdrucks in der Pipette unter Beibehaltung der Abdichtung. Beachten Sie die Schrumpfung der Zellkörper während der Ernteverfahren. Die Aufnahme-Pipette wird dann sanft zurückgezogen, um ein außen-Out Patch, bilden die Zellmembran Verschluss für nachfolgende Biocytin Offenbarung und Erhaltung des geernteten Materials in der Patch-Pipette begünstigt. Von Cauli und Lambolez47 reproduziert mit freundlicher Genehmigung von der Royal Society of Chemistry. <a href="https://www-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/57627/57627fig4large.jpg" target="_blank">Bitte klicken Sie hier für eine größere Version dieser Figur.</a>
<img alt="Figure 5" class="xfigimg" src="/files/ftp_upload/57627/57627fig5.jpg"> Abbildung 5: Charakterisierung der neokortikalen Pyramidenzellen Schicht V. (A) Membran mögliche Antwort einer Schicht V pyramidale Zelle durch Stromimpulse von-100,-40 -10, + 60, 120 und + 500 pA (unteren Spuren) induziert. Das Neuron zeigt eine schwache mögliche Auslenkung nach hyperpolarizing Erstreaktion (obere Spuren). In Reaktion auf eine supraliminal Depolarisation entladen das Neuron lang anhaltende Aktionspotentiale mit langsam entwickelnden nach Hyperpolarisation (obere Spur). In der Nähe von Sättigung das Neuron bei einer niedrigen Frequenz entladen und eine ausgeprägte Anpassung (obere graue Spur) ausgestellt. Einschub: Infrarot-Bilder des aufgezeichneten Schicht V pyramidenförmigen Neurons. Die pial Oberfläche ist nach oben. Maßstabsleiste: 20 µm. (B) Multiplex RT-PCR-Analyse offenbart Ausdruck von vGluT1, SOM, ATP1α1 und ATP1α3. (C) Genexpressionsprofil in einer Stichprobe von 26 Schicht V Pyramidenzellen. vGluT1 wurde in alle Neuronen exprimiert, während GAD65, GAD67 und COX2 nie erkannt wurden. NPY, SOM Kir6.2, SUR1 und SOMInt wurden selten beobachtet. Pyramidenzellen ausgedrückt ATP1α3, 1 Untereinheit des Na+/+ ATPase k und ATP1α2 in geringerem Ausmass. (D) maximale Intensität Projektion der konfokalen Bilder zeigen Biocytin Kennzeichnung des Neurons in (A) aufgezeichnet. <a href="https://www-jove-com.bdigitaluss.remotexs.co/files/ftp_upload/57627/57627fig5large.jpg" target="_blank">Bitte klicken Sie hier für eine größere Version dieser Figur.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody>
<tr>
<td>Gen / GenBank Anzahl</td>
			<td colspan="2">Externe Primer</td>
			<td>Größe (bp)</td>
			<td colspan="2">Interne Primer</td>
			<td>Größe (bp)</td>
		</tr>
<tr>
<td rowspan="4">vGlut1 NM_182993</td>
			<td colspan="2">Sinn,-113</td>
			<td rowspan="4">259</td>
			<td colspan="2">Sinn,-54</td>
			<td rowspan="4">153</td>
		</tr>
<tr>
<td colspan="2">GGCTCCTTTTTCTGGGGCTAC</td>
			<td colspan="2">ATTCGCAGCCAACAGGGTCT</td>
		</tr>
<tr>
<td colspan="2">Anti-Sense, 126</td>
