Name: a duplex digital pcr assay for simultaneous quantification of the enterococcus spp. and the human fecal-associated hf183 marker in waters
Uploaded: 2016-03-09T13:00:00.000+00:00
Duration: 12 min 14 s
Description: Watch this Scientific Journal Video about A Duplex Digital PCR Assay for Simultaneous Quantification of the Enterococcus spp. and the Human Fecal-associated HF183 Marker in Waters at JoVE.com

The authors have no acknowledgements.

1. Assay-Mischung Vorbereitung <ol><li> Machen Sie 100 &amp; mgr; mol / L Lager Konzentrationen für alle Primer in UPW Wasser und Sonden in TE pH 8 - Puffer [Entero F1A, Entero R1, GPL813TQ 12; HF183-1, BthetR1, BthetP1 3]. Hinweis: Die Sonden für die beiden Ziele sind fluoreszierend mit unterschiedlichen Fluorophore 7 , wie in Liste der Materialien / Ausrüstung bezeichnet. </li><li> Bereiten Sie Master-Mix durch Mischen, pro Reaktion geplant, 12 ul digitale PCR-Mix (2x Lager, siehe Liste der Materialien / Geräte), 0,216 ul jeder Vorwärts- und Rückwärts-Primer, 0,06 &amp; mgr; l jeder Fluoreszenzsonde und 5,016 ul Nuclease freies Wasser (Endkonzentration : 900 nM von jedem Primer, 250 nM jede Sonde). Pipette nach oben und unten mindestens 10 Mal zu mischen, während Vorsicht nehmen keine Luftblasen in der Lösung einzuführen. </li><li> Pipette 18 ul Master-Mix (aus Schritt 1.2) in eine reguläre PCR-Röhrchen oder Platte, Mischen in 6 ul DNA-Matrize (wie frü extrahiertschlauen 13) Assay - Mischung zur Tropfenerzeugung zu machen. Wenn laufen die Proben im Doppel, pipettieren 36 &amp; mgr; l Master-Mix und 12 &amp; mgr; l DNA-Matrize in jede Vertiefung. Lassen Sie die entsprechenden Wiederholungsvertiefungen auf dem Teller leer. Fügen Sie positive Kontrollen (siehe Liste der Materialien / Ausrüstung) und keine Template - Kontrollen (NTC) (dh mit UPW Wasser als Vorlage verwendet). Anmerkung: Positive Kontrolle ist notwendig, der Test ordnungsgemäß ausgeführt wird, um sicherzustellen, und der NTC ist notwendig, um sicherzustellen, dass keine Kontamination innerhalb der Platte ist und die Fluoreszenzbasislinie einzustellen später in der Datenanalyse. Erstbenutzer sind sowohl unverwässert und verwässert DNA-Proben zu verwenden, empfohlen. </li></ol> 2. Tröpfchenerzeugung und PCR-Platten-Setup <ol><li> Mischen Sie die Testgemische durch Pipettieren von oben nach unten etwa 15-mal mit einer Mehrkanalpipette verwenden. Stellen Sie sicher, dass die Pipettenspitze innerhalb Flüssigkeit bleibt überschüssige Blasen in der Mischung zu vermeiden, zu machen. </li><li> insert Patrone 1 (mit 8 Vertiefungen) in einen weißen Kassettenhalter und klicken Sie auf den Patronenhalter zu. Kartusche 1 ist jetzt fest an seinem Platz und kann nicht aus dem Halter verdrängt werden, während Tröpfchen zu erzeugen. Mit einer Mehrkanal-Pipette, Transfer sanft 20 ul Testmischung in die mittlere Position der Kassette markiert &#39;Sample&#39; ohne Luftblasen einzuführen. </li><li> Pipettieren in 70 &amp; mgr; l Tropfenerzeugung Öl auf die linke Seite der Kassette (markiert &quot;Öl&quot;). </li><li> Abdeckung Patrone mit einer Dichtung dafür, dass die Dichtung eben ist und gleichmäßig durch die 4 gehalten Zecken auf den Rand der Patrone. Drücken Sie die grüne beleuchtete Taste auf dem Tropfengenerator zu öffnen und die Kassette legen. Drücken Sie die grüne beleuchtete Taste erneut, um den Generator zu schließen. Hinweis: Sobald die Tür schließt, wird die Schaltfläche abgeblendet, kann die Tür nicht wieder geöffnet werden und Tropfenerzeugung beginnt sofort für ca. 1 min fortgesetzt. </li><li> Wenn mehr als 8 Reaktionen zu tun, statt Patrone 2 in einer zweitenweiß Patronenhalter und bereiten in der gleichen Weise wie Patrone 1, während die Tröpfchenerzeugung läuft Gesamtaufbauzeit zu sparen. </li><li> Öffnen Sie den Tropfengenerator Tür, wenn das trübe beleuchtete Taste grün leuchtet Abschluss der Tropfenerzeugung angibt. Entfernen Sie die weiße Patronenhalter enthaltende Patrone 1, beiseite stellen und Platz Patrone 2 auf den Tröpfchengenerator. </li><li> Entfernen Sie die Dichtung aus der Patrone 1 und entsorgen. übertragen Sie vorsichtig das Gesamtvolumen (ca. 40 &amp; mgr; l) der erzeugten Tröpfchen aus der dritten Spalte der Patrone (Aufschrift &quot;Droplets &#39;) auf eine endgültige PCR-Platte (bei Raumtemperatur gehalten) für thermische Zyklen. Hinweis: Verwenden Sie nicht die weiße Patronenhalter als Aktion unclick die neu erzeugten Tröpfchen brechen; nur öffnen Sie die Patronenhalterung, nachdem die Tröpfchen auf die endgültige Platte übertragen worden sind. </li><li> Wiederholen Sie die Schritte 2,1-2,7 für zusätzliche Proben. </li><li> Wenn alle Tröpfchen in der letzten PCR-Platte sind, legen Sie eine durchstechbareFolienabdeckung auf der Oberseite der Platte und legen Sie es auf Abklebefolie. Stellen Sie die Versiegelung auf 180 ° C, drücken Sie &quot;Play&quot; auf der Versiegelung und lassen Dichtung für 10 Sekunden. </li></ol> 3. Thermische Radfahren und Droplet Lesen <ol><li> Legen Sie die versiegelte Platte auf dem Thermocycler, ein kompatibel mit dem endgültigen PCR-Platte verwendet in Schritt 2.7 und