			<td colspan="2">Anti-Sense, 79</td>
		</tr>
<tr>
<td colspan="2">CCAGCCGACTCCGTTCTAAG</td>
			<td colspan="2">TGGCAAGCAGGGTATGTGAC</td>
		</tr>
<tr>
<td rowspan="4">GAD65 NM_008078</td>
			<td colspan="2">Sinn, 99</td>
			<td rowspan="4">375</td>
			<td colspan="2">Sinn, 219</td>
			<td rowspan="4">248</td>
		</tr>
<tr>
<td colspan="2">CCAAAAGTTCACGGGCGG</td>
			<td colspan="2">CACCTGCGACCAAAAACCCT</td>
		</tr>
<tr>
<td colspan="2">Anti-Sense, 454</td>
			<td colspan="2">Anti-Sense, 447</td>
		</tr>
<tr>
<td colspan="2">TCCTCCAGATTTTGCGGTTG</td>
			<td colspan="2">GATTTTGCGGTTGGTCTGCC</td>
		</tr>
<tr>
<td rowspan="4">GAD67 NM_008077</td>
			<td colspan="2">Sinn, 529</td>
			<td rowspan="4">598</td>
			<td colspan="2">Sinn, 801</td>
			<td rowspan="4">255</td>
		</tr>
<tr>
<td colspan="2">TACGGGGTTCGCACAGGTC</td>
			<td colspan="2">CCCAGAAGTGAAGACAAAAGGC</td>
		</tr>
<tr>
<td colspan="2">Anti-Sense, 1109</td>
			<td colspan="2">Anti-Sense, 1034</td>
		</tr>
<tr>
<td colspan="2">CCCAGGCAGCATCCACAT</td>
			<td colspan="2">AATGCTCCGTAAACAGTCGTGC</td>
		</tr>
<tr>
<td rowspan="4">COX 2 NM_011198</td>
			<td colspan="2">Sinn, 199</td>
			<td rowspan="4">268</td>
			<td colspan="2">Sinn, 265</td>
			<td rowspan="4">181</td>
		</tr>
<tr>
<td colspan="2">CTGAAGCCCACCCCAAACAC</td>
			<td colspan="2">AACAACATCCCCTTCCTGCG</td>
		</tr>
<tr>
<td colspan="2">Anti-Sense, 445</td>
			<td colspan="2">Anti-Sense, 426</td>
		</tr>
<tr>
<td colspan="2">CCTTATTTCCCTTCACACCCAT</td>
			<td colspan="2">TGGGAGTTGGGCAGTCATCT</td>
		</tr>
<tr>
<td rowspan="4">NPY NM_023456</td>
			<td colspan="2">Sinn, 16</td>
			<td rowspan="4">294</td>
			<td colspan="2">Sinn, 38</td>
			<td rowspan="4">220</td>
		</tr>
<tr>
<td colspan="2">CGAATGGGGCTGTGTGGA</td>
			<td colspan="2">CCCTCGCTCTATCTCTGCTCGT</td>
		</tr>
<tr>
<td colspan="2">Anti-Sense, 286</td>
			<td colspan="2">Anti-Sense, 236</td>
		</tr>
<tr>
<td colspan="2">AAGTTTCATTTCCCATCACCACAT</td>
			<td colspan="2">GCGTTTTCTGTGCTTTCCTTCA</td>
		</tr>
<tr>
<td rowspan="4">SOM NM_009215</td>
			<td colspan="2">Sinn, 43</td>
			<td rowspan="4">208</td>
			<td colspan="2">Sinn, 75</td>
			<td rowspan="4">146</td>
		</tr>
<tr>
<td colspan="2">ATCGTCCTGGCTTTGGGC</td>
			<td colspan="2">GCCCTCGGACCCCAGACT</td>
		</tr>
<tr>
<td colspan="2">Anti-Sense, 231</td>
			<td colspan="2">Anti-Sense, 203</td>
		</tr>
<tr>
<td colspan="2">GCCTCATCTCGTCCTGCTCA</td>
			<td colspan="2">GCAAATCCTCGGGCTCCA</td>
		</tr>
<tr>
<td rowspan="4">
ATP1Α1 NM_144900
</td>
			<td colspan="2">Sinn, 1287</td>
			<td rowspan="4">288</td>
			<td colspan="2">Sinn, 1329</td>
			<td rowspan="4">183</td>
		</tr>
<tr>
<td colspan="2">CAGGGCAGTGTTTCAGGCTAA</td>
			<td colspan="2">TAAGCGGGCAGTAGCGGG</td>
		</tr>
<tr>
<td colspan="2">Anti-Sense, 1556</td>