einer Temperatur Rampengeschwindigkeit von 2,0 ° C / s. </li><li> Thermo Programm starten wie folgt: 10 min bei 95 ° C, gefolgt von 40 Zyklen von 30 Sekunden bei 94 ° C und 60 Sekunden bei 60 ° C, gefolgt von einer 10 min Halten bei 98 ° C (optional: Endverweilzeit bei 4 oder 15 ° C). </li><li> Nach Abschluss des Radsports, übertragen Sie die Platte auf ein Droplet Reader zur automatischen Messung der Fluoreszenz in jedem Tröpfchen in jeder Vertiefung. Alternativ speichern Sie die Platte bei 4 ° C bis zu 3 Tage vor Tröpfchen Lesen. Sicherstellen, dass die Tröpfchen bei Raumtemperatur sind, bevor mit dem Lesen fortfahren. <ol><li> Öffnen Sie die mitgelieferte Software die Tröpfchen Lesen einrichten. Imdie Standard-Menü &quot;Setup&quot; ein Schema einer leeren 96-Well-Platte, klicken Sie doppelt auf gut A1 zu öffnen Sie das Menü mit drei Abschnitte enthält: &quot;Sample&quot;, &quot;Test 1&quot; und &quot;Assay 2.&quot; </li><li> In der &#39;Sample&#39; Abschnitt geben Sie die Proben-ID in das Feld mit der Bezeichnung &quot;Name&quot; und drücken Sie die Eingabetaste oder die Box auf der rechten markiert überprüfen &quot;Übernehmen&quot;. Als nächstes klicken Sie auf das Dropdown-Menü mit der Bezeichnung &#39;Experiment&#39; und geben Sie &#39;RED&#39; (seltene Ereigniserkennung) und klicken Sie wählen. </li><li> Verschieben Sie in dem Abschnitt &#39;bezeichnet Assay 1. &quot; In der &#39;Name&#39; Abschnitt füllen Sie den Test (zB Enterococcus) und drücken Sie die Eingabetaste. In der unten stehenden Tabelle als &#39;Typ&#39; klicken Sie auf das Dropdown-Menü und wählen Sie &quot;Kanal 1 Unknown&quot; und drücken Sie die Eingabetaste. </li><li> Verschieben Sie in dem Abschnitt &#39;bezeichnet Assay 2. &quot; In der &#39;Name&#39; Abschnitt füllen Sie den Test (zB HF183) und drücken Sie die Eingabetaste. In der unten stehenden Tabelle als &#39;Typ&#39; klicken Sie auf das Dropdown-Menü eind &#39;Kanal 2 Unknown &quot;wählen und drücken Sie die Eingabetaste. Alle Informationen aus den Schritten 3.3.2 bis 3.3.4 ist jetzt in gut A1. </li><li> Nennen Sie alle nachfolgenden Vertiefungen, die Tröpfchen. Um insgesamt Rüstzeit speichern, klicken Sie auf &quot;Shift&quot; oder &quot;Strg&quot;, um mehrere Vertiefungen gleichzeitig wählen. </li><li> Wenn die digitale Darstellung der Platte spiegelt die physische Platte, drücken Sie &quot;OK&quot; an der unteren rechten Ecke des Menüs. Im neuen Menü, das an der Oberseite der Platte schematisch, unter der &quot;Vorlage&quot; Abschnitt wählen &quot;Speichern unter&quot; und den Namen und speichern Sie die Platte erscheint. </li><li> Auf der linken Seite des Bildschirms klicken Sie auf &quot;Ausführen&quot; und wählen Sie die entsprechende Farbstoffsatz im Pop-out &quot;Ausführungsoptionen&quot; Fenster. Datenerfassung initiiert und wird in Echtzeit in der Software angezeigt. </li></ol></li></ol> 4. Datenanalyse und Bericht <ol><li> Wenn der Leser beendet ist und ein Feld &quot;Run Schließe&quot; angezeigt, die besagt, klicken Sie auf &quot;OK&quot;. Hinweis: Die weichenware zeigt die letzte Datendatei unter dem Abschnitt der Software &quot;Analysieren&quot;. In dieser Ansicht hat die Software alle Vertiefungen in der Platte ausgewählt und standardmäßig auf das Diagramm &quot;2D-Amplitude&quot;. </li><li> Überprüfen Sie den Abstand zwischen den positiven und negativen Tröpfchen. Stellen Sie sicher, dass die Fluoreszenz in aller Tröpfchen in den NTC-Brunnen in der Nähe von Baseline sind. </li><li> Klicken Sie auf die Schaltfläche mit der Bezeichnung &quot;Events&quot;. pro Vertiefung Auf der rechten Seite des dargestellten Histogramm auf das Feld namens &#39;Total&#39; und die Box namens &quot;Single&quot; am unteren Rand die Gesamtzahl der akzeptierten Tröpfchen anzuzeigen. Schließen Sie alle Vertiefungen , die &lt;10.000 Tröpfchen 7 indem Sie die Strg - Taste gedrückt halten und auf die auch (s) ausgeschlossen werden. </li><li> Klicken Sie auf die Schaltfläche bezeichnet als &quot;1D Amplitude&quot; bei etwa einer Standardabweichung der Fluoreszenzschwelle einzustellen (500-700 Fluoreszenzeinheiten) über die negativen Tröpfchen in NTC Brunnen für beide Ziele. Ganz am linken Bildschirmrand under die &quot;Auto Analysieren &#39;zeigt zwei Schwellen Tasten, wählen Sie das Symbol auf der rechten Seite, die eine solide rosa horizontale Linie durchzogen. </li><li> Klicken Sie in das Feld auf der linken Seite &#39;Set Threshold&#39; unter jedem der Amplitudendiagramme und geben Sie die entsprechenden Fluoreszenzschwellenwerten. Die Zielkonzentrationen in Kopie pro ul Reaktion werden dann automatisch berechnet. Anmerkung: Die Schwellen müssen nicht für die unterschiedlichen Ziele identisch. </li><li> Exportieren Sie die Ergebnisse in einer CSV-Datei, indem Sie den &quot;Export&quot; Button in der linken oberen Ecke einen Klick auf den 1D-Amplitude-Bildschirm. In der CSV - Datei, multiplizieren Sie die exportierte Zielkonzentration von 4 es von Target (23S - Gen von Enterococcus spp. Oder der HF183 Marker) von Kopie zu konvertieren pro ul Reaktion von Ziel pro ul DNA - Vorlage zu kopieren. </li></ol>

<ol>
	<li>Boehm, A. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Performance+of+forty-one+microbial+source+tracking+methods:+A+twenty-seven+lab+evaluation+study.">Performance of forty-one microbial source tracking methods: A twenty-seven lab evaluation study.</a> Water Res. 47 (18), 6812-6828 (2013).</li><li>Layton, B. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Performance+of+human+fecal+anaerobe-associated+PCR-based+assays+in+a+multi-laboratory+method+evaluation+study.">Performance of human fecal anaerobe-associated PCR-based assays in a multi-laboratory method evaluation study.</a> Water Res. 47 (18), 6897-6908 (2013).</li><li>Cao, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effect+of+platform,+reference+material,+and+quantification+model+on+enumeration+of+Enterococcus+by+quantitative+PCR+methods.">Effect of platform, reference material, and quantification model on enumeration of Enterococcus by quantitative PCR methods.</a> Water Res. 47 (1), 233-241 (2013).</li><li>Sivaganesan, M., Siefring, S., Varma, M., Haugland, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MPN+estimation+of+qPCR+target+sequence+recoveries+from+whole+cell+calibrator+samples.">MPN estimation of qPCR target sequence recoveries from whole cell calibrator samples.</a> J. Microbiol. Methods. 87 (3), 343-349 (2011).</li><li>Huggett, J. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Digital+MIQE+Guidelines:+Minimum+Information+for+Publication+of+Quantitative+Digital+PCR+Experiments.">The Digital MIQE Guidelines: Minimum Information for Publication of Quantitative Digital PCR Experiments.</a> Clin. Chem. 59 (6), 892-902 (2013).</li><li>Cao, Y., Raith, M. R., Griffith, J. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Droplet+digital+PCR+for+simultaneous+quantification+of+general+and+human-associated+fecal+indicators+for+water+quality+assessment.">Droplet digital PCR for simultaneous quantification of general and human-associated fecal indicators for water quality assessment.</a> Water Res. 70, 337-349 (2015).</li><li>Sanders, R., Huggett, J. F., Bushell, C. A., Cowen, S., Scott, D. J., Foy, C. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evaluation+of+Digital+PCR+for+Absolute+DNA+Quantification.">Evaluation of Digital PCR for Absolute DNA Quantification.</a> Anal. Chem. 83 (17), 6474-6484 (2011).</li><li>Whale, A. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparison+of+microfluidic+digital+PCR+and+conventional+quantitative+PCR+for+measuring+copy+number+variation.">Comparison of microfluidic digital PCR and conventional quantitative PCR for measuring copy number variation.</a> Nucleic Acid Res. 40 (11), 82-89 (2012).</li><li>Hindson, C. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Absolute+quantification+by+droplet+digital+PCR+versus+analog+real-time+PCR.">Absolute quantification by droplet digital PCR versus analog real-time PCR.</a> Nature Methods. 10 (10), 1003-1005 (2013).</li><li>Morisset, D., &#352;tebih, D., Milavec, M., Gruden, K., &#381;el, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+analysis+of+food+and+feed+aamples+with+droplet+digital+PCR.">Quantitative analysis of food and feed aamples with droplet digital PCR.</a> PLoS One. 8 (5), e62583 (2013).</li><li>Cao, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evaluation+of+molecular+community+analysis+methods+for+discerning+fecal+sources+and+human+waste.">Evaluation of molecular community analysis methods for discerning fecal sources and human waste.</a> Water Res. 47 (18), 6862-6872 (2013).</li></ol>

The authors declare that they have no competing financial interests.

Es gibt einige wichtige Schritte in dem Protokoll. Erstens kann der Testgemische Mischen schwierig sein, da der Master-Mix mehr viskos ist als herkömmliche qPCR Master Mixes. Einfache Vortexen kann zu einer unzureichenden Durchmischung führen, was wiederum zu einer ungleichmäßigen Verteilung von DNA-Matrizen in den Testgemischen und anschließend in den Tröpfchen. Die Misch-by-Pipettiertechnik in dem beschriebenen Protokoll müssen befolgt werden, um genaue dPCR Quantifizierung zu gewährleisten. Zweitens ist es wi...

Quantitative PCR (qPCR) Verfahren wurden für die Freizeit-Überwachung der Wasserqualität und mikrobiellen Quelle Tracking-Anwendungen weit verbreitet, weil sie schneller sind, flexibler und spezifischer im Vergleich zu traditionellen Kultur-basierten Methoden. Folglich wird qPCR für die Erzielung eines raschen Wasserüberwachungsergebnisse für die allgemeine fäkale Indikatoren wie Enterococcus spp empfohlen. In den überarbeiteten USEPA Erholungswasserqualitätskriterien 1. Viele qPCR - Assays wurden auch zur Identifizierung von Quellen von fäkale Verunreinigungen in Umwelt Gewässer 2 entwickelt und validiert. Unter diesen sind die HF183 Marker - Assays unter den am häufigsten verwendeten zur Identifizierung von Menschen assoziiert fäkale Verunreinigung 3. Jedoch kann qPCR Ergebnisse oft vorgespannt werden, da sie auf Standardkurven für die Quantifizierung verlassen. qPCR quantifiziert unbekannten Konzentrationen von Ziel in Proben, die durch ihre Quantifizierung Zyklus Interpolation (CQ) von einem standard Kurve, die eine lineare Beziehung zwischen Cq und logarithmische Menge einer Gruppe von seriell verdünnten Standards beschrieben. Der Mangel an zuverlässigen und konsistenten Standardreferenzmaterial kann daher vorspannen stark qPCR Ergebnisse. Studien zeigten , dass qPCR Ergebnisse um etwa die Hälfte ein Protokoll unter Verwendung von Standards von verschiedenen Anbietern unterschiedlich 4 und durch 2-fach verschiedenen Chargen von Standards vom gleichen Hersteller 5 verwenden. Digital PCR (dPCR) -Technologie quantifiziert eine unbekannte Probe durch die Frequenz von Positiven in eine große Anzahl von Miniatur - PCRs zählen , die 6 durch Partitionieren eines bulk qPCR in Tausende oder Millionen von gleichförmigen Nanoliter oder Pikoliter - Reaktionen erzeugt werden. Es wird als Tröpfchen digital PCR (dh in diesem Artikel) oder Kammer digitalen PCR jeweils bezeichnet, wenn die Trennwände Wasser-in-Öl - Tröpfchen (dh in diesem Artikel) oder kleine Kammern auf einem Chip sind. Eine höhere Probenkonzentration wird in Anwesenheit von Ziel-DNA führen(Daher positive PCR) in einem höheren Anteil von Trennwänden, eine Beziehung, die durch Poisson-Verteilung angenähert. Als solche sind die binären Ergebnisse (positive oder negative PCR) erfasst und die Frequenz der positiven Tröpfchen verwendet wird unbekannten Probenkonzentrationen direkt über Poisson Approximation zu berechnen, wodurch die Notwendigkeit für eine Standardkurve wie in qPCR eliminieren. Diese binäre Art der digitalen PCR Quantifizierung bietet zusätzliche Vorteile gegenüber qPCR 7. Da verzögerte Verstärkung noch eine positive PCR ergeben können, ist dPCR Quantifizierung robuster gegenüber Hemmung, die Verstärkungseffizienz verringert. In ähnlicher Weise wird dPCR Quantifizierung nicht durch Variabilität in Cq - Werte betroffen wie qPCR ist, zu einer höheren Genauigkeit der dPCR führt im Vergleich zu qPCR 8-10. Darüber hinaus gewährleistet das Unterteilungsprozesses eine sehr kleine Menge an Ziel-DNA in jedem Tröpfchen, Substrat Wettbewerb effektiv minimiert wird (während amplification der verschiedenen DNA - Targets), die gemeinsame Hindernisse für Duplex- zu erreichen (dh ein Test misst gleichzeitig zwei DNA - Targets) in qPCR. Als solches ob Lauf im Duplex- oder Simplex (dh ein Ziel in einem einzigen Assay gemessen wird) dPCR produziert fast nicht zu unterscheiden Quantifizierung beider Ziele 7,11. Das Ziel des digitalen PCR - Assay (EntHF183 dPCR) in diesem Artikel beschriebene gleichzeitige direkte Quantifizierung der allgemeinen fäkale Indikator Enterococcus spp zu erhalten. Und die human-fäkale assoziiert HF183 Marker mit verbesserter Genauigkeit, Reproduzierbarkeit und Robustheit gegenüber Hemmung im Vergleich zu seiner qPCR Pendants. Dieser Assay wurde zur Quantifizierung der fäkalen Kontamination in Umwelt Süßwasser, Meerwasser, und verschiedene Fäkalmaterial 7, kann aber auch angewendet werden auf andere Arten von Gewässern und Abwässern eingesetzt. Dieser Test ist sehr vielversprechend für Sedimente oder Böden aufgrund seiner Analyses eine hohe Toleranz gegenüber der Hemmung, aber weitere Tests wegen Komplexitäten erforderlich Inhibitor in diesen Arten von Proben vermischt.