			<td colspan="2">Anti-Sense, 1492</td>
		</tr>
<tr>
<td colspan="2">CCGTGGAGAAGGATGGAGC</td>
			<td colspan="2">AGGTGTTTGGGCTCAGATGC</td>
		</tr>
<tr>
<td rowspan="4">ATP1Α2 NM_178405</td>
			<td colspan="2">Sinn, 1392</td>
			<td rowspan="4">268</td>
			<td colspan="2">Sinn, 1430</td>
			<td rowspan="4">213</td>
		</tr>
<tr>
<td colspan="2">AGTGAGGAAGATGAGGGACAGG</td>
			<td colspan="2">AAATCCCCTTCAACTCCACCA</td>
		</tr>
<tr>
<td colspan="2">Anti-Sense, 1640</td>
			<td colspan="2">Anti-Sense, 1623</td>
		</tr>
<tr>
<td colspan="2">ACAGAAGCCCAGCACTCGTT</td>
			<td colspan="2">GTTCCCCAAGTCCTCCCAGC</td>
		</tr>
<tr>
<td rowspan="4">ATP1Α3 NM_144921</td>
			<td colspan="2">Sinn, 127</td>
			<td rowspan="4">216</td>
			<td colspan="2">Sinn, 158</td>
			<td rowspan="4">128</td>
		</tr>
<tr>
<td colspan="2">CGGAAATACAATACTGACTGCGTG</td>
			<td colspan="2">TGACACACAGTAAAGCCCAGGA</td>
		</tr>
<tr>
<td colspan="2">Anti-Sense, 324</td>
			<td colspan="2">Anti-Sense, 264</td>
		</tr>
<tr>
<td colspan="2">GTCATCCTCCGTCCCTGCC</td>
			<td colspan="2">CCACAGCAGGATAGAGAAGCCA</td>
		</tr>
<tr>
<td rowspan="4">Kir6.2 NM_010602</td>
			<td colspan="2">Sinn, 306</td>
			<td rowspan="4">431</td>
			<td colspan="2">Sinn, 339</td>
			<td rowspan="4">342</td>
		</tr>
<tr>
<td colspan="2">CGGAGAGGGCACCAATGT</td>
			<td colspan="2">CATCCACTCCTTTTCATCTGCC</td>
		</tr>
<tr>
<td colspan="2">Anti-Sense, 719</td>
			<td colspan="2">Anti-Sense, 663</td>
		</tr>
<tr>
<td colspan="2">CACCCACGCCATTCTCCA</td>
			<td colspan="2">TCGGGGCTGGTGGTCTTG</td>
		</tr>
<tr>
<td rowspan="4">SUR1 NM_011510</td>
			<td colspan="2">Sinn, 1867</td>
			<td rowspan="4">385</td>
			<td colspan="2">Sinn, 2041</td>
			<td rowspan="4">211</td>
		</tr>
<tr>
<td colspan="2">CAGTGTGCCCCCCGAGAG</td>
			<td colspan="2">ATCATCGGAGGCTTCTTCACC</td>
		</tr>
<tr>
<td colspan="2">Anti-Sense, 2231</td>
			<td colspan="2">Anti-Sense, 2231</td>
		</tr>
<tr>
<td colspan="2">GGTCTTCTCCCTCGCTGTCTG</td>
			<td colspan="2">GGTCTTCTCCCTCGCTGTCTG</td>
		</tr>
<tr>
<td rowspan="4">SOMint X51468</td>
			<td colspan="2">Sinn, 8</td>
			<td rowspan="4">240</td>
			<td colspan="2">Sinn, 16</td>
			<td rowspan="4">182</td>
		</tr>
<tr>
<td colspan="2">CTGTCCCCCTTACGAATCCC</td>
			<td colspan="2">CTTACGAATCCCCCAGCCTT</td>
		</tr>
<tr>
<td colspan="2">Anti-Sense, 228</td>
			<td colspan="2">Anti-Sense, 178</td>
		</tr>
<tr>
<td colspan="2">CCAGCACCAGGGATAGAGCC</td>
			<td colspan="2">TTGAAAGCCAGGGAGGAACT</td>
		</tr>
</tbody></table>Tabelle 1. Sequenzen der ersten und zweiten PCR-Primer. Die Position der einzelnen PCR Primer und ihre Sequenzen erfolgen von 5' nach 3'. Mit Ausnahme der Somatostatin-Intron entspricht Position 1 auf den ersten Boden des Start-Codon für jedes Gen.