<table><tbody><tr><td>Low Bind Microtubes</td><td>Costar</td><td>3207</td><td>For storage of reagents, samples/production of master mixes</td></tr><tr><td>Nuclease Free Water</td><td>FisherSci</td><td>BP2484-50</td><td></td></tr><tr><td>TE pH 8 buffer</td><td>FisherSci</td><td>BP2473-100</td><td></td></tr><tr><td>Hardshell 96 Well Plate</td><td>BioRad</td><td>HSP-9601</td><td>For initial master mix and sample inoculation</td></tr><tr><td>Aluminum Sealing Film</td><td>BioRad</td><td>359-0133</td><td>To seal sample plate</td></tr><tr><td>Droplet Generator</td><td>BioRad</td><td>186-3002</td><td></td></tr><tr><td>Droplet Generation Oil</td><td>BioRad</td><td>186-3005</td><td></td></tr><tr><td>Cartridge</td><td>BioRad</td><td>186-4008</td><td></td></tr><tr><td>DG8 Cartridge Holder</td><td>BioRad</td><td>186-3051</td><td></td></tr><tr><td>Gasket</td><td>BioRad</td><td>186-3009</td><td></td></tr><tr><td>20 &amp;#956;l pipet tips</td><td>Rainin</td><td>GP-L10F</td><td>For tansferring sample/master mix to cartidge</td></tr><tr><td>200 &amp;#956;l pipet tips</td><td>Rainin</td><td>GP-L200F</td><td>For transferring droplets to final Twin.Tec Plate</td></tr><tr><td>Twin.Tec 96 Well Plate</td><td>Eppendorf</td><td>951020320</td><td>For final droplets thermal cycling and reading</td></tr><tr><td>Pierceable Heat Seal Foil</td><td>BioRad</td><td>181-4040</td><td>To seal Twin.Tec plate before thermalcycling</td></tr><tr><td>PX1 PCR Plate Sealer</td><td>BioRad</td><td>181-4000</td><td></td></tr><tr><td>CFX96 Thermalcycler</td><td>BioRad</td><td>CFX96 and C1000</td><td>Only the thermal cycler is needed, no optics</td></tr><tr><td>QX100 Droplet Reader</td><td>BioRad</td><td>186-3001</td><td></td></tr><tr><td>Droplet Reader Oil</td><td>BioRad</td><td>186-3004</td><td></td></tr><tr><td>Droplet PCR Supermix&amp;nbsp;</td><td>BioRad</td><td>186-3024</td><td>&lt;em&gt;i.e.&lt;/em&gt; the digital PCR mix in manuscript</td></tr><tr><td>QuantaSoft software (v1.3.2)</td><td>Quantasoft&amp;nbsp;</td><td>QX100&amp;nbsp;</td><td>For viewing, analyzing, and exporting ddPCR data</td></tr><tr><td>Entero Forward Primer (Ent F1A)</td><td>Operon</td><td>GAGAAATTCCAAACGAACTTG</td><td>Alternative vendor can be used</td></tr><tr><td>Entero Reverse Primer (Ent R1)</td><td>Operon</td><td>CAGTGCTCTACCTCCATCATT</td><td>Alternative vendor can be used</td></tr><tr><td>Entero Probe (GPL813TQ)</td><td>Operon</td><td>[6-FAM]-TGG TTC TCT CCG AAA TAG CTT TAG GGC TA-[BHQ1]</td><td>Alternative vendor can be used, but the florophore has to be FAM</td></tr><tr><td>HF183 Forward Primer (HF183-1)</td><td>Operon</td><td>ATCATGAGTTCACATGTCCG</td><td>Alternative vendor can be used</td></tr><tr><td>HF183 Reverse Primer (BthetR1)</td><td>Operon</td><td>CGTAGGAGTTTGGACCGTGT</td><td>Alternative vendor can be used</td></tr><tr><td>HF183 Probe (BthetP1)</td><td>Operon</td><td>[6-HEX]-CTGAGAGGAAGGTCCCCC&lt;br/&gt; ACATTGGA-[BHQ1]</td><td>Alternative vendor can be used, but the florophore has to be HEX (if using VIC, then the appropriate matric compensation must be chosen.&amp;nbsp;</td></tr><tr><td>Positive control</td><td></td><td></td><td>Mixture of &lt;em&gt;E. faecalis&lt;/em&gt; genomic DNA and HF183 standard plasmid (ordered from IDT). For detailed methods in culturing &lt;em&gt;E. faecalis&lt;/em&gt; and sequences of the ordered HF183 plasmid, please see Cao &lt;em&gt;et al.&lt;/em&gt; 2015 (doi:10.1016/j.watres.2014.12.008). Commercilaly available &lt;em&gt;Enterococcus&lt;/em&gt; DNA standards (ATCC 29212Q-FZ) can also be used in the positive control in place of lab-prepared &lt;em&gt;E. faecalis&lt;/em&gt; genomic DNA.</td></tr></tbody></table>