Watch this Scientific Journal Video about Single Cell Multiplex Reverse Transcription Polymerase Chain Reaction After Patch-clamp at JoVE.com

Single Cell Multiplex Reverse Transcription Polymerase Chain Reaction After Patch-clamp

Einzelne Zelle Multiplex reversen Transkription Polymerase-Kettenreaktion nach Patch-clamp

Dieses Protokoll beschreibt die kritische Schritte und Vorsichtsmaßnahmen erforderlich, einzelne Zelle multiplex reversen Transkription Polymerase-Kettenreaktion nach Patch-Clamp durchzuführen. Diese Technik ist eine einfache und effektive Methode um das Expressionsprofil eines vorgegebenen Satzes Gene aus einer einzigen Zelle zeichnet sich durch Patch-Clamp-Aufnahmen zu analysieren.

The cerebral cortex is composed of numerous cell types exhibiting various morphological, physiological, and molecular features. This diversity hampers ...

single-cell-multiplex-reverse-transcription-polymerase-chain-reaction

Universidad San Sebastian

Research

JoVE Journal

Neuroscience

9.7K Aufrufe.  Sorbonne Université. Dieses Protokoll beschreibt die kritische Schritte und Vorsichtsmaßnahmen erforderlich, einzelne Zelle multiplex reversen Transkription Polymerase-Kettenreaktion nach Patch-Clamp durchzuführen. Diese Technik ist eine einfache und effektive Methode um das Expressionsprofil eines vorgegebenen Satzes Gene aus einer einzigen Zelle zeichnet sich durch Patch-Clamp-Aufnahmen zu analysieren.

Serie: Single Cell Multiplex Reverse Transcription Polymerase Chain Reaction After Patch-clamp

Profiling Voltage-gated Potassium Channel mRNA Expression in Nigral Neurons using Single-cell RT-PCR Techniques

In mammalian central nervous system, different types of neurons with diverse molecular and functional characteristics are intermingled with each other, difficult to separate and also not easily identified by their morphology. Thus, it is often difficult to analyze gene expression in a specific neuron type. Here we document a procedure that combines whole-cell patch clamp recording techniques with single-cell reverse transcription polymerase chain reaction (scRT-PCR) to profile mRNA expression in different types of neurons in the substantial nigra. Electrophysiological techniques are first used to record the neurophysiological and functional properties of individual neurons. Then, the cytoplasm of single electrophysiologically characterized nigral neurons is aspirated and subjected to scRT-PCR analysis to obtain mRNA expression profiles for neurotransmitter synthesis enzymes, receptors, and ion channels. The high selectivity and sensitivity make this method particularly useful when immunohistochemistry can not be used due to a lack of suitable antibody or low expression level of the protein. This method is also applicable to neurons in other brain areas.

Neurons are first characterized electrophysiologically. Then the cytoplasm from the recorded neuron is aspirated and subjected to reverse transcription-PCR analysis to detect the expression of mRNAs for neurotransmitter synthesis enzymes, ion channels, and receptors.

Profiling Voltage-gated Potassium Channel-mRNA Expression in nigralen Neuronen mit Einzel-Zell RT-PCR-Techniken

In mammalian central nervous system, different types of neurons with diverse molecular and functional characteristics are intermingled with each other, ...

Forschung

Neurowissenschaften

Single-cell Profiling of Developing and Mature Retinal Neurons

Highly specialized, but exceedingly small populations of cells play important roles in many tissues. The identification of cell-type specific markers and gene expression programs for extremely rare cell subsets has been a challenge using standard whole-tissue approaches. Gene expression profiling of individual cells allows for unprecedented access to cell types that comprise only a small percentage of the total tissue1-7. In addition, this technique can be used to examine the gene expression programs that are transiently expressed in small numbers of cells during dynamic developmental transitions8.
This issue of cellular diversity arises repeatedly in the central nervous system (CNS) where neuronal connections can occur between quite diverse cells9. The exact number of distinct cell types is not precisely known, but it has been estimated that there may be as many as 1000 different types in the cortex itself10. The function(s) of complex neural circuits may rely on some of the rare neuronal types and the genes they express. By identifying new markers and helping to molecularly classify different neurons, the single-cell approach is particularly useful in the analysis of cell types in the nervous system. It may also help to elucidate mechanisms of neural development by identifying differentially expressed genes and gene pathways during early stages of neuronal progenitor development.
As a simple, easily accessed tissue with considerable neuronal diversity, the vertebrate retina is an excellent model system for studying the processes of cellular development, neuronal differentiation and neuronal diversification. However, as in other parts of the CNS, this cellular diversity can present a problem for determining the genetic pathways that drive retinal progenitors to adopt a specific cell fate, especially given that rod photoreceptors make up the majority of the total retinal cell population11. Here we report a method for the identification of the transcripts expressed in single retinal cells (Figure 1). The single-cell profiling technique allows for the assessment of the amount of heterogeneity present within different cellular populations of the retina2,4,5,12. In addition, this method has revealed a host of new candidate genes that may play role(s) in the cell fate decision-making processes that occur in subsets of retinal progenitor cells8. With some simple adjustments to the protocol, this technique can be utilized for many different tissues and cell types.

A method for the isolation of single retinal cells and subsequent amplification of their cDNAs is described. Single-cell transcriptomics reveals the degree of cellular heterogeneity present in a tissue and uncovers new marker genes for rare cell populations. The accompanying protocol can be adjusted to suit many different cell types.

Einzel-Zell-Profiling der Entwicklung und Reife Netzhautneuronen

Highly specialized, but exceedingly small populations of cells play important roles in many tissues. The identification of cell-type specific markers and ...

A Computer-assisted Multi-electrode Patch-clamp System

The patch-clamp technique is today the most well-established method for recording electrical activity from individual neurons or their subcellular compartments. Nevertheless, achieving stable recordings, even from individual cells, remains a time-consuming procedure of considerable complexity. Automation of many steps in conjunction with efficient information display can greatly assist experimentalists in performing a larger number of recordings with greater reliability and in less time. In order to achieve large-scale recordings we concluded the most efficient approach is not to fully automatize the process but to simplify the experimental steps and reduce the chances of human error while efficiently incorporating the experimenter's experience and visual feedback. With these goals in mind we developed a computer-assisted system which centralizes all the controls necessary for a multi-electrode patch-clamp experiment in a single interface, a commercially available wireless gamepad, while displaying experiment related information and guidance cues on the computer screen. Here we describe the different components of the system which allowed us to reduce the time required for achieving the recording configuration and substantially increase the chances of successfully recording large numbers of neurons simultaneously.

Multi-electrode patch-clamp recordings constitute a complex task. Here we show how, by automating of many of the experimental steps, it is possible to accelerate the process leading to qualitative improvement in performance and number of recordings.

Eine EDV-gestützte Multi-Elektroden-Patch-Clamp-System

The patch-clamp technique is today the most  well-established method for recording electrical activity from individual  neurons or their subcellular ...