a duplex digital pcr assay for simultaneous quantification of the enterococcus spp. and the human fecal-associated hf183 marker in waters

Dieses Manuskript beschreibt eine Duplex - Digital - PCR - Assays (EntHF183 dPCR) für die simultane Quantifizierung von Enterococcus spp. Und dem menschlichen HF183 Marker fäkal-assoziiert. Die EntHF183 Duplex dPCR (bezeichnet als EntHF183 dPCR hereon) Test verwendet die gleichen Primer und Sonden-Sequenzen wie die veröffentlichten Einzel quantitative PCR (qPCR) Pendants. Ebenso wie die gleichen Wasserfiltration und DNA-Extraktionsverfahren vor der qPCR durchgeführt werden, bevor anschließend dPCR zu laufen. Jedoch hat der duplex dPCR Assay mehrere Vorteile gegenüber den qPCR-Assays. Am wichtigsten ist, beseitigt die dPCR Assay die Notwendigkeit für eine Standardkurve ausgeführt wird und somit die zugeordnete Bias und Variabilität, durch direkte Quantifizierung ihrer Ziele. Darüber hinaus, während Duplexing (dh simultane Quantifizierung) Enterococcus und HF183 in qPCR führt oft zu schweren Unterschätzung der weniger reichlich Ziel in einer Probe stellt dPCR konsistente Quantifizierung beider Ziele, wetzensie einzeln oder gleichzeitig in dem gleichen Reaktions quantifiziert. Der dPCR Assay ist auch in der Lage PCR Inhibitorkonzentrationen zu tolerieren, 1.59 Grßenordnungen höher sind als diejenigen, die durch qPCR toleriert. Diese Vorteile machen die EntHF183 dPCR Test besonders attraktiv, weil es bietet gleichzeitig präzise und wiederholbare Informationen über allgemeine und Mensch-assoziierte fäkale Verunreinigungen in Umwelt Gewässern ohne die Notwendigkeit zwei getrennte qPCR-Assays auszuführen. Trotz seiner Vorteile gegenüber qPCR, wobei der obere Bestimmungsgrenze des dPCR Assay mit derzeit verfügbaren Instrumentierung ist ungefähr vier Größenordnungen niedriger als die erzielbaren qPCR. Folglich wird Verdünnung für die Messung hoher Konzentrationen von Zielorganismen erforderlich, wie sie typischerweise folgende Abwasser Verschüttungen beobachtet.

Eine gute EntHF183 duplex dPCR Lauf in relativ hohe Anzahl von akzeptierten Tröpfchen (ca. 10,000-17,000) und relativ große Differenz (ca. 5000) zwischen Fluoreszenzwerte für negative und positive Tröpfchen 7 führen. Ungewöhnlich niedrige Anzahl von Tröpfchen gibt wahrscheinlich Probleme in der Tröpfchenerzeugungsprozess und einen Cutoff von 10.000 Tröpfchen basiert auf empirischen Daten aus dem Tröpfchen dPCR System in diesem Artikel verwendeten vo...

Watch this Scientific Journal Video about A Duplex Digital PCR Assay for Simultaneous Quantification of the Enterococcus spp. and the Human Fecal-associated HF183 Marker in Waters at JoVE.com

A Duplex Digital PCR Assay for Simultaneous Quantification of the Enterococcus spp. and the Human Fecal-associated HF183 Marker in Waters

Diese Handschrift beschreibt eine Duplex digitalen PCR Assay , die gleichzeitig verwendet werden können , um Enterococcus spp quantifizieren. Und die HF183 genetischen Markern als Indikatoren für allgemeine und menschlichen assoziiertes fäkale Verunreinigung in Erholungsgewässern.

Eine Duplex-Digital-PCR-Assay für Simultaneous Quantifizierung der<em&gt; Enterococcus spp.</em&gt; Und das menschliche Fecal-assoziierte HF183 Marker in Waters

This manuscript describes a duplex digital PCR assay (EntHF183 dPCR) for simultaneous quantification of Enterococcus spp. and the human fecal-associated ...

a-duplex-digital-pcr-assay-for-simultaneous-quantification

Universidad San Sebastian

Research

JoVE Journal

Environment

A Duplex Digital PCR Assay for Simultaneous Quantification of the Enterococcus spp. and the Human Fecal-associated HF183 Marker in Waters

9.7K Aufrufe.  Southern California Costal Water Research Project Authority.  Diese Handschrift beschreibt eine Duplex digitalen PCR Assay , die gleichzeitig verwendet werden können , um Enterococcus spp quantifizieren. Und die HF183 genetischen Markern als Indikatoren für allgemeine und menschlichen assoziiertes fäkale Verunreinigung in Erholungsgewässern. 

Serie: A Duplex Digital PCR Assay for Simultaneous Quantification of the Enterococcus spp. and the Human Fecal-associated HF183 Marker in Waters

EPA Method 1615. Measurement of Enterovirus and Norovirus Occurrence in Water by Culture and RT-qPCR. Part III. Virus Detection by RT-qPCR

EPA Method 1615 measures enteroviruses and noroviruses present in environmental and drinking waters. This method was developed with the goal of having a standardized method for use in multiple analytical laboratories during monitoring period 3 of the Unregulated Contaminant Monitoring Rule. Herein we present the protocol for extraction of viral ribonucleic acid (RNA) from water sample concentrates and for quantitatively measuring enterovirus and norovirus concentrations using reverse transcription-quantitative PCR (RT-qPCR). Virus concentrations for the molecular assay are calculated in terms of genomic copies of viral RNA per liter based upon a standard curve. The method uses a number of quality controls to increase data quality and to reduce interlaboratory and intralaboratory variation. The method has been evaluated by examining virus recovery from ground and reagent grade waters seeded with poliovirus type 3 and murine norovirus as a surrogate for human noroviruses. Mean poliovirus recoveries were 20% in groundwaters and 44% in reagent grade water. Mean murine norovirus recoveries with the RT-qPCR assay were 30% in groundwaters and 4% in reagent grade water.