Mutagenesis and Functional Analysis of Ion Channels Heterologously Expressed in Mammalian Cells

We will demonstrate how to study the functional effects of introducing a point mutation in an ion channel. We study G protein-gated inwardly rectifying potassium (referred to as GIRK) channels, which are important for regulating the excitability of neurons. There are four different mammalian GIRK channel subunits (GIRK1-GIRK4) - we focus on GIRK2 because it forms a homotetramer. Stimulation of different types of G protein-coupled receptors (GPCRs), such as the muscarinic receptor (M2R), leads to activation of GIRK channels. Alcohol also directly activates GIRK channels. We will show how to mutate one amino acid by specifically changing one or more nucleotides in the cDNA for the GIRK channel. This mutated cDNA sequence will be amplified in bacteria, purified, and the presence of the point mutation will be confirmed by DNA sequencing. The cDNAs for the mutated and wild-type GIRK channels will be transfected into human embryonic kidney HEK293T cells cultured in vitro. Lastly, whole-cell patch-clamp electrophysiology will be used to study the macroscopic potassium currents through the ectopically expressed wild-type or mutated GIRK channels. In this experiment, we will examine the effect of a L257W mutation in GIRK2 channels on M2R-dependent and alcohol-dependent activation.

We will demonstrate how to study the effect of a single point mutation on the function of an ion channel.

Mutagenese und funktionale Analyse von Ionenkanälen heterolog in Säugerzellen exprimierten

We will demonstrate how to study the functional effects of introducing a point mutation in an ion channel. We study G protein-gated inwardly rectifying ...

Biologie

Optimized Transfection Strategy for Expression and Electrophysiological Recording of Recombinant Voltage-Gated Ion Channels in HEK-293T Cells

The in vitro expression and electrophysiological recording of recombinant voltage-gated ion channels in cultured human embryonic kidney cells (HEK-293T) is a ubiquitous research strategy. HEK-293T cells must be plated onto glass coverslips at low enough density so that they are not in contact with each other in order to allow for electrophysiological recording without confounding effects due to contact with adjacent cells. Transfected channels must also express with high efficiency at the plasma membrane for whole-cell patch clamp recording of detectable currents above noise levels. Heterologous ion channels often require long incubation periods at 28&deg;C after transfection in order to achieve adequate membrane expression, but there are increasing losses of cell-coverslip adhesion and membrane stability at this temperature. To circumvent this problem, we developed an optimized strategy to transfect and plate HEK-293T cells. This method requires that cells be transfected at a relatively high confluency, and incubated at 28&deg;C for varying incubation periods post-transfection to allow for adequate ion channel protein expression. Transfected cells are then plated onto glass coverslips and incubated at 37&deg;C for several hours, which allows for rigid cell attachment to the coverslips and membrane restabilization. Cells can be recorded shortly after plating, or can be transferred to 28&deg;C for further incubation. We find that the initial incubation at 28&deg;C, after transfection but before plating, is key for the efficient expression of heterologous ion channels that normally do not express well at the plasma membrane. Positively transfected, cultured cells are identified by co-expressed eGFP or eGFP expressed from a bicistronic vector (e.g. pIRES2-EGFP) containing the recombinant ion channel cDNA just upstream of an internal ribosome entry site and an eGFP coding sequence. Whole-cell patch clamp recording requires specialized equipment, plus the crafting of polished recording electrodes and L-shaped ground electrodes from borosilicate glass. Drug delivery to study the pharmacology of ion channels can be achieved by directly micropipetting drugs into the recording dish, or by using microperfusion or gravity flow systems that produce uninterrupted streams of drug solution over recorded cells.

Reliable method for highly efficient in vitro expression and subsequent electrophysiological recording of recombinant voltage-gated ion channels in cultured human embryonic kidney cells (HEK-293T).

Optimierte Transfektion Strategie für Expression und elektrophysiologische Ableitung von rekombinantem Voltage-Gated Ion Channels in HEK-293T-Zellen

The in vitro expression and electrophysiological recording of recombinant voltage-gated ion channels in cultured human embryonic kidney cells (HEK-293T) ...

Whole-cell Patch-clamp Recordings for Electrophysiological Determination of Ion Selectivity in Channelrhodopsins

Over the past decade, channelrhodopsins became indispensable in neuroscientific research where they are used as tools to non-invasively manipulate electrical processes in target cells. In this context, ion selectivity of a channelrhodopsin is of particular importance. This article describes the investigation of chloride selectivity for a recently identified anion-conducting channelrhodopsin of Proteomonas sulcata via electrophysiological patch-clamp recordings on HEK293 cells. The experimental procedure for measuring light-gated photocurrents demands a fast switchable &#8211; ideally monochromatic &#8211; light source coupled into the microscope of an otherwise conventional patch-clamp setup. Preparative procedures prior to the experiment are outlined involving preparation of buffered solutions, considerations on liquid junction potentials, seeding and transfection of cells, and pulling of patch pipettes. The actual recording of current-voltage relations to determine the reversal potentials for different chloride concentrations takes place 24 h to 48 h after transfection. Finally, electrophysiological data are analyzed with respect to theoretical considerations of chloride conduction.

This article describes how the ion selectivity of channelrhodopsin is determined with electrophysiological whole-cell patch-clamp recordings using HEK293 cells. Here, the experimental procedure for investigating chloride selectivity of an anion-selective channelrhodopsin is demonstrated. However, the procedure is transferable to other channelrhodopsins of distinct selectivity.

Ganzzellige Patch-Clamp-Aufnahmen zur elektrophysiologischen Bestimmung der Ionenselektivität in Channelrhodopsinen

Over the past decade, channelrhodopsins became indispensable in neuroscientific research where they are used as tools to non-invasively manipulate ...

Single Cell Transcriptional Profiling of Adult Mouse Cardiomyocytes

While numerous studies have examined gene expression changes from homogenates of heart tissue, this prevents studying the inherent stochastic variation between cells within a tissue. Isolation of pure cardiomyocyte populations through a collagenase perfusion of mouse hearts facilitates the generation of single cell microarrays for whole transcriptome gene expression, or qPCR of specific targets using nanofluidic arrays. We describe here a procedure to examine single cell gene expression profiles of cardiomyocytes isolated from the heart. This paradigm allows for the evaluation of metrics of interest which are not reliant on the mean (for example variance between cells within a tissue) which is not possible when using conventional whole tissue workflows for the evaluation of gene expression (Figure 1). We have achieved robust amplification of the single cell transcriptome yielding micrograms of double stranded cDNA that facilitates the use of microarrays on individual cells. In the procedure we describe the use of NimbleGen arrays which were selected for their ease of use and ability to customize their design. Alternatively, a reverse transcriptase - specific target amplification (RT-STA) reaction, allows for qPCR of hundreds of targets by nanofluidic PCR. Using either of these approaches, it is possible to examine the variability of expression between cells, as well as examining expression profiles of rare cell types from within a tissue. Overall, the single cell gene expression approach allows for the generation of data that can potentially identify idiosyncratic expression profiles that are typically averaged out when examining expression of millions of cells from typical homogenates generated from whole tissues.

Single cell expression profiling allows the detailed gene expression analysis of individual cells. We describe methods for the isolation of cardiomyocytes, and preparing the resulting lysates for either whole transcriptome microarray or qPCR of specific targets.

Single Cell Transcriptional Profiling der erwachsenen Maus Kardiomyozyten

While numerous studies have examined gene expression changes from homogenates of heart tissue, this prevents studying the inherent stochastic variation ...