Here we present a procedure to quantify enterovirus and norovirus in environmental and drinking waters using reverse transcription-quantitative PCR. Mean virus recovery from groundwater with this standardized procedure from EPA Method 1615 was 20% for poliovirus and 30% for murine norovirus.

EPA-Methode 1615 Messung der Enterovirus und Norovirus Vorkommen in Wasser, Kultur und RT-qPCR. Teil III. Virenerkennung durch RT-qPCR

EPA Method 1615 measures enteroviruses and noroviruses present in environmental and drinking waters. This method was developed with the goal of having a ...

Forschung

Umwelt

Cost-effective Method for Microbial Source Tracking Using Specific Human and Animal Viruses

Microbial contamination of the environment represents a significant health risk. Classical bacterial fecal indicators have shown to have significant limitations, viruses are more resistant to many inactivation processes and standard fecal indicators do not inform on the source of contamination. The development of cost-effective methods for the concentration of viruses from water and molecular assays facilitates the applicability of viruses as indicators of fecal contamination and as microbial source tracking (MST) tools. Adenoviruses and polyomaviruses are DNA viruses infecting specific vertebrate species including humans and are persistently excreted in feces and/or urine in all geographical areas studied. In previous studies, we suggested the quantification of human adenoviruses (HAdV) and JC polyomaviruses (JCPyV) by quantitative PCR (qPCR) as an index of human fecal contamination. Recently, we have developed qPCR assays for the specific quantification of porcine adenoviruses (PAdV) and bovine polyomaviruses (BPyV) as animal fecal markers of contamination with sensitivities of 1-10 genome copies per test tube. In this study, we present the procedure to be followed to identify the source of contamination in water samples using these tools. As example of representative results, analysis of viruses in ground water presenting high levels of nitrates is shown.
Detection of viruses in low or moderately polluted waters requires the concentration of the viruses from at least several liters of water into a much smaller volume, a procedure that usually includes two concentration steps in series. This somewhat cumbersome procedure and the variability observed in viral recoveries significantly hamper the simultaneous processing of a large number of water samples.
In order to eliminate the bottleneck caused by the two-step procedures we have applied a one-step protocol developed in previous studies and applicable to a diversity of water matrices. The procedure includes: acidification of ten-liter water samples, flocculation by skimmed milk, gravity sedimentation of the flocculated materials, collection of the precipitate and centrifugation, resuspension of the precipitate in 10 ml phosphate buffer. The viral concentrate is used for the extraction of viral nucleic acids and the specific adenoviruses and polyomaviruses of interest are quantified by qPCR. High number of samples may be simultaneously analyzed using this low-cost concentration method.
The procedure has been applied to the analysis of bathing waters, seawater and river water and in this study, we present results analyzing groundwater samples. This high-throughput quantitative method is reliable, straightforward, and cost-effective.

The study describes a cost-effective method for the identification of the source of fecal/urine contamination or contamination by nitrates in water using qPCR for the specific quantification of human/porcine/bovine DNA viruses, adenoviruses and polyomaviruses, proposed as MST tools.

Kostengünstige Methode für Mikrobielle Source Tracking mit spezifischen menschlichen und tierischen Viren

Microbial contamination of the environment represents a significant health risk. Classical bacterial fecal indicators have shown to have significant ...

Immunologie und Infektion

Multiplex Detection of Bacteria in Complex Clinical and Environmental Samples using Oligonucleotide-coupled Fluorescent Microspheres

Bacterial vaginosis (BV) is a recurring polymicrobial syndrome that is characterized by a change in the "normal" microbiota from Lactobacillus-dominated to a microbiota dominated by a number of bacterial species, including Gardnerella vaginalis, Atopobium vaginae, and others1-3. This condition is associated with a range of negative health outcomes, including HIV acquisition4, and it can be difficult to manage clinically5. Furthermore, diagnosis of BV has relied on the use of Gram stains of vaginal swab smears that are scored on various numerical criteria6,7. While this diagnostic is simple, inexpensive, and well suited to resource-limited settings, it can suffer from problems related to subjective interpretations and it does not give a detailed profile of the composition of the vaginal microbiota8. Recent deep sequencing efforts have revealed a rich, diverse vaginal microbiota with clear differences between samples taken from individuals that are diagnosed with BV compared to those individuals that are considered normal9,10, which has resulted in the identification of a number of potential targets for molecular diagnosis of BV11,12. These studies have provided a wealth of useful information, but deep sequencing is not yet practical as a diagnostic method in a clinical setting. We have recently described a method for rapidly profiling the vaginal microbiota in a multiplex format using oligonucleotide-coupled fluorescent beads with detection on a Luminex platform13. This method, like current Gram stain-based methods, is rapid and simple but adds the additional advantage of exploiting molecular knowledge arising from sequencing studies in probe design. This method therefore provides a way to profile the major microorganisms that are present in a vaginal swab that can be used to diagnose BV with high specificity and sensitivity compared to Gram stain while providing additional information on species presence and abundance in a semi-quantitative and rapid manner. This multiplex method is expandable well beyond the range of current quantitative PCR assays for particular organisms, which is currently limited to 5 or 6 different assays in a single sample14. Importantly, the method is not limited to the detection of bacteria in vaginal swabs and can be easily adapted to rapidly profile nearly any microbial community of interest. For example, we have recently begun to apply this methodology to the development of diagnostic tools for use in wastewater treatment plants.

We describe a multiplex method for the detection of microorganisms within a sample using oligonucleotide-coupled fluorescent beads. Amplicon from all organisms within a sample is hybridized to a panel of probe-coupled beads. A Luminex or Bio-Plex instrument is used to query each bead for bead type and hybridization signal.

Multiplex Nachweis von Bakterien in komplexen Clinical and Environmental Proben mit Oligonukleotid-gekoppelten Fluoreszenz-Mikrosphären

Bacterial vaginosis (BV) is a recurring polymicrobial syndrome that is characterized by a change in the "normal" microbiota from Lactobacillus-dominated ...

Single Droplet Digital Polymerase Chain Reaction for Comprehensive and Simultaneous Detection of Mutations in Hotspot Regions

Droplet digital polymerase chain reaction (ddPCR) is a highly sensitive quantitative polymerase chain reaction (PCR) method based on sample fractionation into thousands of nano-sized water-in-oil individual reactions. Recently, ddPCR has become one of the most accurate and sensitive tools for circulating tumor DNA (ctDNA) detection. One of the major limitations of the standard ddPCR technique is the restricted number of mutations that can be screened per reaction, as specific hydrolysis probes recognizing each possible allelic version are required. An alternative methodology, the drop-off ddPCR, increases throughput, since it requires only a single pair of probes to detect and quantify potentially all genetic alterations in the targeted region. Drop-off ddPCR displays comparable sensitivity to conventional ddPCR assays with the advantage of detecting a greater number of mutations in a single reaction. It is cost-effective, conserves precious sample material, and can also be used as a discovery tool when mutations are not known a priori.

Here, we present a protocol to accurately quantify multiple genetic alterations of a target region in a single reaction using drop-off ddPCR and a unique pair of hydrolysis probes.

Einzelne Tropfen digitale Polymerase-Kettenreaktion für umfassende und gleichzeitigen Nachweis von Mutationen im Hotspot-Regionen

Droplet digital polymerase chain reaction (ddPCR) is a highly sensitive quantitative polymerase chain reaction (PCR) method based on sample fractionation ...

Genetik

A Modified EPA Method 1623 that Uses Tangential Flow Hollow-fiber Ultrafiltration and Heat Dissociation Steps to Detect Waterborne Cryptosporidium and Giardia spp.

Cryptosporidium and Giardia species are two of the most prevalent protozoa that cause waterborne diarrheal disease outbreaks worldwide. To better characterize the prevalence of these pathogens, EPA Method 1623 was developed and used to monitor levels of these organisms in US drinking water supplies 12. The method has three main parts; the first is the sample concentration in which at least 10 L of raw surface water is filtered. The organisms and trapped debris are then eluted from the filter and centrifuged to further concentrate the sample. The second part of the method uses an immunomagnetic separation procedure where the concentrated water sample is applied to immunomagnetic beads that specifically bind to the Cryptosporidium oocysts and Giardia cysts allowing for specific removal of the parasites from the concentrated debris. These (oo)cysts are then detached from the magnetic beads by an acid dissociation procedure. The final part of the method is the immunofluorescence staining and enumeration where (oo)cysts are applied to a slide, stained, and enumerated by microscopy.
Method 1623 has four listed sample concentration systems to capture Cryptosporidium oocysts and Giardia cysts in water: Envirochek filters (Pall Corporation, Ann Arbor, MI), Envirochek HV filters (Pall Corporation), Filta-Max filters (IDEXX, Westbrook, MA), or Continuous Flow Centrifugation (Haemonetics, Braintree, MA). However, Cryptosporidium and Giardia (oo)cyst recoveries have varied greatly depending on the source water matrix and filters used1,14. A new tangential flow hollow-fiber ultrafiltration (HFUF) system has recently been shown to be more efficient and more robust at recovering Cryptosporidium oocysts and Giardia cysts from various water matrices; moreover, it is less expensive than other capsule filter options and can concentrate multiple pathogens simultaneously1-3,5-8,10,11. In addition, previous studies by Hill and colleagues demonstrated that the HFUF significantly improved Cryptosporidium oocysts recoveries when directly compared with the Envirochek HV filters4. Additional modifications to the current methods have also been reported to improve method performance. Replacing the acid dissociation procedure with heat dissociation was shown to be more effective at separating Cryptosporidium from the magnetic beads in some matrices9,13 .
This protocol describes a modified Method 1623 that uses the new HFUF filtration system with the heat dissociation step. The use of HFUF with this modified Method is a less expensive alternative to current EPA Method 1623 filtration options and provides more flexibility by allowing the concentration of multiple organisms.

A Modified EPA Method 1623 that Uses Tangential Flow Hollow-fiber Ultrafiltration and Heat Dissociation Steps to Detect Waterborne Cryptosporidium and Giardia spp.

This protocol describes the use of a tangential flow hollow-fiber ultrafiltration sample concentration system and a heat dissociation as alternative steps for the detection of waterborne Cryptosporidium and Giardia species using EPA Method 1623.

Eine Änderung, die EPA-Methode 1623 Tangential Flow Hohlfaser-Ultrafiltration und Wärme Dissoziationsstufen nutzt, um auf Wasserbasis Detect<em&gt; Cryptosporidium</em&gt; Und<em&gt; Giardia spp.</em

Cryptosporidium and Giardia species are two of the most prevalent protozoa that cause waterborne diarrheal disease outbreaks worldwide. To better ...

Capture of Environmental DNA (eDNA) from Water Samples by Flocculation

The analysis of environmental DNA (eDNA) has become a widely used approach to problem solving in species management. The detection of cryptic species including invasive and (or) species at risk is the goal, typically accomplished by testing water and sediment for the presence of characteristic DNA signatures. Reliable and efficient procedures for the capture of eDNA are required, especially those that can be performed easily in the field by personnel with limited training and citizen scientists. The capture of eDNA using membrane filtration is widely used currently. This approach has inherent issues that include the choice of filter material and porosity, filter fouling, and time required on site for the process to be performed. Flocculation offers an alternative that can be easily implemented and applied to sampling regimes that strive to cover broad territories in limited time.

Capture of Environmental DNA eDNA from Water Samples by Flocculation

Environmental DNA (eDNA) is typically captured from water samples using alcohol precipitation, filtration, or flocculation. Presented here is an alternative protocol that uses lanthanum chloride to enable collection of dissolved and particulate-bound nucleic acids from water samples containing eukaryotic cells, prokaryotic cells, and virus.

The analysis of environmental DNA (eDNA) has become a widely used approach to problem solving in species management. The detection of cryptic species ...

Development and Testing of Species-specific Quantitative PCR Assays for Environmental DNA Applications

New, non-invasive methods for detecting and monitoring species presence are being developed to aid in fisheries and wildlife conservation management. The use of environmental DNA (eDNA) samples for detecting macrobiota is one such group of methods that is rapidly becoming popular and being implemented in national management programs. Here we focus on the development of species-specific targeted assays for probe-based quantitative PCR (qPCR) applications. Using probe-based qPCR offers greater specificity than is possible with primers alone. Furthermore, the ability to quantify the amount of DNA in a sample can be useful in our understanding of the ecology of eDNA and the interpretation of eDNA detection patterns in the field. Careful consideration is needed in the development and testing of these assays to ensure the sensitivity and specificity of detecting the target species from an environmental sample. In this protocol we will delineate the steps needed to design and test probe-based assays for the detection of a target species; including creation of sequence databases, assay design, assay selection and optimization, testing assay performance, and field validation. Following these steps will help achieve an efficient, sensitive, and specific assay that can be used with confidence. We demonstrate this process with our assay designed for populations of the mucket (Actinonaias ligamentina), a freshwater mussel species found in the Clinch River, USA.