One-channel Cell-attached Patch-clamp Recording

Ion channel proteins are universal devices for fast communication across biological membranes. The temporal signature of the ionic flux they generate depends on properties intrinsic to each channel protein as well as the mechanism by which it is generated and controlled and represents an important area of current research. Information about the operational dynamics of ion channel proteins can be obtained by observing long stretches of current produced by a single molecule. Described here is a protocol for obtaining one-channel cell-attached patch-clamp current recordings for a ligand gated ion channel, the NMDA receptor, expressed heterologously in HEK293 cells or natively in cortical neurons. Also provided are instructions on how to adapt the method to other ion channels of interest by presenting the example of the mechano-sensitive channel PIEZO1. This method can provide data regarding the channel&#8217;s conductance properties and the temporal sequence of open-closed conformations that make up the channel&#8217;s activation mechanism, thus helping to understand their functions in health and disease.

Described here is a procedure for obtaining long stretches of current recording from one ion channel with the cell-attached patch-clamp technique. This method allows for observing, in real time, the pattern of open-close channel conformations that underlie the biological signal. These data inform about channel properties in undisturbed biological membranes.

Ein-Kanal-Cell-Attached-Patch-Clamp-Aufnahme

Ion channel proteins are universal devices for fast communication across biological membranes. The temporal signature of the ionic flux they generate ...

Technical Applications of Microelectrode Array and Patch Clamp Recordings on Human Induced Pluripotent Stem Cell-Derived Cardiomyocytes

Drug-induced cardiotoxicity is the leading cause of drug attrition and withdrawal from the market. Therefore, using appropriate preclinical cardiac safety assessment models is a critical step during drug development. Currently, cardiac safety assessment is still highly dependent on animal studies. However, animal models are plagued by poor translational specificity to humans due to species-specific differences, particularly in terms of cardiac electrophysiological characteristics. Thus, there is an urgent need to develop a reliable, efficient, and human-based model for preclinical cardiac safety assessment. Human-induced pluripotent stem cell-derived cardiomyocytes (hiPSC-CMs) have emerged as an invaluable in vitro model for drug-induced cardiotoxicity screening and disease modeling. hiPSC-CMs can be obtained from individuals with diverse genetic backgrounds and various diseased conditions, making them an ideal surrogate to assess drug-induced cardiotoxicity individually. Therefore, methodologies to comprehensively investigate the functional characteristics of hiPSC-CMs need to be established. In this protocol, we detail various functional assays that can be assessed on hiPSC-CMs, including the measurement of contractility, field potential, action potential, and calcium handling. Overall, the incorporation of hiPSC-CMs into preclinical cardiac safety assessment has the potential to revolutionize drug development.

Human-induced pluripotent stem cell-derived cardiomyocytes (hiPSC-CMs) have emerged as a promising in vitro model for drug-induced cardiotoxicity screening and disease modeling. Here, we detail a protocol for measuring the contractility and electrophysiology of hiPSC-CMs.

Technische Anwendungen von Mikroelektrodenarray- und Patch-Clamp-Aufnahmen an humaninduzierten pluripotenten Stammzell-abgeleiteten Kardiomyozyten

Drug-induced cardiotoxicity is the leading cause of drug attrition and withdrawal from the market. Therefore, using appropriate preclinical cardiac safety ...

Medizin

Establishing a Whole-Cell Configuration through the Patch Clamp Method

Source: Segev, A. et al., <a href="https://app-jove-com.bdigitaluss.remotexs.co/v/54024">Whole-cell Patch-clamp Recordings in Brain Slices.</a>&#160;J. Vis. Exp.&#160;(2016)
This video demonstrates the whole-cell patch clamp technique in a mouse brain slice. This technique establishes a stable connection between micropipette and neuron membrane, which is further disrupted to establish a whole-cell configuration to study the neuron&#39;s health and physiological responses.

Etablierung einer Ganzzellkonfiguration durch die Patch-Clamp-Methode

All procedures involving animal models have been reviewed by the local institutional animal care committee and the JoVE veterinary review board.
1. Slice ...