Environmental DNA assays require rigorous design, testing, optimization and validation before the collection of field data can begin. Here, we present a protocol to take users through each step of designing a species-specific, probe-based qPCR assay for the detection and quantification of a target species DNA from environmental samples.

Entwicklung und Prüfung artspezifischer quantitativer PCR-Assays für Umwelt-DNA-Anwendungen

New, non-invasive methods for detecting and monitoring species presence are being developed to aid in fisheries and wildlife conservation management. The ...

Foodborne Pathogen Screening Using Magneto-fluorescent Nanosensor: Rapid Detection of E. Coli O157:H7

Enterohemorrhagic Escherichia coli O157:H7 has been linked to both waterborne and foodborne illnesses, and remains a threat despite the food- and water-screening methods used currently. While conventional bacterial detection methods, such as polymerase chain reaction (PCR) and enzyme-linked immunosorbent assays (ELISA) can specifically detect pathogenic contaminants, they require extensive sample preparation and lengthy waiting periods. In addition, these practices demand sophisticated laboratory instruments and settings, and must be executed by trained professionals. Herein, a protocol is proposed for a simpler diagnostic technique that features the unique combination of magnetic and fluorescent parameters in a nanoparticle-based platform. The proposed multiparametric magneto-fluorescent nanosensors (MFnS) can detect E. coli O157:H7 contamination with as little as 1 colony-forming unit present in solution within less than 1 h. Furthermore, the ability of MFnS to remain highly functional in complex media such as milk and lake water has been verified. Additional specificity assays were also used to demonstrate the ability of MFnS to only detect the specific target bacteria, even in the presence of similar bacterial species. The pairing of magnetic and fluorescent modalities allows for the detection and quantification of pathogen contamination in a wide range of concentrations, exhibiting its high performance in both early- and late-stage contamination detection. The effectiveness, affordability, and portability of the MFnS make them an ideal candidate for point-of-care screening for bacterial contaminants in a wide range of settings, from aquatic reservoirs to commercially packaged foods.

Foodborne Pathogen Screening Using Magneto-fluorescent Nanosensor: Rapid Detection of E. Coli O157:H7

The overall goal of this protocol is to synthesize functional nanosensors for the portable, cost-effective, and rapid detection of specifically targeted pathogenic bacteria through a combination of magnetic relaxation and fluorescence emission modalities.

Foodborne Krankheitserreger Screening mit Magneto-fluoreszierende Nanosensor: Schnellnachweis von E. Coli O157: H7

Enterohemorrhagic Escherichia coli O157:H7 has been linked to both waterborne and foodborne illnesses, and remains a threat despite the food- and ...

Amplification of Escherichia coli in a Continuous-Flow-PCR Microfluidic Chip and Its Detection with a Capillary Electrophoresis System

Polymerase chain reaction (PCR) is a traditional method employed for the amplification of a target gene that has played an important role in biomolecular diagnostics. However, traditional PCR is very time-consuming because of the low-temperature variation efficiency. This work proposes a continuous-flow-PCR (CF-PCR) system based on a microfluidic chip. The amplification time can be greatly reduced by running the PCR solution into a microchannel placed on heaters set at different temperatures. Moreover, as capillary electrophoresis (CE) is an ideal way to differentiate positive and false-positive PCR products, a CE system was built to achieve efficient separation of the DNA fragments. This paper describes the process of amplification of Escherichia coli (E. coli) by the CF-PCR system built in-house and the detection of the PCR products by CE. The results demonstrate that the target gene of E. coli was successfully amplified within 10 min, indicating that these two systems can be used for the rapid amplification and detection of nucleic acids.

Amplification of Escherichia coli in a Continuous-Flow-PCR Microfluidic Chip and Its Detection with a Capillary Electrophoresis System

This protocol describes how to build a continuous-flow-polymerase chain system based on a microfluidic chip and how to build a capillary electrophoresis system in the lab. It presents a simple method for the analysis of nucleic acids in the lab.

Amplifikation von Escherichia coli in einem Continuous-Flow-PCR-Mikrofluidik-Chip und deren Detektion mit einem Kapillarelektrophorese-System

Polymerase chain reaction (PCR) is a traditional method employed for the amplification of a target gene that has played an important role in biomolecular ...

Biotechnik

Detection of Live Escherichia coli O157:H7 Cells by PMA-qPCR

A unique open reading frame (ORF) Z3276 was identified as a specific genetic marker for E. coli O157:H7. A qPCR assay was developed for detection of E. coli O157:H7 by targeting ORF Z3276. With this assay, we can detect as low as a few copies of the genome of DNA of E. coli O157:H7. The sensitivity and specificity of the assay were confirmed by intensive validation tests with a large number of E. coli O157:H7 strains (n = 369) and non-O157 strains (n = 112). Furthermore, we have combined propidium monoazide (PMA) procedure with the newly developed qPCR protocol for selective detection of live cells from dead cells. Amplification of DNA from PMA-treated dead cells was almost completely inhibited in contrast to virtually unaffected amplification of DNA from PMA-treated live cells. Additionally, the protocol has been modified and adapted to a 96-well plate format for an easy and consistent handling of a large number of samples. This method is expected to have an impact on accurate microbiological and epidemiological monitoring of food safety and environmental source.

Detection of Live Escherichia coli O157:H7 Cells by PMA-qPCR

A qPCR assay was developed for detection of Escherichia coli O157:H7 targeting a unique genetic marker, Z3276. The qPCR was combined with propidium monoazide (PMA) treatment for live cell detection. This protocol has been modified and adapted to a 96-well plate format for easy and consistent handling of numerous samples

Erkennung von Live-<em&gt; Escherichia coli</em&gt; O157: H7-Zellen durch PMA-qPCR

A unique open reading frame (ORF) Z3276 was identified as a specific genetic marker for E. coli O157:H7. A qPCR assay was developed for detection of E. ...

Eine Duplex-Digital-PCR-Assay für Simultaneous Quantifizierung der

Zusammenfassung

Weitere Videos entdecken

Kapitel in diesem Video